ID: 917109366

View in Genome Browser
Species Human (GRCh38)
Location 1:171529401-171529423
Sequence CTGTGGGTATGCAGGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917109366_917109371 7 Left 917109366 1:171529401-171529423 CCACCTTTCCTGCATACCCACAG 0: 1
1: 0
2: 1
3: 36
4: 289
Right 917109371 1:171529431-171529453 TCTCCTGTCTTTCCCATTTCAGG 0: 1
1: 1
2: 5
3: 42
4: 388
917109366_917109373 13 Left 917109366 1:171529401-171529423 CCACCTTTCCTGCATACCCACAG 0: 1
1: 0
2: 1
3: 36
4: 289
Right 917109373 1:171529437-171529459 GTCTTTCCCATTTCAGGTAATGG 0: 1
1: 2
2: 11
3: 81
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917109366 Original CRISPR CTGTGGGTATGCAGGAAAGG TGG (reversed) Intronic
900130168 1:1084063-1084085 CGTGGGGTCTGCAGGAAAGGAGG - Intronic
900566261 1:3333481-3333503 ATGTGGAGATGCAGGAAAAGGGG + Intronic
903455674 1:23484765-23484787 CTGGGCGTACGCAGCAAAGGAGG - Intergenic
904474616 1:30756962-30756984 CTGTGAGTCACCAGGAAAGGAGG + Intronic
904570547 1:31461061-31461083 CTGTGGATGTGAAGGTAAGGAGG + Intergenic
904748459 1:32725709-32725731 ATGTGGGTATGCAGCCCAGGAGG - Intergenic
904843261 1:33388120-33388142 TGGTGGGCATTCAGGAAAGGTGG - Intronic
905498833 1:38419671-38419693 CTTTGGTTTTGCTGGAAAGGAGG - Intergenic
906054504 1:42904654-42904676 ATGTGGGTCTGAAGTAAAGGTGG + Intergenic
906130387 1:43452145-43452167 CTGTGGGTGTGCGGAGAAGGGGG - Exonic
906637818 1:47421381-47421403 CTGTAGGGAAGCAGGGAAGGTGG + Intergenic
907756272 1:57313751-57313773 CTGTGTGTTTGCAGGAAGAGGGG - Intronic
907931049 1:59000499-59000521 CTGTGGAGGTGCAGGCAAGGTGG - Intergenic
907949659 1:59170055-59170077 CTGGTGGTATGCAGGAGAGGTGG - Intergenic
910218194 1:84863583-84863605 ATGTGGATATGAAGGAGAGGAGG - Intronic
910781889 1:90947017-90947039 CTGTGTGGATGAAGGCAAGGAGG + Intronic
912359129 1:109080126-109080148 GGGTGGGGATGCAGGAAACGAGG + Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913120720 1:115737934-115737956 AGGTGGGTAGGCAGGAAAAGTGG + Intronic
913272714 1:117109805-117109827 CAGTGGGTGAGCTGGAAAGGTGG + Intergenic
914920051 1:151840202-151840224 CTGTGTTTATCCAGGAAAAGAGG - Exonic
914986681 1:152463821-152463843 GTGTGTGTGTGTAGGAAAGGGGG - Intergenic
915031930 1:152887005-152887027 CTATGGGTCTGCAGGAATGGTGG + Intergenic
915040588 1:152965278-152965300 CTGTGGATATTGAGCAAAGGAGG + Intergenic
915735305 1:158080864-158080886 CTGTGGGTAAGCAGGTACGCAGG - Intronic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
916962509 1:169903582-169903604 CTGGGGGTAAGGAGGAATGGGGG + Intergenic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
918462315 1:184789300-184789322 CTGTGGGTATGCACAAATGATGG + Intergenic
918481813 1:184986184-184986206 CTGTGGTTAGGGAAGAAAGGAGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923146877 1:231204256-231204278 CTGGGGGTAAACGGGAAAGGAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924759973 1:246974828-246974850 CGGTGGGTCAGCAGGAGAGGTGG - Intronic
924819424 1:247474276-247474298 CTGTGGTGATTCTGGAAAGGGGG + Intergenic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
1063015582 10:2073749-2073771 ATGTGGGTATGGAGTCAAGGTGG - Intergenic
1063157240 10:3391013-3391035 ATGTGGGGATGGAGGAATGGGGG + Intergenic
1063264649 10:4434427-4434449 CTGGGGGTATGCAGGAGGGTGGG - Intergenic
1065253105 10:23836916-23836938 CTGTGGGAAGGAAGGAAGGGAGG + Intronic
1068496099 10:57786948-57786970 ATGTGGGTAAGAAGGAAAGGAGG - Intergenic
1069605904 10:69738396-69738418 CTGTGGCTGAGCAGGAAGGGAGG + Intergenic
1069966637 10:72123515-72123537 CTGTGCGTGTGCAGGGATGGGGG + Intronic
1071573956 10:86712369-86712391 CTGGAGGGAGGCAGGAAAGGTGG + Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1074978082 10:118596737-118596759 CTGTGGGTGTTCAGTCAAGGAGG - Intergenic
1075079803 10:119375739-119375761 CTGTGGGCATGCCGGGGAGGTGG + Intronic
1075339311 10:121632903-121632925 CAGTGGGTTTGCAGGCCAGGAGG + Intergenic
1076538184 10:131196355-131196377 CTGTGCATTTGCAGGGAAGGTGG + Intronic
1076898978 10:133327860-133327882 CTGTGGGGACTCAGGACAGGAGG - Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1079244371 11:18742258-18742280 CCATGGGTCTGCAGGAGAGGTGG - Exonic
1079493715 11:21017179-21017201 ATGTTGGGAGGCAGGAAAGGAGG + Intronic
1084073421 11:66753205-66753227 GTGTGTGTATGCAGGCAAGCAGG + Intronic
1084085585 11:66853627-66853649 CTGCGGGGAGGCAGGAAGGGTGG - Intronic
1084134603 11:67167347-67167369 CTGATGGTATGCAGGAAGGCAGG + Intronic
1084172063 11:67405572-67405594 CTGTGGGTAGCCAGGAAGGTGGG - Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1086261201 11:84943381-84943403 ATGTGGGAATGCAGGAAGGCAGG - Intronic
1088228323 11:107645566-107645588 CTTTGGGAAGCCAGGAAAGGTGG - Intronic
1088815956 11:113421090-113421112 CTGGAGGTATGGAGGAGAGGTGG - Intronic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1090244010 11:125202865-125202887 CTGGGGGTAGAGAGGAAAGGTGG - Intronic
1091904017 12:4168283-4168305 CTGTGGCCATGCAAGAAGGGTGG + Intergenic
1092046510 12:5434761-5434783 CTGTGTGTGTGAGGGAAAGGTGG + Intronic
1095662639 12:44755548-44755570 CTGTGGCTATACAGGTAAAGTGG - Intronic
1095947973 12:47764610-47764632 ATGTGGGTAACCAGGAAAGCAGG + Intronic
1096100853 12:48969825-48969847 CTGAGCGGAGGCAGGAAAGGGGG + Intronic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096634601 12:52950140-52950162 ATCTGGGAATCCAGGAAAGGAGG + Intronic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096717288 12:53499275-53499297 CTGTGGGGATGGAGGAACTGGGG - Intronic
1097382160 12:58908090-58908112 CTTTGGGGATGCAGGAAATTAGG - Intronic
1097842292 12:64333256-64333278 CTGCTGGCATGCTGGAAAGGAGG + Intronic
1098465644 12:70783642-70783664 CTCTGGGTCTGCAGGACTGGCGG + Intronic
1099017677 12:77364287-77364309 GTGTTGGAAGGCAGGAAAGGAGG + Intergenic
1099040463 12:77646706-77646728 TTGGGGGTGTGCAGGATAGGAGG + Intergenic
1100574623 12:95878761-95878783 GTGCAGGTAGGCAGGAAAGGGGG - Intronic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101100282 12:101384689-101384711 CTGGGGGCAGGAAGGAAAGGAGG + Intronic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1103479850 12:121244020-121244042 CTATGTGTATGAAGGAAGGGTGG + Intronic
1103564385 12:121808185-121808207 CTGTAGATGGGCAGGAAAGGGGG - Intronic
1103633112 12:122278968-122278990 CTGAGGGTTTGAACGAAAGGAGG + Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1106393313 13:29356556-29356578 ATGTGGGTGGACAGGAAAGGGGG + Intronic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1106913372 13:34486721-34486743 CTGTGTGTGTGCAGGATATGTGG - Intergenic
1107703295 13:43072056-43072078 CTGTGAGTATGCAGGAATGCGGG - Intronic
1108980660 13:56508820-56508842 CTGCAGGTAGGCAGGAAAGAAGG + Intergenic
1111642096 13:90981486-90981508 GTGTGGGTGTGCTGGAGAGGGGG - Intergenic
1113960916 13:114125758-114125780 CTGTGTTCACGCAGGAAAGGAGG - Intronic
1114189413 14:20429485-20429507 CTGGAGGTAAGCAGGCAAGGGGG - Exonic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1115661925 14:35504274-35504296 ATGTGTGCATGCATGAAAGGTGG - Intergenic
1117447551 14:55819096-55819118 CAGTGGGAATGCACGAAAGAAGG + Intergenic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119642528 14:76325919-76325941 CTGTGGGTGTGCAGCACAGGCGG - Intronic
1120322376 14:82980705-82980727 CTGTGGGTTTCAGGGAAAGGGGG + Intergenic
1121044199 14:90776032-90776054 CTCTGTGTATGCAGAAAAGAAGG + Intronic
1121450067 14:94001383-94001405 CCAGGGCTATGCAGGAAAGGGGG - Intergenic
1121947494 14:98137066-98137088 CTCTGGGTATGCATGTTAGGGGG + Intergenic
1122891728 14:104735142-104735164 CTGTGTGTGAGCAGGAAAGGGGG + Intronic
1125184841 15:36918640-36918662 CCATGGGTGTGCAGAAAAGGTGG + Intronic
1125889988 15:43258710-43258732 CTGTGGTGCTGCAGGACAGGAGG - Intronic
1127221794 15:56887595-56887617 GTGTGGGGAGGAAGGAAAGGTGG + Intronic
1128673608 15:69593226-69593248 CTGTGGGTGGTCAGAAAAGGAGG + Intergenic
1128870909 15:71154621-71154643 CTGCGGGTAAGCAGGAAGGCTGG + Intronic
1128992747 15:72274062-72274084 GTGGTGGTATGCTGGAAAGGGGG - Intronic
1129270540 15:74417211-74417233 CTGGGGCCATGCAGGAAAGCAGG - Intronic
1129882666 15:79017451-79017473 CTGTAGGTCTGCAGGATAGTGGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130898149 15:88186594-88186616 CTCTGGGGCTGCAGGAAAGCAGG - Intronic
1131442498 15:92469530-92469552 CTGTGAGACAGCAGGAAAGGAGG + Intergenic
1131898216 15:97057524-97057546 CTGTGTTCATGTAGGAAAGGTGG - Intergenic
1132771772 16:1567543-1567565 CTGTGGATGAGCAGGGAAGGAGG - Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1134805124 16:17117884-17117906 CGGTGGGTATGCAGAAGTGGGGG - Exonic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1138190545 16:55010272-55010294 GTTTGGGTATGAAGAAAAGGTGG + Intergenic
1139643601 16:68311106-68311128 CGCTGGGTATGCTGGGAAGGTGG + Intronic
1139721502 16:68859692-68859714 CTGTGGGAAGGCAGAAAATGTGG + Intronic
1140132973 16:72180283-72180305 CTGTGGCTTTGCAGAAAAGCAGG - Intergenic
1141725129 16:85782881-85782903 CAGGGAGAATGCAGGAAAGGAGG - Intronic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1143137427 17:4719696-4719718 ATGTGGGTGAGCAGGAAAGGAGG + Intronic
1144032660 17:11336325-11336347 ATGTGGGTATGGGGTAAAGGAGG + Intronic
1144131872 17:12254136-12254158 CAGTGGGTGTGCACGTAAGGTGG - Intergenic
1144249435 17:13400717-13400739 ATGGGGGTGAGCAGGAAAGGAGG + Intergenic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1147306151 17:39565793-39565815 ATGTTGGTATCCAGGAGAGGGGG + Intergenic
1148137113 17:45300645-45300667 CTGTGGGCAGGCAGAAAAGGAGG - Intronic
1148451825 17:47783554-47783576 CTGTTGGTTTGCTGGAGAGGCGG - Intergenic
1148784293 17:50137923-50137945 ATGGGGGTATGCAGGAGAGGAGG - Intronic
1149485076 17:57036316-57036338 CTTTGGAAATGCAGGAAAAGAGG + Intergenic
1150033544 17:61767903-61767925 CAGTGGGTATTAAAGAAAGGTGG - Intronic
1150161054 17:62898458-62898480 TTGTGGGAGTGCAGGAGAGGTGG + Intergenic
1151735573 17:75938083-75938105 CTTTGGGGATGCAGGATGGGAGG + Intronic
1152640260 17:81446385-81446407 CTGTGGGTAACCAGAAAAGGGGG - Intronic
1154004535 18:10515772-10515794 CTGTGGGGATGCTGGAGATGAGG + Intergenic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1155038810 18:22047610-22047632 ATTTGGGTAAGCAGGAAATGCGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1157316219 18:46592221-46592243 GTGTGGGTATCCAGGAAACCAGG - Intronic
1157824353 18:50799480-50799502 ATGTGGATAAGCAGGAGAGGTGG + Intronic
1158538354 18:58328974-58328996 CCCTGAGCATGCAGGAAAGGGGG - Exonic
1161233509 19:3187053-3187075 GCGTGGGTATGCATCAAAGGCGG - Intronic
1161701748 19:5799731-5799753 GTGTGGGTATGCATGAATGTTGG + Intergenic
1161970853 19:7579283-7579305 GTGTGGGAAGGCAGGAAAGAGGG - Intergenic
1162131273 19:8527484-8527506 CTGTGGGGATGCAGGATTAGAGG + Intronic
1163128032 19:15254968-15254990 CTTTGGGGAAGGAGGAAAGGCGG - Intronic
1163397090 19:17070012-17070034 CTGTGGGGATTCAGGCAGGGAGG - Intronic
1165706754 19:37981774-37981796 CCGTGAGTATTTAGGAAAGGAGG + Intronic
1167032915 19:46975355-46975377 CTGAGGGTGCGCAGGAGAGGAGG + Intronic
1167277992 19:48550407-48550429 CTGATGGTAAGCAGAAAAGGAGG - Intergenic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
925027264 2:619946-619968 CTGTGGGCATGCAGGAAGAGGGG + Intergenic
925097657 2:1220186-1220208 CTGTGGGGCCTCAGGAAAGGGGG + Intronic
925273580 2:2633124-2633146 CTGTGGGGCTGTAGGAAAAGCGG + Intergenic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
926104426 2:10141551-10141573 CTGTGGTTGTGCTGGAATGGAGG + Exonic
926176621 2:10598453-10598475 CTGTGGGAATACAGGGAATGTGG + Intronic
928098876 2:28423308-28423330 CTGCAGGTGTGCAGGAAAGGTGG + Intergenic
928286317 2:29992991-29993013 CGGTGGGGATCCAGGAAAAGTGG + Intergenic
928659543 2:33487446-33487468 ATTTGGGTGTGCAGGAAAGGAGG + Intronic
929904897 2:46037023-46037045 CTGTGGGAAGGCAGGCGAGGAGG - Intronic
930195781 2:48508531-48508553 TTGTTGGAATGCAGGAAAGGGGG + Intronic
931808197 2:65828407-65828429 TTCTGGGCATGCAGGAAAAGAGG + Intergenic
933811900 2:86037869-86037891 CTGTTACTATGCAGGAATGGAGG - Intronic
935419175 2:102848931-102848953 TTGTGAGGAAGCAGGAAAGGGGG - Intergenic
937129222 2:119494677-119494699 CTCCTGGTCTGCAGGAAAGGTGG + Intronic
939685551 2:145194728-145194750 CTGGGGGTAAGCAGCTAAGGTGG + Intergenic
941274998 2:163479917-163479939 AGTTGGGTATGCTGGAAAGGTGG + Intergenic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
942464478 2:176193038-176193060 CTGTGTTTATACAGGAAAAGAGG + Intergenic
946026456 2:216674623-216674645 CTGAAGATATCCAGGAAAGGGGG - Exonic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946306004 2:218857464-218857486 GTGTATGTTTGCAGGAAAGGTGG + Intergenic
947903980 2:233746267-233746289 CTGTGGGGATTCAAGGAAGGTGG + Intronic
948043425 2:234923390-234923412 CAGTGGGTGTGCTGGAAAGGTGG + Intergenic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948608645 2:239152757-239152779 CTGTAGGCATGGAGGCAAGGAGG + Intronic
1170935483 20:20805663-20805685 TTGTGGGTATGCAGGCAATAGGG + Intergenic
1171017874 20:21557967-21557989 CTGTGGCTGTGCAGGAAGGTGGG + Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1173654860 20:44692992-44693014 CTGTGAGTAGGCAGTGAAGGTGG - Intergenic
1174891345 20:54398457-54398479 GTGTGGGTACCCAGAAAAGGCGG + Intergenic
1175281104 20:57804734-57804756 CTGAAGGCTTGCAGGAAAGGAGG - Intergenic
1175306001 20:57975905-57975927 CTGAGGCCATGAAGGAAAGGAGG + Intergenic
1177406333 21:20673219-20673241 CTGAGGCTATGCAGGATAGCAGG - Intergenic
1178341706 21:31791092-31791114 CTGTGGGTGTCCAGTAAATGTGG - Intergenic
1179168968 21:38957975-38957997 CTGTGGGCATGGAGTAAATGGGG + Intergenic
1179833642 21:44013232-44013254 CTTTGTGTATGCATTAAAGGAGG - Intronic
1179967709 21:44816958-44816980 CTGGGGGTGTGATGGAAAGGGGG + Intronic
1180589128 22:16921329-16921351 CTCTGGGTCTGCAGAACAGGAGG - Intergenic
1181320757 22:22004318-22004340 CTGTGGGTGGGTAGGAAAGGGGG - Intergenic
1182582255 22:31321293-31321315 GGGTGGGAATGCAGGAGAGGTGG - Intergenic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184835651 22:47019553-47019575 GTGTGGGTGTGCAGGGAGGGAGG + Intronic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
949821868 3:8124384-8124406 CTGTGAATATTCATGAAAGGGGG + Intergenic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
950967737 3:17157583-17157605 GTGTGTGTCCGCAGGAAAGGAGG + Intronic
952980121 3:38727536-38727558 CTGTGGCTCTGCAGGGATGGTGG + Intronic
953060214 3:39421728-39421750 CTGTTAGTATGGAAGAAAGGAGG - Intergenic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953988292 3:47462863-47462885 CTATGGGGAAGCAGGAAGGGAGG - Intronic
955319646 3:57965063-57965085 CTGTGGGTCTACAGGTAAGTGGG + Intergenic
956621466 3:71225239-71225261 CTGTGGCTATCCAGGCAAAGGGG - Intronic
957243476 3:77688900-77688922 CTGTAGAAATGCAGGAGAGGAGG + Intergenic
957676427 3:83372793-83372815 CTATGCATATGCAGGAAAAGGGG + Intergenic
958637801 3:96766879-96766901 ATGTGGGTAGGAAGGAGAGGAGG - Intergenic
961106076 3:124242761-124242783 CTGTGGATATGCAGGACAACAGG + Intronic
961769009 3:129234674-129234696 CTGTTGGTATGCAGGAATTCAGG - Intergenic
965419091 3:168434866-168434888 CTGTGGGTATCCATAAAGGGTGG - Intergenic
965514681 3:169608307-169608329 ATAGGGGTATGCAGGAAAGCTGG - Intronic
965762308 3:172092678-172092700 CTGTGGGTGTCCTGGAAAAGAGG + Intronic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
966133002 3:176665838-176665860 GTGTGGATATGGAGGAAAAGTGG - Intergenic
968656998 4:1782990-1783012 CATGGGGCATGCAGGAAAGGGGG + Intergenic
973605074 4:52578646-52578668 CTGGAGGAATGAAGGAAAGGAGG + Intergenic
974022976 4:56707978-56708000 TTGTAGGAATGAAGGAAAGGAGG + Intergenic
978051963 4:104212154-104212176 CTGTGGGTATGTAGTATAGTGGG - Intergenic
978415683 4:108473603-108473625 CTCTGGGTAGGAAGGCAAGGGGG + Intergenic
978556744 4:109989117-109989139 CTGTGTGTATAAAGAAAAGGAGG + Intronic
980183051 4:129425768-129425790 TTGTGTGTATGCAGGAGATGAGG - Intergenic
982086501 4:151841581-151841603 CTGTGGGGATGCTGCACAGGAGG - Intergenic
984837748 4:184038272-184038294 CTGTGTGTATACGGGAAAGATGG - Intergenic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
985434413 4:189915268-189915290 CTCAGGGTAGGCAGGTAAGGTGG - Intergenic
985995155 5:3593626-3593648 CTGTGGGGAGGCAGGAATAGGGG - Intergenic
986017611 5:3771317-3771339 CTGTGGCTGTGCAGGAATGTCGG - Intergenic
988135703 5:27168625-27168647 ATGTGGGTATGAAGTATAGGAGG - Intergenic
990637445 5:57745005-57745027 GTGTGTGTATGTAAGAAAGGAGG - Intergenic
991627677 5:68621106-68621128 CTGTGTGTATATAGGAGAGGAGG + Intergenic
992304170 5:75418805-75418827 CAGTGGCTATTCAGGAATGGGGG + Intronic
992330558 5:75713696-75713718 CTGTAAATAAGCAGGAAAGGAGG + Intronic
993275399 5:85850501-85850523 CTGTGGTTATGCAGGGCAGGGGG + Intergenic
997303660 5:132823872-132823894 CTGTGGGGAGGCTGGAGAGGAGG - Exonic
997778643 5:136634747-136634769 CTGTGGGTATTCAGGATGGAGGG + Intergenic
1000267527 5:159652066-159652088 CTGTGGATATGCAGAACTGGGGG - Intergenic
1001020130 5:168175723-168175745 CTGGGGTTATGCTGGAAAAGAGG + Intronic
1001706455 5:173744470-173744492 CTGTGGGTATTCTACAAAGGGGG - Intergenic
1002417422 5:179127780-179127802 CGGTGGGTGGGCAGGAAGGGGGG - Intronic
1002877051 6:1220014-1220036 CTGTAGGTATGAAGGTAGGGAGG + Intergenic
1002915296 6:1524003-1524025 CTGTGTGAATGCAGGGAAAGCGG + Intergenic
1004394966 6:15239632-15239654 CTGTGAGTAGGCAGGGAAAGGGG - Intergenic
1004771292 6:18785553-18785575 CTGTGTGTATGTAGGTATGGGGG - Intergenic
1005690146 6:28297024-28297046 GTGTGGGTCTGTAGGAAACGTGG - Intronic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1011925078 6:92632698-92632720 CTGAGGGTTTGCAGCAAATGGGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1015847924 6:137540706-137540728 CTGTGTGTAGGAAGGAGAGGAGG + Intergenic
1016683132 6:146853373-146853395 CTGGGGGTCTGGAGGAAATGAGG - Intergenic
1017318612 6:153062267-153062289 CTGGGGGTAGGGAGGAGAGGTGG - Intronic
1017739461 6:157394151-157394173 CGGTGGGTAGGCGGGAAGGGTGG - Intronic
1019437780 7:1030830-1030852 CTGTGGGAAAGCAGGCATGGTGG - Intronic
1020883293 7:13791364-13791386 CTGTAGGCAGGCAGGAAAGAGGG - Intergenic
1022010273 7:26302687-26302709 TTGTGGGTATGCAGCAAAAGTGG - Intronic
1023495656 7:40793181-40793203 CTCTGGGTTTGCAGAAGAGGTGG + Intronic
1023741727 7:43287258-43287280 CTGTGGAGATGCTGGAATGGAGG + Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1025700118 7:63810983-63811005 CTGTGGCTATTCAGGAAAATGGG + Intergenic
1026385173 7:69839688-69839710 GTGGGGGTATTCAGGAAAGCAGG + Intronic
1026589295 7:71681518-71681540 CTGTGGGTATCCTAGGAAGGTGG - Intronic
1028621881 7:92835256-92835278 TTGGGGGGATGCAGGACAGGCGG - Intronic
1029702776 7:102258605-102258627 CTGTGGGGAACCAGGAATGGTGG + Intronic
1031184589 7:118460482-118460504 CTGTGGGAAGGCAGGAAATAAGG - Intergenic
1032092349 7:128917300-128917322 CTGTGGACATGCAGGAGATGGGG - Intergenic
1032451873 7:132038439-132038461 CTGTGGCTGGGCAGGAAAAGTGG - Intergenic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033547844 7:142418171-142418193 GTGTGGCTGTGCAGGAAAAGTGG + Intergenic
1034526878 7:151670211-151670233 CTGGGGGTATGGAGCAGAGGAGG - Intronic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1036560680 8:9898481-9898503 CTGGGGGTATCCGGGAGAGGAGG + Intergenic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036890955 8:12596821-12596843 ATGTGGGTAGGCAGGTCAGGTGG - Intergenic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1040057714 8:43074892-43074914 TTGTGGGTATGTGGGACAGGTGG - Intronic
1040311223 8:46237860-46237882 CTGTGAGAATGCAGGAATGCTGG + Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045414540 8:101952976-101952998 CCGTGGGGATGAAGGAAAGGAGG - Intronic
1045535927 8:103027839-103027861 CTGTGTGTGTGCAGGGAGGGTGG - Intronic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1048878776 8:138856950-138856972 ATGGGGACATGCAGGAAAGGTGG - Intronic
1049139058 8:140934932-140934954 CTGTGTTTATGCAGAAAAGGAGG + Intronic
1049196037 8:141316174-141316196 CTGTGGAAATGCGGGGAAGGGGG + Intergenic
1049761859 8:144335401-144335423 CTGTCAGCATGCAGGAGAGGGGG - Intronic
1050830701 9:10008546-10008568 CTGTGAATATGCATGAAATGGGG - Intronic
1051114162 9:13674947-13674969 CAGAGGCTATGCAGGAAATGGGG + Intergenic
1051114278 9:13675954-13675976 CAGAGGCTATGCAGGAAATGGGG - Intergenic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053555406 9:39132269-39132291 TTGTGGGGATTCCGGAAAGGAGG + Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053819524 9:41952520-41952542 CTGTGGGGATTCCGGAAAGGAGG + Intronic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1054109792 9:61096173-61096195 CTGTGGGGATTCTGGAAAGGAGG + Intergenic
1054611065 9:67234952-67234974 CTGTGGGGATTCTGGAAAGGAGG - Intergenic
1054931788 9:70642677-70642699 GCGAGGGTAAGCAGGAAAGGAGG - Intronic
1056889956 9:90482707-90482729 ATGTGGGCATGAAGGACAGGAGG - Intergenic
1059324762 9:113497452-113497474 ATGCCGCTATGCAGGAAAGGAGG - Intronic
1060987975 9:127830790-127830812 CTCAGGGACTGCAGGAAAGGTGG - Intronic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061518448 9:131103171-131103193 CTGTAGGTGACCAGGAAAGGCGG + Intronic
1186559482 X:10595658-10595680 CTGAGGGTATGGGGGAAGGGAGG + Intronic
1186795669 X:13044505-13044527 CGGTGGGGATGCGGGGAAGGCGG - Intronic
1187371201 X:18707846-18707868 CTGTGGTTATGAATGAAAAGGGG + Intronic
1187546223 X:20255317-20255339 CTGGGGGAATGGAGGAAATGGGG + Intronic
1191953761 X:66622452-66622474 GTATGGGTAGGCAGGAAAGAAGG + Intronic
1193963027 X:87948589-87948611 CTGTGTTTGTTCAGGAAAGGGGG - Intergenic
1195119559 X:101736617-101736639 CTGTAGGGATCCAGGAAAGATGG + Intergenic
1195255970 X:103091561-103091583 CTGTGGGTGGGCAGGGTAGGGGG + Intronic
1198500317 X:137238217-137238239 AAGTGGGTAGGCAGGAAGGGAGG - Intergenic
1200745485 Y:6900268-6900290 CTGTGGGCAGGCGGGCAAGGAGG + Intergenic
1201369932 Y:13252643-13252665 CTGTGGGTTTACAGGAATGAGGG + Intronic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic