ID: 917106489

View in Genome Browser
Species Human (GRCh38)
Location 1:171497710-171497732
Sequence CTTTGAAAGGCGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149308
Summary {0: 1, 1: 85, 2: 2518, 3: 32671, 4: 114033}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917106489_917106495 -8 Left 917106489 1:171497710-171497732 CCTCCCACCTTCGCCTTTCAAAG 0: 1
1: 85
2: 2518
3: 32671
4: 114033
Right 917106495 1:171497725-171497747 TTTCAAAGTGCTGGTATTACAGG 0: 11
1: 891
2: 25812
3: 331961
4: 259755
917106489_917106499 22 Left 917106489 1:171497710-171497732 CCTCCCACCTTCGCCTTTCAAAG 0: 1
1: 85
2: 2518
3: 32671
4: 114033
Right 917106499 1:171497755-171497777 CACTGCGCGTGGCCCTAATCGGG 0: 1
1: 0
2: 2
3: 25
4: 223
917106489_917106498 21 Left 917106489 1:171497710-171497732 CCTCCCACCTTCGCCTTTCAAAG 0: 1
1: 85
2: 2518
3: 32671
4: 114033
Right 917106498 1:171497754-171497776 CCACTGCGCGTGGCCCTAATCGG 0: 1
1: 0
2: 8
3: 98
4: 471
917106489_917106496 11 Left 917106489 1:171497710-171497732 CCTCCCACCTTCGCCTTTCAAAG 0: 1
1: 85
2: 2518
3: 32671
4: 114033
Right 917106496 1:171497744-171497766 CAGGTGTAAGCCACTGCGCGTGG 0: 1
1: 215
2: 6410
3: 37678
4: 101304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917106489 Original CRISPR CTTTGAAAGGCGAAGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr