ID: 917111799

View in Genome Browser
Species Human (GRCh38)
Location 1:171556358-171556380
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1252
Summary {0: 3, 1: 51, 2: 142, 3: 281, 4: 775}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917111799_917111811 5 Left 917111799 1:171556358-171556380 CCCCCCACCCCTTGTGCTTCCTG 0: 3
1: 51
2: 142
3: 281
4: 775
Right 917111811 1:171556386-171556408 GGCAATGCCCTGCCCTGCTTTGG 0: 30
1: 336
2: 2185
3: 1433
4: 1212
917111799_917111817 20 Left 917111799 1:171556358-171556380 CCCCCCACCCCTTGTGCTTCCTG 0: 3
1: 51
2: 142
3: 281
4: 775
Right 917111817 1:171556401-171556423 TGCTTTGGCTCACCCTCCGTGGG 0: 49
1: 263
2: 533
3: 981
4: 1057
917111799_917111816 19 Left 917111799 1:171556358-171556380 CCCCCCACCCCTTGTGCTTCCTG 0: 3
1: 51
2: 142
3: 281
4: 775
Right 917111816 1:171556400-171556422 CTGCTTTGGCTCACCCTCCGTGG 0: 49
1: 266
2: 534
3: 972
4: 1120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917111799 Original CRISPR CAGGAAGCACAAGGGGTGGG GGG (reversed) Intronic
900038968 1:441115-441137 CGGGAAGTGCAAGGGGTTGGGGG + Intergenic
900060400 1:676091-676113 CGGGAAGTGCAAGGGGTTGGGGG + Intergenic
900183127 1:1321128-1321150 GAGGCAGCACAGGGGGCGGGGGG - Intronic
900414441 1:2528565-2528587 CCGGAAGAACAGGGGGAGGGAGG - Intergenic
901461685 1:9395742-9395764 CAGAAAGCACCAGGGGTTGCAGG + Intergenic
901469845 1:9448636-9448658 CAGGCAGCCCAGGGAGTGGGAGG + Intergenic
901480353 1:9520739-9520761 CAGGAAGCACAGGGAGGGGAAGG - Intergenic
901817585 1:11803620-11803642 CAGCCAGCACAAGGGGGCGGGGG + Intronic
901822666 1:11840233-11840255 CAGGCAGCACCAGGAGAGGGTGG - Exonic
901884105 1:12210747-12210769 CAGGAGGAAGTAGGGGTGGGGGG - Intergenic
901929952 1:12590804-12590826 CTGGAAGCAGAAGGGCTGGTAGG - Intronic
902535183 1:17115601-17115623 CAGGGCTCACAAGAGGTGGGTGG + Intronic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
902965228 1:19996109-19996131 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
903566981 1:24275010-24275032 CAGGAAGTACAAGGGATTGGGGG - Intergenic
903994635 1:27298097-27298119 CATGAAGCGCAAGTGGTGAGTGG + Exonic
905356684 1:37389809-37389831 CAGGATGCAGAAGGGCCGGGTGG - Intergenic
905408520 1:37753284-37753306 CGGGATGCACGAGGGGGGGGCGG + Intronic
905905000 1:41612114-41612136 CAGGAGGCAGAAAGGGTGAGAGG - Intronic
906150211 1:43583237-43583259 CAGGCAGGACCAGGGATGGGTGG + Intronic
906515937 1:46438802-46438824 CAGGGAGCACAGGGAGTAGGAGG + Intergenic
906570165 1:46831109-46831131 CAGGAAGCAGAAGGGGTCGGGGG - Intergenic
906639316 1:47432206-47432228 CATGCAACACAAGGCGTGGGTGG + Intergenic
907079903 1:51611727-51611749 CTGGAAGGTCAAGGGGTGGGGGG + Intronic
908178390 1:61579087-61579109 CGGGAAGTGCAAGGGGTCGGGGG - Intergenic
908290051 1:62656777-62656799 CAAGAAGCCCTAGGGGTGGGAGG + Intronic
908576740 1:65467974-65467996 CGGGAAGCGCAAGGGGTCAGGGG - Intronic
908733268 1:67248921-67248943 CAGGAAGCACAAGGGGCTGGGGG - Intronic
908821687 1:68093535-68093557 CGGGAAGTGCAAGGGGTTGGCGG - Intergenic
909301110 1:74014540-74014562 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
909397015 1:75181633-75181655 CAAGAAGTACAAGGGGTTTGGGG - Intergenic
909448985 1:75777776-75777798 AAGGAAGCGCAAGGGGTTGGGGG + Intronic
909457138 1:75862219-75862241 CGGAAAGCACAAGGGGTGGGGGG - Intronic
909807947 1:79894533-79894555 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
910374182 1:86551445-86551467 CAGGAAACACAAGAGGGGTGAGG + Intronic
910618865 1:89230720-89230742 CAGAAAGGACAAGGGGTTAGGGG - Intergenic
910626863 1:89316514-89316536 CAGGAAGTGTAAGGAGTGGGGGG + Intergenic
910956846 1:92715668-92715690 CAGTAAGCACAAGGCTTCGGGGG + Intronic
911079727 1:93916581-93916603 CAGGAAGCACAAGGGGTCAGTGG - Intergenic
911120679 1:94293416-94293438 CAGGAAGTGCAAAGGGTCGGGGG - Intergenic
911218031 1:95216788-95216810 CAGGAAGCGCAAGGGGTCAGGGG - Intronic
911268360 1:95771163-95771185 CAGGAAGCTCAAGGGGTCTTTGG - Intergenic
911339297 1:96617791-96617813 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
911342053 1:96651440-96651462 CGGGAAGCGCAAGGGGTCGGGGG + Intergenic
911399540 1:97358009-97358031 TGGGAAGCACAAGTGGTTGGGGG + Intronic
911700813 1:100949948-100949970 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
912225744 1:107732420-107732442 CAAGAAGCTCAAGGGGTTGGGGG + Intronic
912463185 1:109851244-109851266 CAGGAAGCACAAGGGGTCAGAGG + Intergenic
912535455 1:110365693-110365715 CAAGAATGACAAGGGATGGGAGG - Intronic
912646140 1:111393943-111393965 CGGAAAGCACAAGGGGTTGGGGG + Intergenic
913191362 1:116416009-116416031 CAGGACACAGAAGGGTTGGGGGG + Intergenic
913408049 1:118517721-118517743 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
913473615 1:119215347-119215369 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
913485147 1:119327232-119327254 AAGGAAGCACAAGCAGTAGGGGG + Intergenic
913512458 1:119574056-119574078 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
913526368 1:119697321-119697343 CGGGAAGCACAAGGGGTAGGAGG - Intronic
913607373 1:120478344-120478366 TGGGAAGCGCAAGGGGTTGGGGG + Intergenic
914209059 1:145561795-145561817 CGGGAAGTGCAAGGGGTTGGGGG - Intergenic
914267978 1:146054161-146054183 CGGGAAGTGCAAGGGGTTGGGGG - Intergenic
914458703 1:147861813-147861835 CGGGAAGTTCAAGGGGTTGGGGG + Intergenic
914807183 1:151000202-151000224 CAGGAAGCAGATGGGTTTGGTGG - Intronic
915314998 1:155023499-155023521 CAGGAAGCACAGAGGGTGGGTGG - Intronic
915912709 1:159924526-159924548 CAGGAGGCACAGGGCGCGGGGGG + Intronic
916038414 1:160941837-160941859 TGGAAAGCACAAGGGGTTGGGGG - Intergenic
916379631 1:164195484-164195506 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
917111799 1:171556358-171556380 CAGGAAGCACAAGGGGTGGGGGG - Intronic
917125437 1:171683379-171683401 CAGGAATCACAAGCTCTGGGTGG - Intergenic
917308823 1:173656039-173656061 TGGGAAGCACAAGGGGTCAGGGG - Intronic
917743653 1:177986208-177986230 CAGGAAGCACAAGGGGTCGGGGG + Intergenic
917904026 1:179572002-179572024 CAGGAAGCACAAGGGGTCGGGGG - Intronic
918537156 1:185586586-185586608 TGGGAAGCACAAGGGGTCAGGGG + Intergenic
918616613 1:186551245-186551267 CAGGAAGTGCAAGGAGTCGGGGG - Intergenic
919436746 1:197572124-197572146 CGGGAAGCACAAGGGGTTGGGGG + Intronic
919778417 1:201208366-201208388 CAGGAAGCAAAGTGGGTGAGGGG + Exonic
919849819 1:201665113-201665135 AAGGAAGAACCATGGGTGGGAGG - Intronic
920305391 1:205015191-205015213 CAGGAAGGACTGGGGGTGGGTGG + Intronic
920387746 1:205580469-205580491 CAGGAAGCAGGAGAGGTGAGGGG - Intronic
920428629 1:205899488-205899510 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
920588782 1:207196144-207196166 CGGGAAGCACAAGAGGTCGGGGG + Intergenic
920944361 1:210514699-210514721 CAGAAAGGACAAGGGGGGTGAGG + Intronic
921004099 1:211075789-211075811 CAGGAAGTGCAAGGGATCGGGGG + Intronic
921340032 1:214125381-214125403 CAGGAAGCTCAAGCTATGGGTGG - Intergenic
921383927 1:214551310-214551332 CAGGAGGCGAAAGGGGAGGGAGG + Intronic
921759408 1:218895693-218895715 CAGGAATAACAAGTGGTGGGTGG + Intergenic
922471324 1:225879184-225879206 CAGGAAGGAGGAGGGGTAGGTGG - Intronic
922796761 1:228343314-228343336 GAGGAAGCACCAGGCCTGGGAGG + Intronic
923067049 1:230527530-230527552 CAGGAAGTACAAGGGGTCAGGGG - Intergenic
923194489 1:231652024-231652046 CAGGAAGCACAAGGGGTCAGGGG - Intronic
923345000 1:233043059-233043081 CAGAAAGCAGAAGGCGTTGGAGG - Intronic
923478138 1:234356716-234356738 GATGAAGCAGAAGGAGTGGGTGG + Intergenic
923853355 1:237820405-237820427 CAGGAAGCACAAGGGGTTGGGGG + Intronic
924064610 1:240208508-240208530 CAGGAAGCAGAGGGGGCGGTGGG - Exonic
924581838 1:245330400-245330422 CAGCAGGGACAACGGGTGGGTGG + Intronic
924721720 1:246629234-246629256 CAGAAAGAACATGGGGTTGGAGG - Intronic
1063003251 10:1944540-1944562 CAAGGAGCACCAGGTGTGGGAGG - Intergenic
1063105295 10:2987099-2987121 AAGGCAGGACCAGGGGTGGGAGG + Intergenic
1063114413 10:3063881-3063903 GAGGAAGACCGAGGGGTGGGGGG + Intergenic
1063570552 10:7211137-7211159 TAGAAAGCACCTGGGGTGGGCGG + Intronic
1064146952 10:12833290-12833312 CACCAGGCACACGGGGTGGGGGG + Exonic
1064518673 10:16177529-16177551 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
1065231077 10:23599047-23599069 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1065236541 10:23658196-23658218 CAGAAAGCAAAAGGGATGGAAGG - Intergenic
1065427345 10:25619365-25619387 CGGAAAGCACAAGGGGTTGGGGG + Intergenic
1065799094 10:29334833-29334855 TGGGAAGCGCAAGGGGTTGGGGG + Intergenic
1066006147 10:31147782-31147804 TAGGAAGCCCAAGGGGAGGATGG + Intergenic
1066615459 10:37289020-37289042 CAGGAAGTGCAAGAAGTGGGGGG - Intronic
1066751233 10:38659369-38659391 GGGAAAGCACAAGGGGTTGGGGG + Intergenic
1066965812 10:42263722-42263744 CGGGAAGCACAAGGGGTTGGGGG - Intergenic
1067127640 10:43533415-43533437 CGGGAAGCAAAAGGGGTCAGGGG - Intergenic
1067147035 10:43701505-43701527 CAGGAAGAACAAGGGCTGGACGG - Intergenic
1067193321 10:44091099-44091121 CAGGAAGCACAAGGGGTCCGGGG + Intergenic
1067209765 10:44250162-44250184 CAGGAAGCACAAGGGGGTCAGGG - Intergenic
1067231152 10:44411654-44411676 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1067236450 10:44454459-44454481 CGGGAAGCACAAGGGGTTGGAGG - Intergenic
1067335419 10:45358932-45358954 CCGGAAGCACAAGTGATTGGGGG + Intergenic
1067539647 10:47142270-47142292 CAGGAAGGCCCTGGGGTGGGTGG - Intergenic
1067775144 10:49158537-49158559 AAGGAAGCACAACGTGTGTGCGG + Intronic
1068210077 10:53909714-53909736 CAGGAAGCAAAAGGGGTTGGGGG + Intronic
1068239614 10:54288571-54288593 CAGGAAGCACAAGGGGTCAAGGG + Intronic
1068495319 10:57779029-57779051 AGGGAAGCACAAGGGGTTGGGGG + Intergenic
1068534780 10:58229868-58229890 AGGGAAGCACAAGGAGTTGGGGG + Intronic
1068651573 10:59528379-59528401 CAGGAAGTACAAGGGGTCAGGGG + Intergenic
1068759337 10:60690292-60690314 CGGGAAGCACAAGGGGTCAGGGG + Intronic
1068789189 10:61008836-61008858 CAGGAAGTGCAAGGGGTCAGGGG - Intergenic
1068866198 10:61897715-61897737 GAGGAAAGAAAAGGGGTGGGGGG + Intergenic
1069259901 10:66382139-66382161 CGGGAAGCACAAGGGGTCAGCGG + Intronic
1069264621 10:66442870-66442892 CGGGAAGCGCAAGGGGTCAGGGG + Intronic
1069300306 10:66899559-66899581 CAGGAAGTGCAAGGGTTCGGAGG + Intronic
1069708232 10:70472661-70472683 TGGGAAAGACAAGGGGTGGGAGG - Intergenic
1069734585 10:70645418-70645440 GGGGAAGCACAAGGGGTCAGGGG - Intergenic
1070003054 10:72395490-72395512 TGGGAAGCACAAGGGGTCAGGGG + Intronic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070393681 10:75993064-75993086 CAGGAATCACAAGGGCTGAGAGG - Intronic
1070412947 10:76160974-76160996 AAGCAACCGCAAGGGGTGGGAGG + Intronic
1070807217 10:79277659-79277681 CAGGAAGGCCACGGGGTTGGTGG + Intronic
1071066756 10:81644902-81644924 TGGGAAACACAAGGGGTTGGGGG - Intergenic
1071698517 10:87903782-87903804 CAGGAAGCACAAGGGGTCGGGGG - Intronic
1071794314 10:88989314-88989336 AAGGAAGGAAAAGGGGTGTGAGG - Intronic
1071844287 10:89505633-89505655 CAGGAAGCTCAACGGGTCAGGGG + Intronic
1072370212 10:94758363-94758385 CAGAAAGCACAAGAGGTTGGGGG - Intronic
1072380031 10:94858459-94858481 TGGGAAGCACAAGAGGTTGGGGG - Intergenic
1072394345 10:95023435-95023457 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1072480587 10:95807444-95807466 TGGGAAGCACAAGGGGTTGGGGG - Intronic
1072516252 10:96186157-96186179 CAGGAAGTACAAGGGGTCAGGGG - Intronic
1072775097 10:98182974-98182996 CAGGAAGCGCAAGCGGTCAGGGG - Intronic
1072831587 10:98663997-98664019 CTAGAAGCAGCAGGGGTGGGTGG - Intronic
1073444186 10:103571133-103571155 CAGGAAGCAGGAGGCGGGGGCGG - Intronic
1073745840 10:106467412-106467434 CGGGAAGCACAAGGGGTCAGGGG + Intergenic
1073998155 10:109339567-109339589 CAGGAAGCACAAGGGGCCGGGGG - Intergenic
1074017109 10:109545520-109545542 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1074117843 10:110470972-110470994 CAGGAAGCACAAGGGATCAGAGG - Intergenic
1074631488 10:115259551-115259573 CGGGAAGCACAAGGGGTTGGGGG - Intronic
1075394606 10:122117917-122117939 CAGCAAGCCCAAGGGATGGAGGG - Intronic
1075707379 10:124509803-124509825 CGGGAAGCAGCAGGGCTGGGTGG - Intronic
1075805384 10:125184918-125184940 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1076159224 10:128229516-128229538 CAGGAAGCACAAGGGGTTAGGGG - Intergenic
1076293183 10:129363456-129363478 CAGGAAGGAGAAGGGATGGATGG - Intergenic
1076296414 10:129388698-129388720 AAGGAAGACCATGGGGTGGGTGG - Intergenic
1076397836 10:130154269-130154291 CAGGAAGCGCAAGGGGTTGGAGG - Intronic
1076425269 10:130363111-130363133 CAGGCAGCATGGGGGGTGGGAGG + Intergenic
1076590986 10:131581906-131581928 TGGGAAGCACAGGGGGTTGGGGG - Intergenic
1076888943 10:133274697-133274719 CAGGCAGCAAAGGAGGTGGGTGG + Intronic
1076965176 11:77026-77048 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1077068130 11:653872-653894 CCAGGAGCACAAGGGGAGGGAGG + Intronic
1077075282 11:698271-698293 CAGGAAGCCCGAGGAGTGAGTGG - Intronic
1077353415 11:2103548-2103570 CAGGAAGCCCACTGGGAGGGTGG - Intergenic
1077387037 11:2274745-2274767 CAGAAAGCACCAAGTGTGGGCGG - Intergenic
1077462626 11:2718229-2718251 GAGCAAGCACAAGGTGTGTGAGG - Intronic
1077537698 11:3132377-3132399 CAGGAAGTCCAAGGGATGGGGGG - Intronic
1077714515 11:4568245-4568267 TAAGAAGTACATGGGGTGGGTGG + Intergenic
1078168766 11:8912465-8912487 AAGGAAGCACTAAGGGTTGGGGG - Exonic
1078321591 11:10339804-10339826 CAGGAAGCACAAGGGGTCGGGGG + Intronic
1078388441 11:10913627-10913649 CAGGAAGGAAAAAGGGAGGGAGG - Intergenic
1078482600 11:11691726-11691748 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1078530357 11:12132123-12132145 CAGGAAGCAGAGGTGGTAGGAGG - Intronic
1078560382 11:12366144-12366166 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1078796829 11:14600677-14600699 TGGGAAGCACAAGGGGTCAGGGG - Intronic
1078846710 11:15125076-15125098 AAGGGAGCTCCAGGGGTGGGAGG + Intronic
1079333060 11:19549404-19549426 GAGAAAGCACAAGGTGGGGGAGG - Intronic
1079408043 11:20162520-20162542 CGGGGAGAAAAAGGGGTGGGGGG - Intergenic
1079577796 11:22025167-22025189 CAGGAAGCACAAGGGGTAGGGGG + Intergenic
1079654022 11:22965845-22965867 TGGGAAGCACAAGGCGTTGGGGG - Intergenic
1080033688 11:27688668-27688690 CAGGAAGCGCAAGGGGTCAGGGG - Intronic
1080042069 11:27769470-27769492 CAGGGTGCAGAAAGGGTGGGAGG + Intergenic
1080235872 11:30067558-30067580 CGGGAAGCACAAGGGGTTGGGGG - Intergenic
1080346885 11:31335337-31335359 CCGGAAGTGCAAGGGGTCGGGGG - Intronic
1080489502 11:32747881-32747903 CAGGAAGCGCAAGAGGTCAGGGG - Intronic
1081143853 11:39536741-39536763 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
1081241444 11:40711128-40711150 CGGGAAGCGAAAGGGGTCGGGGG - Intronic
1081324631 11:41729227-41729249 CAGGAAGTGCAAGGGGTCGGGGG - Intergenic
1081565614 11:44259140-44259162 CAGGAAGAAGCAGGGGTGTGAGG + Intergenic
1082860184 11:57848035-57848057 GGGGAAGCTCAAGGGGTTGGGGG + Intergenic
1082995287 11:59249510-59249532 CAGCAAGCACTATGGGTGGAAGG - Intergenic
1083296752 11:61719140-61719162 AAGGAAGCAGCATGGGTGGGAGG - Intronic
1083525552 11:63361377-63361399 AAGCAAGCAGAAGGAGTGGGTGG + Intronic
1083531541 11:63427969-63427991 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1083641165 11:64146165-64146187 CAGGAAACTCAAGGGCAGGGAGG + Intronic
1083722800 11:64611754-64611776 CAGGAAGCAGCTGGGGTTGGAGG - Intronic
1083771863 11:64872037-64872059 AAGGAAGCAGAGGGAGTGGGAGG + Intronic
1083854012 11:65383260-65383282 GAGAAAGCAGCAGGGGTGGGTGG - Intronic
1083964481 11:66035025-66035047 CAGGTGGCACAAGGGGAAGGGGG + Intergenic
1084020447 11:66414121-66414143 GAGGAAGCACAGGGGCTGGGGGG + Intergenic
1084541249 11:69788430-69788452 CACGAACCCCAAGAGGTGGGCGG + Intergenic
1084612140 11:70210041-70210063 CAGGTAGCAGAAGAGGTGGATGG - Intergenic
1084646512 11:70461999-70462021 CAGGAACAAAATGGGGTGGGTGG - Intergenic
1084836656 11:71806968-71806990 CCAGAAACACAGGGGGTGGGAGG + Intergenic
1085019728 11:73198119-73198141 CAGGAACTAGAAGGGGAGGGTGG + Intergenic
1085800682 11:79586277-79586299 GAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1086086104 11:82956644-82956666 CAGGAAGCAAAAGGGGTCAGGGG - Intronic
1086117289 11:83266314-83266336 CTGGAAGCGCAAGGGGTCAGCGG + Intronic
1086298197 11:85395463-85395485 CAGGAAGTGCAAGGGGTAAGGGG + Intronic
1086506322 11:87508184-87508206 CAGGAAGCACAAGGGGTGTGGGG - Intergenic
1086612899 11:88778388-88778410 TGGGAAGCGCAAGGGGTTGGGGG - Intronic
1086644966 11:89209147-89209169 TGGGAAGCACAAGGGGTTGGGGG + Intronic
1086732969 11:90271489-90271511 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1087151099 11:94860619-94860641 CAGAAAGCAAACTGGGTGGGAGG - Intronic
1087364228 11:97198656-97198678 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1087484827 11:98748065-98748087 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1087686675 11:101273149-101273171 CAGCAAGCAGAAGAGGTGGGGGG - Intergenic
1088197691 11:107293904-107293926 CAGGAAATGCAAGGGGTAGGGGG + Intergenic
1088381091 11:109193283-109193305 CAGGAAGCACAAGGGGTCCAGGG - Intergenic
1088735328 11:112723734-112723756 CAGGAAGGGTAAGGGGAGGGAGG + Intergenic
1088891636 11:114049330-114049352 CAGGAAGGGCAGGTGGTGGGAGG - Intergenic
1089270088 11:117296152-117296174 CAGGAAGAAGAAGGGATGAGAGG - Intronic
1089360830 11:117885397-117885419 CAGAAATCACAAGGGATGGATGG - Intergenic
1089780306 11:120869124-120869146 CTGCAGGCACAAGGGTTGGGAGG + Intronic
1089875996 11:121722754-121722776 CAGGAAGCGGCGGGGGTGGGGGG + Intergenic
1089977040 11:122741815-122741837 CAGGAAGCAGAACCCGTGGGAGG - Intronic
1090103808 11:123830155-123830177 CAGGAAGCGCAAGGGGTCGGGGG - Intergenic
1090431742 11:126652230-126652252 CACAAAGAACAAGGGGTGGGGGG - Intronic
1090922797 11:131221673-131221695 TAGGAAGCACAAGGTGGGTGAGG + Intergenic
1091109038 11:132948274-132948296 CAGGAGGCAGAAGGAGTGAGAGG + Intronic
1091421289 12:342983-343005 CTGGAAGAACAAGGGGTCAGAGG + Intronic
1091867228 12:3851317-3851339 CAGGAAGCACAAGGGATTGGGGG + Intronic
1092402579 12:8189137-8189159 CCAGAAACACAGGGGGTGGGAGG - Intergenic
1092443760 12:8534001-8534023 AAGGAAGCCCCAGGGATGGGTGG + Exonic
1092784542 12:12015508-12015530 CAGGACGCAGCAGGGCTGGGAGG + Intergenic
1092900434 12:13054725-13054747 CAGTGAGGCCAAGGGGTGGGTGG + Intronic
1092923756 12:13255995-13256017 CAGGGAGGAGAAGGGGAGGGAGG + Intergenic
1093004349 12:14035657-14035679 CGGGAAGCACAAGGGGTGGGGGG + Intergenic
1093085967 12:14867281-14867303 CAGGAAGTGCAAGGGGTCAGGGG - Intronic
1093191740 12:16082614-16082636 AAGAAAGCACAAGGGGTGGGAGG - Intergenic
1093677606 12:21962385-21962407 CAGGGAGCACAAGGGGTCAGGGG + Intergenic
1094311795 12:29092555-29092577 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1094453220 12:30604023-30604045 CGGGAAGTGCAAGGGGTTGGGGG + Intergenic
1094482358 12:30894984-30895006 CGGGAAGCACAAGGGGTCAGGGG - Intergenic
1095128282 12:38508060-38508082 CAGGAAGGGCAAGGGGTCGGGGG + Intergenic
1095706476 12:45242508-45242530 CAGGAAGCACAAGGGGTCGGGGG - Intronic
1095793828 12:46195887-46195909 CAGGAAGCACAAGGGGTCAGGGG - Exonic
1095830981 12:46586269-46586291 TGGGAAGCACAAGGGGTTAGGGG - Intergenic
1095831534 12:46591927-46591949 CAGGAAGTGCAAGGAGTTGGGGG - Intergenic
1095845231 12:46737169-46737191 TGGGAAGCACAAGGGGTCAGGGG + Intergenic
1095940815 12:47725561-47725583 CAGGAAGAAAAAGGGGAGGGAGG + Intronic
1096006830 12:48180281-48180303 CAGGAAGCAGAAGCTGTGCGGGG + Intronic
1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG + Intronic
1096227978 12:49881597-49881619 CAGGAAGCACGAGGGTCGGGCGG - Intronic
1096428004 12:51520658-51520680 CAGGAAGCTGCAGGTGTGGGAGG + Intergenic
1096448522 12:51717080-51717102 CAGGAAGCAGAAGGAGTGAGGGG - Intronic
1096460305 12:51818526-51818548 CAGAAAGCAACGGGGGTGGGGGG + Intergenic
1097301400 12:58023086-58023108 CATGAAGCACAAGGGGTTGGGGG - Intergenic
1097435638 12:59549619-59549641 AGGGAAGCACAAGGGGTTGGGGG - Intergenic
1097552837 12:61098076-61098098 CAGGAAGCAGAAGAGGTGAGGGG - Intergenic
1097912194 12:64982296-64982318 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1098151954 12:67555984-67556006 TGGGAAGCACAAGGGGTAGGGGG - Intergenic
1099317447 12:81102443-81102465 CAGGAAGCATAAGTGGGGGAGGG + Intronic
1099428307 12:82551146-82551168 CAGGAAGCACAAAAGGGTGGGGG - Intergenic
1099491960 12:83299629-83299651 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1099522445 12:83681419-83681441 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1100375172 12:94008265-94008287 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1100652408 12:96604912-96604934 CAGAAAGCACAAGGGTTTGGGGG - Intronic
1100713276 12:97279903-97279925 CAGGAATTGCAAGGAGTGGGTGG + Intergenic
1100896195 12:99185625-99185647 CTGGAAGTGCAAGGGGTCGGGGG + Intronic
1100900771 12:99238106-99238128 CAGGAAGTGCAAGGGGTTGGGGG + Intronic
1101815211 12:108140846-108140868 CACGATGCCCAGGGGGTGGGAGG - Intronic
1101826740 12:108226201-108226223 CAGGGAGAACTAGGGGTGGTGGG + Intronic
1101889895 12:108703844-108703866 CAGGAGGAACAAGGGGCTGGAGG - Intronic
1102460960 12:113099389-113099411 CAGGAAGAACCAAGGCTGGGTGG - Exonic
1102875933 12:116448774-116448796 CAGGATACACATGGGGTAGGTGG - Intergenic
1103255464 12:119538351-119538373 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
1103509143 12:121462351-121462373 CAGAAAGCCCAGGGGATGGGAGG + Intronic
1104053413 12:125211428-125211450 CAGGAAGCCCACAGGGTTGGAGG - Intronic
1104141741 12:125993714-125993736 CAGTAAACTCTAGGGGTGGGGGG + Intergenic
1104807684 12:131599889-131599911 CATGATGGACACGGGGTGGGGGG - Intergenic
1105201340 13:18182346-18182368 CAGGAAGTACAAGGGGTTGGGGG + Intergenic
1105474825 13:20720762-20720784 CCGCAAGCACAAGAGGTGGCTGG + Intronic
1105585028 13:21735872-21735894 CAGGAAGCATAAGGTGGGGATGG + Intergenic
1105789048 13:23779671-23779693 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1106095058 13:26636445-26636467 CAGGAAACACAAGGGGTCAGGGG - Intronic
1106412893 13:29523489-29523511 CTAGAAGCACAAGGGGTCAGCGG + Intronic
1106816846 13:33418146-33418168 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1107267932 13:38579601-38579623 CAGGAAGCAAGAGAGATGGGAGG - Intergenic
1108217657 13:48200938-48200960 TGGGAAGCACAAGGGGTCAGGGG + Intergenic
1108471780 13:50774202-50774224 CAGGAAGCTCAAGGGGTTGGGGG - Intronic
1108988731 13:56628883-56628905 CAGGAAGCACAAGGGGTCAGAGG + Intergenic
1109358553 13:61266848-61266870 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1109385956 13:61629254-61629276 CGGGAAGTGCAAGGGGTCGGGGG - Intergenic
1109669392 13:65585353-65585375 CAGGAAGCTCAAGTGGTCGCGGG + Intergenic
1109675940 13:65675759-65675781 CTGGAAGCACTAGGGGTCGGGGG - Intergenic
1109806610 13:67452458-67452480 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1109816197 13:67588525-67588547 CAGGAAGCAGAAGGGGTTGGGGG + Intergenic
1110071524 13:71184471-71184493 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
1110818512 13:79887238-79887260 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1111647239 13:91046609-91046631 CAGGAAGCATCAGGGGTAAGGGG - Intergenic
1112232355 13:97602051-97602073 CAGGAAGCGCAAGGTGTCAGGGG + Intergenic
1113044890 13:106145418-106145440 AAGCAGGCCCAAGGGGTGGGAGG - Intergenic
1113300962 13:109018755-109018777 CAGGAAGTGCAAGGGGTCGGGGG - Intronic
1113348818 13:109508241-109508263 CAGGAAGCGCAAGGGGTCGGGGG - Intergenic
1113449577 13:110397726-110397748 CAGGAAGGAGAGGGAGTGGGTGG + Intronic
1114603754 14:23978606-23978628 CAGGAAGCACAAGGGGTCAGAGG + Intronic
1114608766 14:24021380-24021402 CAGGAAGCACAAGGGGTCAGAGG + Intergenic
1114630328 14:24155384-24155406 CAGGATGCAGAGGTGGTGGGTGG - Intronic
1114695550 14:24623973-24623995 CAGAAAGTGCAAGGAGTGGGGGG - Intergenic
1114964337 14:27939141-27939163 CAGGAAGCACAAGGGATTTGGGG + Intergenic
1115349595 14:32379540-32379562 CAGGAAGCCCAAGGAGAGGAGGG - Intronic
1115833120 14:37364070-37364092 CAGGAAGCGCAAGGGGTCAGGGG - Intronic
1115843629 14:37501805-37501827 TGGGAAGCACAAGGTGTCGGGGG + Intronic
1115940409 14:38602089-38602111 CAGGAAGCACAAGAGGTTGGGGG - Intergenic
1116212741 14:41968742-41968764 CAGGAAGCTCAAGGGGTTGAAGG - Intergenic
1116433666 14:44873892-44873914 CGGGAAGTGCAAGGGGTTGGGGG - Intergenic
1116792705 14:49356776-49356798 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1117005715 14:51419114-51419136 CAGGAAGCGTAAGGAGTTGGGGG - Intergenic
1117081655 14:52157952-52157974 TGGGAAGTGCAAGGGGTGGGGGG + Intergenic
1117170010 14:53084833-53084855 CAGGAGGCGCAAGGGGTCTGGGG + Intronic
1117172754 14:53117352-53117374 CAGGAAGCAGAAAGGGTCAGGGG + Intronic
1117511344 14:56454649-56454671 TGGGAAGTGCAAGGGGTGGGGGG + Intergenic
1117614489 14:57519498-57519520 CAGAAAGTGCAAGGGGTTGGGGG - Intergenic
1117624146 14:57618419-57618441 CAAGAAGCAGAAGGGGTCGGGGG + Intronic
1117797063 14:59405675-59405697 CGGGAAGCACAGGGGGTCAGGGG - Intergenic
1118005553 14:61561852-61561874 GAGGAAGCACAGGGGCTGTGGGG + Intronic
1118494629 14:66295977-66295999 CGGGAAGCACAAGGGGTCGGGGG + Intergenic
1118559914 14:67067889-67067911 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
1118865983 14:69703979-69704001 GAGGAAGCAGTAAGGGTGGGAGG - Intronic
1119930598 14:78542623-78542645 CAGGAAGTGCAAGGGGTCAGGGG - Intronic
1120065733 14:80038984-80039006 CGGGAAGCTCAAGGGGTCAGGGG + Intergenic
1120559673 14:85974993-85975015 CGGGAAGCACAAGGGGTTGGGGG - Intergenic
1120619934 14:86750937-86750959 TGGGAAGCACAAAGGGTTGGAGG - Intergenic
1120649206 14:87111087-87111109 AAGGAAGCAGAAAGGGAGGGAGG - Intergenic
1121701397 14:95957033-95957055 CAGGGAGCACAAAAGGTGTGGGG - Intergenic
1121735757 14:96216926-96216948 CAGAAAGCCCAAGGAGTGAGGGG + Intronic
1121915372 14:97833032-97833054 CAGTGAGCACAAGGGCAGGGTGG + Intergenic
1122625491 14:103083522-103083544 CAGGAAGCAGGGGGGGGGGGGGG - Intergenic
1122655731 14:103258293-103258315 CAGGACCCAGATGGGGTGGGCGG + Intergenic
1123144292 14:106112986-106113008 TAGGATGCATCAGGGGTGGGAGG + Intergenic
1123773028 15:23548279-23548301 CAGGAGGCAGAGGGAGTGGGAGG - Intergenic
1123804887 15:23860646-23860668 CAGAAAGCTCGAGGGCTGGGAGG + Intergenic
1124530413 15:30500579-30500601 TAGGAAGCAAAAGGGGAGGCAGG - Intergenic
1124724700 15:32145856-32145878 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
1124768246 15:32507109-32507131 TAGGAAGCAAAAGGGGAGGCAGG + Intergenic
1124778762 15:32610068-32610090 CAGGAAGCTCTAGAGCTGGGAGG + Intergenic
1124885680 15:33683692-33683714 CAGGAAGCACAAGGGGTCGGGGG + Intronic
1124918011 15:33995889-33995911 CTGGAAGCGCAAGGGGTCAGGGG + Intronic
1124948438 15:34292949-34292971 CAGGAAGCACAAGGGGTCGGGGG - Intronic
1125051740 15:35306883-35306905 CAGGAAGCAAAAAGACTGGGTGG + Intronic
1125219835 15:37320143-37320165 CGGGAAGTGCAAGGGGTTGGGGG + Intergenic
1125352190 15:38779513-38779535 TGGGAAGTACAAGGGGTAGGGGG - Intergenic
1125779531 15:42252182-42252204 CAGGAAGCGCAAGGGGTCGGGGG - Intronic
1125837342 15:42764314-42764336 CGGGAAGCATAGGGGGTTGGGGG + Intronic
1125984691 15:44038736-44038758 CGGGAAGCACGAGGGGTCAGGGG + Intronic
1126087079 15:45021021-45021043 CGGGAAGCGCAAGCGGTTGGGGG - Intergenic
1126350777 15:47742825-47742847 CAGGAAACACAGAGGGTGTGGGG - Intronic
1126443942 15:48720937-48720959 CACAAAGCACATGGGATGGGTGG - Intronic
1126476293 15:49068734-49068756 CAGGAAGTGCAAGGGGTCGGGGG + Intergenic
1127179409 15:56399167-56399189 CGGGAAGTGCAAGGGGTTGGGGG + Intronic
1127339517 15:58026576-58026598 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1127452618 15:59131511-59131533 CGGGAAGCGCAAGGGGTCGGAGG + Intergenic
1127525054 15:59784618-59784640 CGGGAAGCGCAAGGGGTCGGGGG - Intergenic
1127570587 15:60237354-60237376 CAGGAAGCACAAGTGGTTGGGGG + Intergenic
1128339870 15:66813934-66813956 CGGGAAGCGCAAGGGGTTGGGGG - Intergenic
1129173340 15:73821454-73821476 CAGGAAGCATAAGCGGTGGCTGG - Intergenic
1129333028 15:74837448-74837470 AAGGCAGCACAAGGGATGAGAGG + Intronic
1129335132 15:74847530-74847552 CAAGAAGCATGAGGGGTGGTGGG + Intronic
1129460073 15:75696175-75696197 CAGGAGGGGGAAGGGGTGGGAGG - Intronic
1129602450 15:77008176-77008198 AGGGAAGCACAGGGTGTGGGTGG + Intronic
1129697893 15:77750994-77751016 CAGGAAGAACAAGGGCAGCGTGG + Intronic
1129739368 15:77982613-77982635 GAGGAAGACCAAGGGGCGGGGGG - Intergenic
1129879200 15:78996005-78996027 CAGGAAGCCCAGGGGCTGAGAGG - Intronic
1130202975 15:81850606-81850628 CAGGAGGCAGAAGGGGTGAGGGG + Intergenic
1130231515 15:82100820-82100842 CAGAAAGCACAGGGTGAGGGAGG - Intergenic
1130703703 15:86211775-86211797 CAGGAAGTGCAAGGGGTCAGGGG - Intronic
1131057760 15:89385785-89385807 CAGGAACCATAAGAGGTGAGTGG - Intergenic
1132248307 15:100314970-100314992 AAGGAGGCACAAGGAGTGAGGGG + Intronic
1132287970 15:100679493-100679515 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1132387438 15:101410359-101410381 CCTGAAGCAGAAGGGCTGGGAGG + Intronic
1132404912 15:101536268-101536290 CAGGCAGCACTGGGGGTGTGGGG + Intergenic
1132442950 15:101886492-101886514 CGGGAAGTGCAAGGGGTTGGGGG - Intergenic
1132582694 16:692803-692825 CAGGAAGCTCCAGGGCTGAGTGG - Exonic
1132736203 16:1387382-1387404 CAGGAAGTGCAAGGGATAGGGGG - Intronic
1134039675 16:11058971-11058993 CAGAAAGCCCAAGACGTGGGTGG - Intronic
1134312932 16:13092756-13092778 CAAGAAGCACAAGGGGTTGGGGG - Intronic
1135068916 16:19335341-19335363 CAGGAACCAGAAGGGGTGGACGG + Intergenic
1135301795 16:21334977-21334999 TGGGAAGCGCAAGGGGTTGGGGG - Intergenic
1135512040 16:23094054-23094076 CGGGAAGCTCAAGGGGTCGGGGG + Intronic
1135525429 16:23210231-23210253 CAGCAACCACAAGGGGAGGTGGG + Intronic
1135633891 16:24057638-24057660 TAGGAAGCACATGCTGTGGGAGG + Intronic
1136276973 16:29184617-29184639 CAGGAAGCACCAGGACTGGGTGG + Intergenic
1136705879 16:32187934-32187956 CGGGCGGCACAAGGGGTGGGGGG - Intergenic
1136731492 16:32417736-32417758 CGGGAAGCACAAGGGGTTGGGGG - Intergenic
1136762033 16:32741471-32741493 CGGGAGGCACAAGGGGTGGGGGG + Intergenic
1136806067 16:33128917-33128939 CGGGAGGCACAAGGGGTGGGGGG - Intergenic
1136861957 16:33709993-33710015 CAGGAACCACAGTGGGTGTGGGG - Intergenic
1137051923 16:35721752-35721774 CAGGAAGAGCAAGGGGTCAGGGG - Intergenic
1137471033 16:48758869-48758891 CAAGAAGCATAAGGGGTTGGGGG + Intergenic
1137798679 16:51242869-51242891 GATGAAGCACAAGGGTTGGCTGG + Intergenic
1137978748 16:53052851-53052873 CTGGAAGGGCAAGGGGTGGTGGG - Intergenic
1138260341 16:55615625-55615647 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1138354761 16:56368258-56368280 CAGGAATCACAGGTTGTGGGTGG - Intronic
1138782801 16:59809499-59809521 CGGGAAGCGCAAGGGGTCAGGGG + Intergenic
1139075041 16:63435526-63435548 CAATAAGCACAGGGGGTTGGAGG - Intergenic
1139288893 16:65839551-65839573 CAGGAAGCACACAGGCTGGCGGG + Intergenic
1139852459 16:69959424-69959446 CAGGCACCACAGGGTGTGGGAGG - Intronic
1139881430 16:70182332-70182354 CAGGCACCACAGGGTGTGGGAGG - Intronic
1140035931 16:71371283-71371305 CAGGTAGGGCAGGGGGTGGGAGG + Intronic
1140371079 16:74413172-74413194 CAGGCACCACAGGGTGTGGGAGG + Intronic
1140507473 16:75482823-75482845 CAGGAGGCAACAGGGGTGGGTGG + Intronic
1140695115 16:77525152-77525174 CAGGAAACACAAGTGGTCAGGGG + Intergenic
1141045979 16:80716474-80716496 CTGGATGAACAATGGGTGGGTGG + Intronic
1141572045 16:84940250-84940272 GAGGAAGCATTAGGTGTGGGGGG + Intergenic
1141801307 16:86311238-86311260 CTGGAAGCACTTGGGGAGGGTGG + Intergenic
1142081347 16:88150681-88150703 CAGGAAGCACCAGGACTGGGTGG + Intergenic
1142220401 16:88851567-88851589 CAGGAAGTGCGAGGGGTTGGGGG + Intronic
1142235630 16:88921316-88921338 CAGGCAGCAGAAAGGATGGGCGG + Intronic
1142292736 16:89200385-89200407 CAGGAACCGGAAGGGGTGGGGGG - Intronic
1142356415 16:89603943-89603965 CAGGAAGCACTGGGGGCTGGAGG + Intergenic
1202994900 16_KI270728v1_random:99534-99556 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
1203021587 16_KI270728v1_random:411876-411898 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
1203064192 16_KI270728v1_random:1001787-1001809 CGGGCGGCACAAGGGGTGGGGGG + Intergenic
1203123445 16_KI270728v1_random:1558176-1558198 CAGGAACCACAGTGGGTGTGGGG - Intergenic
1143539288 17:7559713-7559735 CAGGGTGCAGCAGGGGTGGGAGG + Intronic
1143836743 17:9699084-9699106 CAGGAAACGCAAGGCATGGGTGG + Intronic
1144087643 17:11825301-11825323 GAGGAAGCACAATGGGGAGGTGG - Intronic
1144293997 17:13855672-13855694 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1144574515 17:16420447-16420469 CAGGAGGCCTGAGGGGTGGGTGG - Intronic
1144671420 17:17134687-17134709 CAGGAAGGCCATGGGGTGGTGGG - Intronic
1144760024 17:17701855-17701877 CAGGCAGGACCAGGGCTGGGTGG - Intronic
1144836305 17:18158334-18158356 CAGCAAGTAAAAGGCGTGGGCGG + Intronic
1145861185 17:28211743-28211765 TGGGAAGTACAAGGGGTTGGGGG + Intergenic
1146450020 17:32965410-32965432 CAGGAAGATCAAGGGGCAGGAGG + Intergenic
1147121755 17:38339204-38339226 CAGGAGGAATAGGGGGTGGGGGG + Intronic
1147575116 17:41594545-41594567 AAGGAAGCACAGAGGGAGGGAGG + Intergenic
1147971698 17:44221675-44221697 CCTGAAGCAAAAGGGGGGGGGGG + Intergenic
1148157321 17:45431638-45431660 CAGGGAGCCCATGGGCTGGGTGG + Intronic
1148392009 17:47279495-47279517 CAGCAACCACAAAGGGAGGGAGG + Intronic
1148950295 17:51305126-51305148 CAGGAAGCGCAAGGGGTCTGGGG + Intergenic
1149093901 17:52817483-52817505 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1149133719 17:53340069-53340091 CGGGAAGTGCAAGGGGTTGGGGG + Intergenic
1149192939 17:54085827-54085849 CAGAAGGCACAAGGGGTTGGGGG + Intergenic
1149212187 17:54316551-54316573 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1149394544 17:56226111-56226133 TTGGAAGGGCAAGGGGTGGGAGG + Intronic
1149886232 17:60342859-60342881 CAGGAAGCGCAAGGGGTTAGGGG - Intronic
1149932080 17:60767130-60767152 CCGGAAGCGCAAAGGGTCGGGGG - Intronic
1150389018 17:64780360-64780382 CAGGGAGCCCAAGGGCCGGGTGG + Intergenic
1150427168 17:65086100-65086122 CCGGAAGCACAAGGAGGGGCTGG + Intergenic
1150790428 17:68197557-68197579 CAGGGAGCCCAAGGGCCGGGGGG - Intergenic
1151052599 17:70995601-70995623 CAGGAGGCAGAAGGAGTAGGGGG - Intergenic
1151834396 17:76573479-76573501 CAAGAAGCACAGAGGGTGGGAGG + Intronic
1151875806 17:76867772-76867794 CAGGAAGTACGAGGAGGGGGAGG + Intergenic
1152043080 17:77917563-77917585 GAGGAAGGAGAAGGGGGGGGAGG + Intergenic
1152062730 17:78090512-78090534 CTGGAAATACAAGGGGAGGGGGG + Intronic
1152284097 17:79402568-79402590 CAGGAGCCACATGGGGTGGTGGG + Intronic
1152559716 17:81071979-81072001 CCGGAAGCAGAGGGGGAGGGGGG - Intronic
1152983497 18:301288-301310 CAGGAAGGAAAAGGGAGGGGAGG - Intergenic
1153064954 18:1035241-1035263 CAGGAAGCGTAAGGGGTCGGGGG - Intergenic
1153419329 18:4886453-4886475 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
1153441259 18:5122181-5122203 CAGGAAGCGCAAGGGGTTGGGGG + Intergenic
1153478071 18:5518332-5518354 GAGGGAGTACACGGGGTGGGAGG - Intronic
1153895963 18:9560468-9560490 CAGGAAGCAAAATGGATGAGTGG + Intronic
1154019464 18:10650196-10650218 CAGGAAGCACAAGCAGTCAGAGG + Intergenic
1154170393 18:12046920-12046942 CAGGAACCACCACGGGTGTGGGG + Intergenic
1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG + Intronic
1154288609 18:13084559-13084581 CGGGAAGCACAAGGGGTCGGGGG - Intronic
1155006613 18:21735249-21735271 CAGGAAGCACAAGGGGTCAGTGG + Intronic
1155020538 18:21892867-21892889 CAGGAAGATCAAGTGATGGGAGG - Intergenic
1155476910 18:26244504-26244526 CAGGAAGCACAAGGGGGTCAGGG - Intronic
1155512999 18:26595937-26595959 CAGGAAGCTGAGGAGGTGGGAGG + Intronic
1155659322 18:28228933-28228955 TAGGAAGCACAAGGGGTCGGGGG - Intergenic
1155662238 18:28263160-28263182 AAAGAAAAACAAGGGGTGGGGGG - Intergenic
1155665252 18:28299773-28299795 TGGGAAGCACAAGGAGTTGGAGG - Intergenic
1155778623 18:29801216-29801238 AAAGAAGTACAAAGGGTGGGGGG + Intergenic
1156443882 18:37219763-37219785 CAGGAAGCGCAAGGGGTCGGGGG - Intronic
1157025286 18:43835677-43835699 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1157036722 18:43984167-43984189 CAGGAAGTGCAAGGGTTCGGGGG + Intergenic
1157058285 18:44256232-44256254 CAGGAAGCACAAGGAGTTGGGGG - Intergenic
1157561441 18:48649163-48649185 CGAGAAGCACAAGGGGTCAGGGG + Intronic
1158703674 18:59771541-59771563 CAGGAAGCGCAAGGGGTTGGGGG + Intergenic
1160050812 18:75431541-75431563 CCAGAACCACCAGGGGTGGGAGG - Intergenic
1160295967 18:77637298-77637320 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1160544969 18:79647211-79647233 CAGGAAGGAAAGGGGGAGGGAGG + Intergenic
1160589477 18:79935118-79935140 CAAGATCCTCAAGGGGTGGGAGG + Intronic
1160641981 19:146656-146678 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1160841014 19:1147066-1147088 CAGGGACCCCAAGGGCTGGGCGG + Intronic
1160866672 19:1259326-1259348 CAGGAAGCAGCCAGGGTGGGAGG + Intergenic
1161233402 19:3186578-3186600 CAGGAAGCCTAAGGGGCGGAGGG - Intronic
1162028844 19:7908903-7908925 CAGGCGGCATTAGGGGTGGGAGG - Intronic
1162771055 19:12949528-12949550 CAGGAAGCACAGGGGCGTGGGGG - Intronic
1163031233 19:14545495-14545517 CAGCAAGCCTAGGGGGTGGGGGG + Intronic
1163367731 19:16885289-16885311 CAGGAAGTAGAATGGGTTGGGGG - Intergenic
1163380208 19:16961222-16961244 CGGGAAGCACAAGGGGTCAGGGG + Intronic
1163757100 19:19112594-19112616 CAGGAGAGACAAGGGGTAGGTGG + Exonic
1164085664 19:21899907-21899929 CAAGAAGCACAAGGGGTCAGGGG - Intergenic
1164090957 19:21951856-21951878 TGGGAGGCACAAGGGGTTGGGGG + Intronic
1164152417 19:22566411-22566433 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1164556308 19:29255425-29255447 CAGGAAGCACAAGGGGTTGGTGG - Intergenic
1164582292 19:29442099-29442121 CAGAAACCTCATGGGGTGGGTGG + Intergenic
1164753485 19:30672786-30672808 CAGGAAGTACAAGGAGGGAGTGG + Intronic
1164898797 19:31900409-31900431 AAGGAAGCACAATGGCTGGTAGG - Intergenic
1165642632 19:37403188-37403210 GAGGAAGCCCCAGGGGTGGGAGG - Intergenic
1165819832 19:38667403-38667425 GAAAAATCACAAGGGGTGGGGGG + Intronic
1165914339 19:39248398-39248420 CAGGGGGCACAGGGGCTGGGCGG + Intergenic
1165929096 19:39344482-39344504 CAGGAAGCGCTGGGAGTGGGTGG - Intronic
1165970470 19:39624526-39624548 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1166240246 19:41486538-41486560 CGGGAAGCACAAGGGGTTAGGGG + Intergenic
1166318768 19:42003594-42003616 CCTGAAGCGCAAGTGGTGGGAGG - Exonic
1166960511 19:46493674-46493696 CAGGAAGAAGAAGGGGAGCGCGG - Exonic
1167257907 19:48442345-48442367 CAGGAAGTCCATGCGGTGGGTGG - Exonic
1168119276 19:54242603-54242625 CAGGAGGCACCAGGGCGGGGAGG - Intronic
1168170571 19:54585728-54585750 TGGGAAGCACAAGGGGTCGGAGG - Intronic
1168405330 19:56107640-56107662 AAGGAAGCACACGGGGAGGGGGG + Intronic
1168493979 19:56835173-56835195 CAGGGTGCAGAAGGGGAGGGTGG - Intronic
1168508303 19:56954730-56954752 CAGGAAGCAGAGGGAGTGAGGGG + Intergenic
1202709262 1_KI270714v1_random:8085-8107 CGGGAAGTGCAAGGGGTTGGGGG + Intergenic
925245350 2:2377701-2377723 AGGGAAACAGAAGGGGTGGGAGG + Intergenic
925609680 2:5692635-5692657 CAGGAAGGTGGAGGGGTGGGAGG + Intergenic
925905418 2:8537079-8537101 CAGCAAACACGAGGGGAGGGAGG - Intergenic
926225545 2:10964652-10964674 CAGGAAACAGAAGGGGTGAGAGG - Intergenic
926366620 2:12139412-12139434 CGGGAAGCACAAGGGGTCGGAGG - Intergenic
926469149 2:13231408-13231430 CAAGCAGCACAAGCTGTGGGTGG + Intergenic
926648542 2:15316430-15316452 CAGGAAGTGCAAGGGGTTGGGGG + Intronic
927027913 2:19089444-19089466 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
927410403 2:22818391-22818413 CAGGAAGTACAGGGGATGGTTGG - Intergenic
927779670 2:25929183-25929205 CAGGAAGGGCAAGGGGTGACTGG - Intronic
928331583 2:30361702-30361724 CAGGAAGCATTGGGGGTGGGGGG - Intergenic
928462620 2:31489270-31489292 CAGGAAGCACAAGGGGTGGAGGG + Intergenic
928900812 2:36315809-36315831 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
929570174 2:43017938-43017960 CAGGAAGCAAATGGGCTTGGGGG + Intergenic
929794339 2:45047435-45047457 CAGAGGGCACACGGGGTGGGGGG + Intergenic
929898509 2:45982149-45982171 CTGGAAGCACAAGGTGGTGGCGG - Intronic
930137724 2:47919252-47919274 CTGGAAGCACATGGGCTGTGTGG + Intergenic
930143131 2:47973703-47973725 TGGGAAGCACAAGGGGTCAGGGG + Intergenic
930217034 2:48707961-48707983 CAGGGAGCACAAGGGGTCCAGGG - Intronic
930274789 2:49298651-49298673 CAGGAAGCACAAGGGGTCAAGGG + Intergenic
930634217 2:53787026-53787048 CAGGAGGCTCAAGGGGGCGGAGG + Intronic
930840226 2:55837480-55837502 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
930908946 2:56606761-56606783 CGGGAAGTGCAAGGGGTGGGGGG - Intergenic
931190722 2:59997610-59997632 CAGCAAGGAGAAGTGGTGGGAGG + Intergenic
931204693 2:60136141-60136163 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
931305140 2:61021227-61021249 CAGGAAGCGCAAGGGATTGGGGG + Intronic
931306527 2:61034515-61034537 CAGGAAGCACAAGGGGTCAGGGG + Intronic
931594475 2:63926694-63926716 TGGGAAGCACAAGGGGTCGGGGG + Intronic
931971212 2:67589112-67589134 TGGAAAGCACAAGGGGTCGGGGG + Intergenic
932327982 2:70876075-70876097 CAGGAAGCGCGAGGGGTCGGGGG + Intergenic
932511881 2:72300787-72300809 CAGGAAGTGCAAGGGGTCGGGGG - Intronic
932666871 2:73705206-73705228 CAGGGAGCTCAAGGGCTGAGGGG + Intergenic
933366756 2:81362901-81362923 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
933850272 2:86361131-86361153 CAGGGAGCCCAAGGTGTGGGAGG + Intergenic
933880399 2:86663866-86663888 CGGAAAGCACAAGGGGTCAGGGG + Intronic
934314223 2:91901538-91901560 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
935064880 2:99638756-99638778 CAGGAAAAACAGGCGGTGGGGGG - Intronic
935273967 2:101460179-101460201 CAGGAAGCTCAAGATGTCGGGGG - Intronic
935604761 2:104959552-104959574 CAGGAAGGGCAAGGGGTCTGGGG - Intergenic
936649896 2:114413937-114413959 CAGGAAGCTCAAGGGGTTGGGGG - Intergenic
936775377 2:115965955-115965977 CGGGAAGCACAAGGGGTTTGGGG - Intergenic
937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG + Intronic
937413944 2:121699560-121699582 CAGGAAGCAGACCGGGTGAGCGG + Intergenic
937573442 2:123391555-123391577 CAGAAAGCACAAGGGATTGGGGG + Intergenic
937970881 2:127547938-127547960 AAGGAAGCACCAGGTGTGGATGG - Intronic
938118514 2:128618184-128618206 CAGGAAGCAAGAGAGATGGGAGG - Intergenic
938549153 2:132363969-132363991 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
939019960 2:136946919-136946941 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
940437286 2:153669728-153669750 CAGGAAGCACAAGGGGACAGGGG + Intergenic
940528273 2:154844881-154844903 CAGGAAGCACAAGGGGTCTGGGG - Intronic
940667855 2:156630985-156631007 CAGGAGGCAGACGGAGTGGGAGG + Intergenic
940923731 2:159340203-159340225 TAGGCAGACCAAGGGGTGGGGGG + Intronic
941041488 2:160628518-160628540 CGGGAAGTACAAGGAGTTGGGGG - Intergenic
941523755 2:166581402-166581424 CAAGAAGCACTAGGGGTCAGAGG + Intergenic
941903434 2:170698905-170698927 CAGCAAGCACTGGGGATGGGAGG + Intergenic
942265306 2:174218750-174218772 CAGCAAACCCCAGGGGTGGGAGG + Intronic
942475174 2:176311836-176311858 CAGGAAGCGCAAGGGGTCAGGGG - Intronic
942668864 2:178352295-178352317 CAGGAAGCATGAGGGGTCAGGGG + Intronic
942744083 2:179212205-179212227 TAGGAAGCGCAAGGGGCCGGGGG + Intronic
942779897 2:179629725-179629747 CAGGAAGCACAAGGGGCTGGGGG + Intronic
942873550 2:180765283-180765305 CGGGAAGCACAAGGGGTTAGGGG + Intergenic
942952011 2:181731831-181731853 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
943233582 2:185290027-185290049 TGGGAAGCACAAGGAGTTGGGGG + Intergenic
943359656 2:186902071-186902093 CAGGAAGTGCAAGGGATTGGGGG - Intergenic
943558187 2:189430401-189430423 CAGGAAACACAAGGGGTTGGGGG + Intergenic
943583488 2:189711802-189711824 TGGGAAGCACAAGGGGTTGGGGG + Intronic
943660411 2:190554046-190554068 CGGGAAGCACAAGGGGTCAGGGG + Intergenic
943716754 2:191160752-191160774 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
944033908 2:195269642-195269664 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
944507235 2:200425138-200425160 CAGGAAGCACAAATGGCGGGGGG - Intronic
945161901 2:206900166-206900188 CGGGAAGTGCAAGGGGTAGGGGG - Intergenic
945776720 2:214114741-214114763 CGGGAAGCACAAGGGTTTGGGGG - Intronic
946294499 2:218773188-218773210 CGGGAAGCGCAAGGGGTTGGGGG - Intergenic
946756282 2:222951076-222951098 CAGGAAGCAGCAGGGCTGCGTGG + Intergenic
947440622 2:230118053-230118075 CAGGAAGTGCAAAGGGTTGGGGG - Intergenic
947483548 2:230525620-230525642 CAGGAAGCACAAGGGGTGGGGGG + Intronic
948121738 2:235535944-235535966 CAGGAAGCAGATGGGGCGAGGGG - Intronic
948464401 2:238145313-238145335 CAGGAAGCCCCAGGCCTGGGTGG + Intronic
948558139 2:238831683-238831705 CAGGAGGCAGAAGAGGTGAGAGG + Intergenic
948669964 2:239561895-239561917 GAGGAAGCACACAGGCTGGGCGG + Intergenic
948765630 2:240217305-240217327 CAGGAAAGAAAATGGGTGGGAGG + Intergenic
948865317 2:240772028-240772050 CAGGAGGCACAAAGGTTGGGTGG + Intronic
948888125 2:240893928-240893950 CAGGAAGCCCGAGGGGCTGGGGG + Intronic
948937199 2:241174583-241174605 CAGGAAACAAATGAGGTGGGTGG - Intronic
1169010585 20:2246913-2246935 GAGGAAGCAGATGGGGTGGGAGG - Intergenic
1169012798 20:2264625-2264647 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1169307123 20:4501761-4501783 TGGGAAGCGCAAGGGGTTGGGGG - Intergenic
1169508589 20:6240067-6240089 CAGGAAGCACAAGGGAGCAGTGG - Intergenic
1169645174 20:7802712-7802734 CAGGAAGCACAATGTGTGTGAGG + Intergenic
1169795801 20:9461465-9461487 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1170153512 20:13249336-13249358 CTGGCAGAACTAGGGGTGGGAGG - Intronic
1170176125 20:13471880-13471902 CAGGAAGCGCAAGGGGTCAGAGG + Intronic
1170186155 20:13593415-13593437 CAGGAAGCACAAGGGGTCGGAGG + Intronic
1171204340 20:23267325-23267347 CAGGAAGCTCAGGCAGTGGGAGG - Intergenic
1171247221 20:23621269-23621291 CGGGAAGCACAAGGGGTCAGGGG - Intergenic
1171284774 20:23928202-23928224 CAGGAGGCACAAGGGAGGGTAGG - Intergenic
1172114999 20:32568529-32568551 CAGGAAGAACATGGGGAGGGAGG - Intronic
1172877160 20:38171458-38171480 CAGGAAACACTAGAGGTGGGAGG + Intergenic
1173584781 20:44174396-44174418 CAGGATGCAAAAAGGGTTGGGGG - Intronic
1174224106 20:48982931-48982953 CGGGAAGCGTAAGGGGTCGGAGG - Intronic
1175322003 20:58094749-58094771 CAGGCAGCAGAGGAGGTGGGAGG + Intergenic
1175536404 20:59717632-59717654 CAGGAAGAACACGGGCTGGGGGG - Intronic
1175740703 20:61417917-61417939 CAGAAAACTCAAGGGATGGGAGG - Intronic
1175844646 20:62052040-62052062 CAGGACGCAGAAGGGGAAGGTGG - Intronic
1175871240 20:62210423-62210445 AAGGAAGGAGAGGGGGTGGGGGG + Intergenic
1176126689 20:63478680-63478702 CAGAGCGCACAAGGTGTGGGGGG + Intergenic
1176716605 21:10355642-10355664 CAGGAAGTACAAGGGGTTGGGGG - Intergenic
1179078024 21:38142488-38142510 CAGGAAGCAGAGGGGCTGGGAGG + Intronic
1179300917 21:40109631-40109653 CAGGAAGCACAAGGGTTCAGGGG + Intronic
1179417942 21:41213393-41213415 CAGCAGGCAGAAGGGGTGAGAGG + Intronic
1179486877 21:41716107-41716129 CAGAAACCACAAGGTGGGGGCGG + Intergenic
1179509292 21:41861852-41861874 CAGAAATAACAAGGGGAGGGGGG + Intronic
1180248030 21:46561519-46561541 CTGTGAGCACATGGGGTGGGTGG + Intronic
1180540981 22:16447404-16447426 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1180601731 22:17024294-17024316 CAGGAAGTACAAGGGGTTGGGGG + Intergenic
1180790043 22:18570878-18570900 CTGGAAGCAGAGGGGGTCGGTGG + Intergenic
1181231696 22:21424437-21424459 CTGGAAGCAGAGGGGGTCGGTGG - Intronic
1181246955 22:21510431-21510453 CTGGAAGCAGAGGGGGTCGGTGG + Intergenic
1181326991 22:22057535-22057557 CGGGAAGCACAAGGGGTCGGGGG - Intergenic
1181459533 22:23078042-23078064 CAGGAAGCAAGAGGGCTGGGTGG - Intronic
1181963889 22:26643114-26643136 CAGGAAGTAGGAGCGGTGGGTGG - Intergenic
1182443902 22:30379470-30379492 CAGCAAGCCCAGTGGGTGGGAGG - Exonic
1182667679 22:31971362-31971384 CAGGAACCGCAATGGTTGGGCGG - Intergenic
1182761825 22:32728619-32728641 CAGGGAGCACAAGAGGTTGGGGG + Intronic
1183467136 22:37985432-37985454 CAGGAAAGAAAAGGGGAGGGAGG - Intronic
1183654734 22:39177889-39177911 CAGGAGGCACCAGGGGAAGGCGG - Intergenic
1184173635 22:42773464-42773486 CAGGAAGCACGGAGGTTGGGGGG + Intergenic
1184428494 22:44427220-44427242 CAGGAAGCACCACGGGTGTGTGG - Intergenic
1184492944 22:44820623-44820645 CCCCAAGCACAAGGGGAGGGAGG - Intronic
1184538776 22:45106173-45106195 GAGGAAGCAAAAGGACTGGGAGG + Intergenic
1185001693 22:48250298-48250320 CAGGAGGCAGCAGGGATGGGCGG - Intergenic
1185245209 22:49769697-49769719 CTGCGAGCACAGGGGGTGGGAGG - Intergenic
1185264568 22:49893800-49893822 CAGTAAGGACAAAAGGTGGGAGG + Intergenic
1185322332 22:50207537-50207559 CAGGCAGCCTCAGGGGTGGGCGG - Intronic
949456661 3:4246195-4246217 CGGGAAGCACAAGGGATCAGAGG - Intronic
949496519 3:4637410-4637432 TAGGGAGAACAAGAGGTGGGAGG + Intronic
949632601 3:5944508-5944530 AGGGAAGCCCAAGGGGTGGCGGG - Intergenic
949660493 3:6272819-6272841 CGGGAAGCGCAAGGGGTCAGGGG - Intergenic
950299907 3:11867932-11867954 CAGGAAGCACAAGGGGGCGGAGG - Intergenic
950434047 3:12967876-12967898 GAAGAAGCACAGGGGGCGGGGGG + Intronic
950701359 3:14751429-14751451 CAGGAAGCACAAGGCGTCAAGGG + Intronic
950781609 3:15397412-15397434 GGGGAAGCACAAGGGGTCAGGGG - Intronic
951124138 3:18963613-18963635 CGGGAAGCGCAAGGGGTCAGGGG - Intergenic
951183215 3:19682739-19682761 GGGGAAGCACAAGGGGTTGAGGG - Intergenic
951434299 3:22643697-22643719 CAGAAAGCACAAGGGATCAGGGG - Intergenic
951439544 3:22707314-22707336 GGGGAAGCACAAGGGGTGGGGGG - Intergenic
951469132 3:23036367-23036389 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
951617717 3:24566920-24566942 CGGGAAGCCCAAGGGGTCGGGGG + Intergenic
952213636 3:31254117-31254139 CTGGAGGGAAAAGGGGTGGGGGG - Intergenic
952335711 3:32401589-32401611 CAGGAAGCGCCAGGGCTGGCAGG - Intronic
952517716 3:34122523-34122545 CGGGAAGTGCAAGGGGTCGGGGG - Intergenic
952519596 3:34143316-34143338 CAGGAAGAACAAGGGGGAGAAGG - Intergenic
952550595 3:34472166-34472188 CCGGAAGCACAAGGGGTTGGGGG - Intergenic
952814017 3:37431317-37431339 CAGGAAGCGCAAAGGGTCAGGGG - Intronic
952863968 3:37838993-37839015 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
953254630 3:41278000-41278022 TGGGAGGCACAAGGGGTCGGGGG + Intronic
953717066 3:45324646-45324668 CATGAGGCACAGAGGGTGGGTGG - Intergenic
954358402 3:50102593-50102615 CCTGAAGCAGAAGGTGTGGGGGG + Intronic
954501020 3:51014100-51014122 CAGGAAGCTCAAGGGGTCGGGGG - Intronic
954701643 3:52453809-52453831 GAGGATGCAGAAGGGGTAGGGGG - Intronic
954827917 3:53391334-53391356 CAGGAAGAGCAAGGGGTCGGGGG + Intergenic
956373273 3:68587079-68587101 CGGGAAGCATAAGGGGTTGGGGG - Intergenic
956603606 3:71049629-71049651 CAGGAAAAAAAGGGGGTGGGGGG + Intronic
956920896 3:73928033-73928055 TAGGAAAGCCAAGGGGTGGGTGG + Intergenic
957256689 3:77845634-77845656 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
957511102 3:81188501-81188523 GAGGAAGCACAAGAGGTGACGGG - Intergenic
957768677 3:84659293-84659315 GAGCAAGACCAAGGGGTGGGGGG - Intergenic
957786093 3:84885141-84885163 AGGGAAGCACAAGGGGTCAGGGG + Intergenic
958081086 3:88747095-88747117 CGGGAAGTACAAGGGGTCAGGGG + Intergenic
958257498 3:91341479-91341501 CGGGAAGCTCAAGGGGTTGGGGG - Intergenic
958413992 3:93852695-93852717 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
958479699 3:94630809-94630831 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
958553529 3:95645231-95645253 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
958618456 3:96526848-96526870 CAGGAAGGGCAAGGGGTCAGGGG + Intergenic
958873455 3:99589055-99589077 CAGGAAACACAAGGGGTCAGGGG + Intergenic
959097442 3:101971358-101971380 CGGGAGGCACAAGGGGTTGGGGG - Intergenic
959170863 3:102842217-102842239 CAGGAAGTGCAAGGGGTCAGGGG - Intergenic
959290733 3:104469777-104469799 TGGGAAGCACAGGGGGTTGGGGG - Intergenic
959692892 3:109218776-109218798 CAGGAAGGGCAAGGGTTCGGGGG + Intergenic
959724597 3:109529140-109529162 CGGGAAGCGCAAGGGGTTTGGGG - Intergenic
959764023 3:110002301-110002323 CGGGAAGCGCAAGGGGTCGGGGG - Intergenic
960478780 3:118162815-118162837 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
960508071 3:118516915-118516937 CAGGAAGCACAAGGGGTTGGAGG + Intergenic
960787718 3:121392335-121392357 TGGGAAGCGCAAGGGGTGGGGGG - Intronic
960836088 3:121908317-121908339 CAGGAAGGACAAGCGGTTGGGGG - Intronic
960890495 3:122443011-122443033 CAGGAAGCACAATGGGTCGGGGG + Intronic
960911224 3:122651141-122651163 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
960913105 3:122668930-122668952 AGGGAAGCACAAGGGGTTGGGGG - Intergenic
961738268 3:129015730-129015752 AATAAATCACAAGGGGTGGGGGG - Intronic
962007265 3:131361465-131361487 CACAAAGCACAAGGCCTGGGTGG - Intergenic
962009630 3:131381181-131381203 CACAAAGCACAAGGCCTGGGTGG - Intergenic
962145631 3:132836761-132836783 TAGGAACCAAAAGGGGAGGGAGG - Intergenic
962191193 3:133312663-133312685 TGGGAAGCACAAGGGGTCAGGGG - Intronic
962291428 3:134140060-134140082 CAGGAAGCACAAGGGGTAGGGGG + Intronic
962316954 3:134364960-134364982 CAAGAGGTACATGGGGTGGGTGG - Intronic
962513457 3:136126180-136126202 CAGGAAGCACAAGGGGTTGGGGG + Intronic
962602829 3:137007722-137007744 CGGGAAGCACAAGGGGCCAGGGG - Intronic
962645088 3:137430686-137430708 CAGGAATCAAAAGGGGTCAGGGG + Intergenic
962668318 3:137679221-137679243 CAGGAAGAGCAAGGGGTCAGGGG + Intergenic
962675154 3:137750883-137750905 CAGGAAGCATAAGGGGTCAGTGG + Intergenic
964264126 3:154875032-154875054 CAGGAAATGCAAGGGGTCGGGGG + Intergenic
964269994 3:154945342-154945364 CTGGAAGCACAAGGGGTGGGGGG + Intergenic
964701732 3:159575038-159575060 CTGGAAGCACAAGGGGTTGGGGG - Intronic
964994987 3:162867983-162868005 AGGAAAGCACAAGGGGTTGGGGG + Intergenic
965200773 3:165655330-165655352 CAGGAAGGGCAAGGGGTCGGGGG + Intergenic
965221371 3:165931281-165931303 TGGGAAGCACAAGGGGTCAGGGG + Intergenic
965520219 3:169663036-169663058 CAGCAAAGACTAGGGGTGGGAGG - Intronic
966493652 3:180556173-180556195 CAGGAAGTACAAGGGGTCAGGGG + Intergenic
966542317 3:181105818-181105840 TAGGAAGAGAAAGGGGTGGGGGG - Intergenic
966835851 3:184048940-184048962 CAGTCAGAACAGGGGGTGGGAGG + Intergenic
967181576 3:186909798-186909820 CAGGAAGCACAAGCGGTCGGGGG - Intergenic
967199327 3:187058230-187058252 CAGGAAGCGCAAGGGGTCAGGGG - Intronic
967330441 3:188284438-188284460 CAGGAGGCCCAAGGGGGAGGTGG + Intronic
967921956 3:194620398-194620420 CAGGAATCAGAAGGGCTGTGTGG - Intronic
968271422 3:197406441-197406463 CAGCCAGCAGAAGGGGCGGGGGG + Intergenic
968408645 4:365266-365288 TGGGAAGCACAAGGGGTTGGGGG - Intronic
968856199 4:3125674-3125696 CAGGAAGGGCAAGGGGTGGAAGG - Intronic
968860679 4:3166874-3166896 TGGGAAGCACAAGGGGTCGGGGG - Intronic
969182427 4:5452336-5452358 CTGGATGTACAAGGCGTGGGTGG + Intronic
970173026 4:13308104-13308126 GAGCAAGTACAAGGGGTGGGAGG - Intergenic
970182800 4:13416945-13416967 CAGGAAACACAAGGGGTCGGGGG + Intronic
970496240 4:16628811-16628833 CAGGAAGTGCAAGGGGTCAGGGG + Intronic
971333824 4:25704518-25704540 CAGAAAGCAGAAGGGGAGAGAGG + Intergenic
971347380 4:25823697-25823719 CAGGAACCACAAGGGGCAGATGG + Intronic
971560720 4:28077144-28077166 CAGGAAGTGCAAGAGGTTGGGGG + Intergenic
972196145 4:36656207-36656229 CAGGAAGTGCAAGGGCTTGGGGG + Intergenic
972551336 4:40137719-40137741 CAGGAGGCAGAAGGAGTAGGGGG + Intronic
972672940 4:41231314-41231336 TGGGAAGCAGAAAGGGTGGGTGG + Intergenic
973237682 4:47922990-47923012 TGGGAAGCACAAGGGGTCGGGGG - Intronic
973317896 4:48780316-48780338 CAGGAAGGCCAGGGGGCGGGCGG - Intronic
973567011 4:52198955-52198977 CAGGAAGCACAGGGAATGAGGGG - Intergenic
973598956 4:52522058-52522080 CAGGAGGTAAAAGGGGTTGGGGG + Intergenic
973732220 4:53833531-53833553 CAGGAAGCACAAGGGGTCAGGGG + Intronic
973835731 4:54807255-54807277 CAGGAAGTACAAGGGGTTGGGGG + Intergenic
973871368 4:55170044-55170066 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
974127492 4:57714297-57714319 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
974196810 4:58585548-58585570 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
974307258 4:60157474-60157496 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
974558702 4:63488719-63488741 CAGGAAACACAAGGGTTTTGGGG - Intergenic
974871725 4:67652733-67652755 CAGGAAGCACAAGGGGTCAGGGG + Intronic
974944095 4:68505298-68505320 CTGGAAGTGCAAGGGGTTGGGGG - Intergenic
975064337 4:70041843-70041865 CGGGAAGCATAAGGGGTTGTGGG - Intergenic
975177834 4:71308606-71308628 CAGGAAGTGCAAGGGGCCGGGGG + Intronic
975291163 4:72679518-72679540 TGGGAAGCACAAGGGTTTGGGGG + Intergenic
975558345 4:75686541-75686563 CAGCAAGAGCAAAGGGTGGGTGG + Intronic
975744669 4:77464537-77464559 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
976024972 4:80675975-80675997 TGAGAAGCACAAGGGGTTGGGGG - Intronic
976387674 4:84480220-84480242 CAGAAAGTACTAGAGGTGGGTGG + Intergenic
976438219 4:85043525-85043547 CAGGAAATGCAAGGGGTTGGGGG + Intergenic
976451531 4:85196452-85196474 CCGGAAGCACAAGGGGTTGGGGG - Intergenic
976477969 4:85506680-85506702 CAGGAAGTGCAAGGGGTTGGTGG - Intronic
976552606 4:86413852-86413874 TAGGAAGCACAAGGGGTTGGGGG - Intronic
976580546 4:86730739-86730761 CAGGAAGCCCAAGGGATAGAGGG - Intronic
976585346 4:86791051-86791073 CGGGAAGCACAAGGTGTCAGGGG + Intronic
976975905 4:91165866-91165888 CAGGAAGCACAATGGGTTGGGGG - Intronic
977219824 4:94325718-94325740 CAGGAAGCACAGGGGGTTGAGGG - Intronic
977326505 4:95580734-95580756 CACGAAGCACAAGGGGTTGGGGG - Intergenic
977511192 4:97965048-97965070 CAGGAAGCGCAAGAGGTTGAGGG + Intronic
977619961 4:99125186-99125208 CAGGAAGCACAAGAGAGGGCAGG - Intronic
977771743 4:100868739-100868761 CCGGAAGCACAAGGGGCCGGGGG - Intronic
977829688 4:101576256-101576278 CAGGAAGTGCAAGGAGTTGGGGG + Intronic
977946443 4:102919616-102919638 CGGGAAGCACAAGGGGTTGGGGG + Intronic
977950832 4:102968741-102968763 GAAGCAGCACAAGGGGTCGGGGG + Intronic
978150273 4:105426391-105426413 CAGGAAGCGCCAGGGGTCAGGGG + Intronic
978464511 4:108994163-108994185 CAGGAAACTCAAGGGGTCGGGGG + Intronic
978493991 4:109339789-109339811 CAGGAAGCTCAAGGGGTCAGGGG + Intergenic
978517821 4:109587394-109587416 CGGGAAGCACAAGGGGTCAGGGG - Intronic
978928915 4:114287219-114287241 TGGGAAGCCCAAGGGGTTGGGGG + Intergenic
979103433 4:116653016-116653038 CATGAAAACCAAGGGGTGGGGGG + Intergenic
979272897 4:118783039-118783061 CGGGAAGCCCAAGGGGTCAGGGG - Intronic
979289781 4:118966725-118966747 CAGGAGGAACTAGGGGAGGGGGG - Intronic
979315416 4:119255684-119255706 CAGGAAGCACAAGGGGTCAGGGG - Intronic
979462718 4:121001947-121001969 CAGGAAGTGCAAGGGGTCAGGGG - Intergenic
979516555 4:121616406-121616428 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
979544282 4:121921811-121921833 AAGGAAGCAGCAGGAGTGGGTGG + Intronic
979581323 4:122364886-122364908 CGGGAAGCGCAAGGGTTGAGGGG + Intergenic
980584018 4:134789431-134789453 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
980803530 4:137783838-137783860 CGGGAAGCACAAGGGGTCAGGGG + Intergenic
981414974 4:144482644-144482666 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
981445787 4:144836906-144836928 CAGAAAGCGCAAGGGGTCAGGGG + Intergenic
981512655 4:145574526-145574548 CAGGAAGTGCAAGAGGTTGGGGG + Intergenic
981796324 4:148599233-148599255 CAGGAAGCGCAAAGGGTCGGGGG - Intergenic
981850946 4:149229586-149229608 CAGGAAGCACAAGGGGTTGAGGG + Intergenic
983677783 4:170316592-170316614 CAGGGAACACAAGGGGTCAGGGG + Intergenic
985190863 4:187371178-187371200 CAGGAAGCACATGTTGTGGGTGG + Intergenic
985293721 4:188412356-188412378 GAGGAAGCACAGGGAGTGGAAGG + Intergenic
985708880 5:1417093-1417115 CAGGGCGCACATGGGATGGGGGG - Intronic
985754237 5:1703673-1703695 CAGGAAGCACAGGGTGCAGGTGG + Intergenic
985794744 5:1953617-1953639 CAGGAAGCACAACAGGTCAGGGG + Intergenic
986143069 5:5049830-5049852 CAGGTAGGACAGGGGCTGGGCGG - Intergenic
986476339 5:8137457-8137479 GAGGAGGAACAAGGGGTGGCAGG + Intergenic
986706468 5:10458173-10458195 CAGGAAGGACAAGGACTGGCGGG - Intronic
986838880 5:11672864-11672886 CAGGAAGTGCAAGGGGTCAGGGG - Intronic
987046158 5:14110908-14110930 CAGGAAGAAGAAGACGTGGGTGG - Intergenic
987279761 5:16400883-16400905 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
987528273 5:19080918-19080940 CGGGAAGCACAAGGGGTCGGGGG - Intergenic
987837982 5:23186334-23186356 CGGGAAGCACAAGGGGTCCGGGG + Intergenic
988167898 5:27617554-27617576 CAGGAAGCACAAAGAGCTGGGGG - Intergenic
988381302 5:30499779-30499801 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
988441946 5:31243389-31243411 AAGGAAGCACAGGGGGTGGTTGG + Intronic
988687588 5:33540015-33540037 CGGGAAGTGCAAGGGGTTGGGGG + Intronic
988795139 5:34646637-34646659 CGGGAAGCACAAGGGGTCAGGGG - Intergenic
988975156 5:36508201-36508223 CAGGAAGTGCAAGGGGTCGGGGG + Intergenic
989087246 5:37688893-37688915 TGGGAAGCGCAAGGGGTCGGGGG + Intronic
989337508 5:40336086-40336108 GAGGAAGCACAAGGAGTTGGGGG + Intergenic
989390500 5:40895557-40895579 CAGGAAGTGCAAAGGGTTGGCGG + Intergenic
989614769 5:43328810-43328832 CGGGAAGCACGAGGGGTTGGGGG - Intergenic
990230330 5:53706114-53706136 CAGGAAGCACAAAGGGTCAGAGG - Intergenic
990234290 5:53750688-53750710 TAGGAAGTGCAAGGGGTTGGGGG + Intergenic
990239163 5:53799556-53799578 CTGGAAGCACAAGGGGTCATGGG + Intergenic
990244910 5:53854633-53854655 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
990415525 5:55582494-55582516 GAGGAAGCAGCAGGAGTGGGTGG - Intergenic
990721386 5:58699899-58699921 CAGGAAGCACACGGGGTCAGGGG - Intronic
991105424 5:62837274-62837296 CAGGAAGCACAAGGGGTAGGGGG + Intergenic
991243486 5:64484929-64484951 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
991257790 5:64634161-64634183 GAGGAAGCATCAGGGGTAGGAGG + Intergenic
991280800 5:64910887-64910909 TGGGAAGCACAAAGGGTAGGGGG - Intronic
991387481 5:66106135-66106157 AAGGAAGAGCAAGGGGTCGGGGG + Intergenic
991425062 5:66482235-66482257 CAGGAAGCTCAAGGGGTCGGGGG + Intergenic
991575821 5:68102412-68102434 CTGGAAGCACAAGGGGTGGGGGG + Intergenic
992069465 5:73136023-73136045 CAGGAAGCACACTGTGGGGGTGG + Intergenic
992254958 5:74912028-74912050 TGGGAAGTACAAGGGGTCGGGGG - Intergenic
992468200 5:77028349-77028371 AAGGAGGCAGAAGGAGTGGGAGG + Intergenic
992498847 5:77321989-77322011 CAGGAGGCACAGGGAGCGGGAGG + Intronic
992516680 5:77501083-77501105 CAGGAAGTGCAAGGGGTTGCAGG + Intronic
992756449 5:79911177-79911199 CTGGAAGTGCAAGGGGTCGGGGG + Intergenic
993039485 5:82796657-82796679 CAGTAAGCAGAAGGGGTGCAGGG + Intergenic
993438333 5:87924914-87924936 CAGGAAGTGCAAGGGGTCAGGGG - Intergenic
993546581 5:89220088-89220110 CGGGAAGTGCAAGGGGTCGGGGG + Intergenic
993799241 5:92310695-92310717 TAAGAACCACAGGGGGTGGGAGG - Intergenic
994039650 5:95244387-95244409 CGGGAAGCACAAGGGGTGGGGGG + Intronic
994090809 5:95808258-95808280 CTGGCAGCACAAGGGAGGGGCGG - Intronic
994160299 5:96549600-96549622 CGGGAAGCACAGGGGGTTGGGGG + Intronic
994545611 5:101163036-101163058 CGGGAAGCATAAGGGGTCAGGGG + Intergenic
994586556 5:101716210-101716232 CAGGAAGCACAAGGGATCTGGGG - Intergenic
994624176 5:102196872-102196894 CAGGAAGCGCAAGGGGTCGGGGG - Intergenic
994852769 5:105076940-105076962 CAGGAAGGAGAACGGGTGGAGGG + Intergenic
995136621 5:108686190-108686212 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
995457357 5:112366486-112366508 TTGGAAGAGCAAGGGGTGGGAGG + Intronic
995459737 5:112390254-112390276 TGGGAAGCACAAGGGGTCAGGGG + Intronic
995489865 5:112679434-112679456 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
995643004 5:114278804-114278826 CGGGAAGCACAAGGGATCAGAGG - Intergenic
995695663 5:114876076-114876098 CAGGAAGCCCAAGGGGTTGAGGG + Intergenic
995908028 5:117149820-117149842 CAGAAATCATCAGGGGTGGGAGG - Intergenic
996275360 5:121660083-121660105 CAGGAAGTGCAAGGGGTGGGGGG + Intergenic
996859069 5:128044105-128044127 CGGGAAGCACAAGGGGTTGGGGG + Intergenic
997211068 5:132077083-132077105 GAGGAAGCAAGAGGGGTGGTGGG - Intergenic
997597529 5:135117030-135117052 GAGGAAGTTCATGGGGTGGGAGG + Intronic
999099009 5:149006823-149006845 CAGGAAGGAGAATGGTTGGGTGG + Intronic
999111227 5:149123126-149123148 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
999712353 5:154329759-154329781 GATGAAGCACAGAGGGTGGGAGG - Intronic
999963471 5:156783002-156783024 CAGGAAGCACAAGGGGTTGAGGG + Intergenic
999965573 5:156806043-156806065 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
1000145199 5:158447142-158447164 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1000214264 5:159139729-159139751 CGGGAAGCACAAGGGGTTCGGGG + Intergenic
1000547989 5:162625593-162625615 CAGGAAGTATGAGGAGTGGGGGG + Intergenic
1001076340 5:168630885-168630907 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1001185466 5:169567362-169567384 AATGAAGGTCAAGGGGTGGGAGG + Intergenic
1001347819 5:170922754-170922776 CAGGAAGCGCAAGGGGTCAGGGG - Intronic
1002169880 5:177369081-177369103 CTGGAAGGACATGAGGTGGGGGG - Intronic
1002194441 5:177494604-177494626 CAGGAAGCACAGAGGATGAGGGG + Intronic
1002685709 5:181007920-181007942 CAGGAAGTGCAAGGAGTGGGGGG + Intergenic
1002734879 5:181377828-181377850 CGGGAAGTGCAAGGGGTTGGGGG - Intergenic
1002749648 6:96294-96316 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1002833894 6:849154-849176 CAGGGAGCTCAAGTGATGGGTGG + Intergenic
1003062931 6:2876422-2876444 CAGTCTGCACAAGGGGAGGGAGG + Intergenic
1003198182 6:3933230-3933252 CAGGAAGCACATGCGGCAGGTGG + Intergenic
1003228171 6:4225148-4225170 TAGGAAGCACAAGGGGTTGGGGG + Intergenic
1003316849 6:5020607-5020629 CAGGAAGCGCAAGGAGTTGGGGG - Intergenic
1003434431 6:6072678-6072700 CAGGAAGTGCAAGGGGTCGGGGG - Intergenic
1003542125 6:7027043-7027065 CGGGAAGCACAAGGGGTCAAGGG + Intergenic
1003647475 6:7925878-7925900 CTGGAAGTGCAAGGGGTTGGGGG + Intronic
1003763835 6:9213669-9213691 CGGGAAGCACAAGGGATTGGGGG + Intergenic
1003835595 6:10069372-10069394 CAGGAGGCAGAGGGGGAGGGTGG - Intronic
1003987522 6:11451991-11452013 CGGGAAGCCCAAGGGGTTGGGGG + Intergenic
1004056030 6:12139544-12139566 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1004255496 6:14059813-14059835 CAGAATGCACAAGGGGTGTGAGG + Intergenic
1005003303 6:21264004-21264026 CAGGAAGATGAAGAGGTGGGAGG + Intergenic
1005056966 6:21738451-21738473 GAGGATGGACAAGGGCTGGGTGG + Intergenic
1005397723 6:25400532-25400554 CATGAAGCACAGCTGGTGGGGGG - Intronic
1005879233 6:30042323-30042345 CTGGAAGGACAAGAGCTGGGTGG - Intergenic
1005934339 6:30508678-30508700 TAGGAAGCACGAAGGGTGGTAGG - Intergenic
1006241192 6:32680243-32680265 CAGGAGTCACAAGGGGTAAGGGG - Intergenic
1006405682 6:33843537-33843559 GGGGAAGCAGAAGGGGAGGGAGG - Intergenic
1006616585 6:35332135-35332157 CAGGAAGCAGAAGGGGTTGGGGG + Intergenic
1007115266 6:39338934-39338956 CAGTAATGACAGGGGGTGGGTGG + Intronic
1007134471 6:39507943-39507965 GAGGAAGGGGAAGGGGTGGGGGG - Intronic
1007827126 6:44608890-44608912 CAGGAAGGAGAAAGGGAGGGAGG - Intergenic
1008094724 6:47328015-47328037 CGGGAAGCACAAGGGGTCAGGGG + Intergenic
1008176270 6:48271304-48271326 CAGGAAGTGCAAGGAGTTGGGGG - Intergenic
1008671005 6:53768736-53768758 CACAAAGCACAAAGGGTGGGTGG + Intergenic
1008997808 6:57679544-57679566 CGGGAAGCTCAAGGGGTTGGGGG + Intergenic
1009186297 6:60578882-60578904 CGGGAAGCTCAAGGTGTTGGGGG + Intergenic
1009655590 6:66541103-66541125 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1009679972 6:66880140-66880162 CAGAAAGCAAAAGGGGAGGCAGG + Intergenic
1010003845 6:70974352-70974374 CAGGAAGCGCAAGGGGTATGGGG + Intergenic
1010102518 6:72125923-72125945 CAGGAAGCGCAAGGGGTCAGGGG - Intronic
1010171848 6:72984646-72984668 CAGGAAGCACAAGGGGTGGGGGG - Intronic
1010251624 6:73713342-73713364 CAGCAAGAAATAGGGGTGGGTGG + Intronic
1010282267 6:74035630-74035652 CAGGAAGGACAAGGGGTCATGGG - Intergenic
1010364212 6:75031032-75031054 CAGGAAGCATAAGGGGTTGGGGG + Intergenic
1010676950 6:78756306-78756328 CAGGAAGAACAAGGGGTCAGGGG + Intergenic
1010747218 6:79577830-79577852 CGGGAAGCACAAGGGGTTGCGGG + Intergenic
1011234583 6:85202181-85202203 CAAGAAGCGCAAGGGGTTGTGGG + Intergenic
1011292131 6:85788038-85788060 TGGGAAGCACAAGGGGTTTGGGG - Intergenic
1011417715 6:87139866-87139888 CCAGAAGCGCAAGGGGTTGGGGG + Intergenic
1011537357 6:88390902-88390924 CAGGAAACACAAGAGGTTAGGGG + Intergenic
1011884595 6:92078468-92078490 CAGGAAGCACAAGGGGTTGGAGG + Intergenic
1011909675 6:92420941-92420963 TCGGAAGCACAAGGGGTTGGGGG + Intergenic
1012484144 6:99702307-99702329 CAGAAAGCACAAAGGGTCAGTGG + Intergenic
1012589948 6:100968900-100968922 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1012597967 6:101062186-101062208 TGGGAAGCACAGGGGGTCGGGGG + Intergenic
1012878400 6:104756752-104756774 CGGGAAGCGCAAGGGGTCAGGGG + Intronic
1012940978 6:105415190-105415212 CGGGAAGCACAAGGGGTCTGGGG + Intergenic
1013131585 6:107238253-107238275 CAGGAAGGATCAGGAGTGGGTGG + Intronic
1013386857 6:109640367-109640389 CAGGAAGTGCAAGGGGTCCGGGG - Intronic
1013387380 6:109645266-109645288 TGGGAAGCACAAGGGGTGGGGGG + Intronic
1013436614 6:110116239-110116261 CAGGAAGTACAAGGGGTCAGGGG + Intronic
1013578340 6:111507659-111507681 TGGGAAGCGCAAGGGGTTGGGGG - Intergenic
1013926679 6:115481016-115481038 CAAGAAGCACAAGGGGTCAGGGG - Intergenic
1014938723 6:127413534-127413556 CGGGAAGCACAAGGGGTTTGGGG - Intergenic
1015046309 6:128780180-128780202 CAGGATGGGCAAGGGGTCGGGGG - Intergenic
1015388173 6:132650150-132650172 AAGGAAGCACATGGGCTGGGAGG - Intergenic
1015419146 6:132986405-132986427 CGGGAAGTGCAAGGGGTTGGGGG - Intergenic
1015967735 6:138711855-138711877 CGGGAAGCACAAAGGGTCAGGGG - Intergenic
1016006033 6:139090364-139090386 CAGGAAGTGCAAGGGGTGAGGGG - Intergenic
1016265890 6:142232346-142232368 CAGGAAGTGCAAGGGGCTGGGGG + Intergenic
1016436905 6:144047132-144047154 CGGGAAGTGCAAGGGGTTGGGGG - Intronic
1016523906 6:144977667-144977689 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1016584893 6:145673483-145673505 CAGGAAGTGCAAGGGGTAGGGGG + Intronic
1016608682 6:145964025-145964047 CGGGAAGCTCAAGGGCTGAGAGG - Intronic
1016856067 6:148671651-148671673 CTGGAAGCACAAGGGGTTGGGGG - Intergenic
1017302861 6:152882857-152882879 CAGGAAGTGCAAGGGGTCGGAGG + Intergenic
1017411477 6:154172347-154172369 TGGGAAACACAAGGGGTCGGGGG + Intronic
1017686645 6:156920176-156920198 CAGGGAGCTGAAGGGGAGGGAGG - Intronic
1017836554 6:158183837-158183859 CAGGAAGTGCAAGGGGTCAGGGG - Intronic
1017968778 6:159290795-159290817 TGGGAAGCACAAGGAGTTGGGGG - Intergenic
1019170067 6:170128869-170128891 CAGGAAGCAGGCGGGTTGGGGGG + Intergenic
1019239141 6:170650145-170650167 CAAGAAGTGCAAGGGGTTGGGGG - Intergenic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019541947 7:1555547-1555569 CAGGAAGCAGCGGGGGAGGGAGG + Intronic
1019578226 7:1747744-1747766 CAGGACGGCCAAGGGCTGGGAGG + Exonic
1020063790 7:5172037-5172059 TGGGAAGCAAAGGGGGTGGGTGG - Intergenic
1020250711 7:6466210-6466232 CAGGAAGAACAGGTAGTGGGTGG + Exonic
1020333326 7:7042015-7042037 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1020344199 7:7145553-7145575 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1020443060 7:8239605-8239627 CAGGAAGTGCAAGGGGTCGGGGG + Intronic
1020480018 7:8647358-8647380 CAGGAAAATAAAGGGGTGGGAGG + Intronic
1020659537 7:10966028-10966050 CAGAAAGCTCAAGGGGTCAGAGG - Intergenic
1020774171 7:12432286-12432308 TGGGAAGCACAAAGGGTAGGGGG - Intergenic
1020795644 7:12675845-12675867 CGGGAAGCACAAGGGATCAGGGG + Intergenic
1021282720 7:18740204-18740226 CAGGAAGCACAAGGGGTTGGGGG - Intronic
1021755191 7:23844731-23844753 TGGGAAGCGCAAGGGGTTGGGGG + Intergenic
1022136057 7:27449482-27449504 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1022331045 7:29379308-29379330 CAGGAAGTTAAAGGGGTGCGTGG + Intronic
1022383880 7:29884377-29884399 CAAGAAGCATAAGGGGGGAGCGG - Exonic
1022745415 7:33166817-33166839 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
1022896776 7:34757963-34757985 CAGGAAGCAGAAGAGGAGAGTGG + Intronic
1023038910 7:36155076-36155098 TTGGAGGCACAAGGGATGGGAGG + Exonic
1023066083 7:36379034-36379056 CAGGAAGTGCAAGGGGTCAGGGG - Intronic
1023146197 7:37153344-37153366 CGGGAAGCACAAGGGGTCCAGGG + Intronic
1023509417 7:40934871-40934893 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1023568977 7:41553081-41553103 TGGGAAGCACAAGGGATTGGGGG - Intergenic
1023651233 7:42371377-42371399 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
1023860695 7:44216262-44216284 CAGGCAGCATAGGTGGTGGGTGG + Intergenic
1023888555 7:44377082-44377104 CAGGAGGCACAAGGAGGGAGAGG - Intergenic
1023958301 7:44905578-44905600 CAGGAAGCCCAAGGGGTGGCAGG - Intergenic
1024106175 7:46088884-46088906 CAGAAAGCACAAAGGGTCAGGGG - Intergenic
1024262013 7:47580508-47580530 GTGGTAGCACAGGGGGTGGGGGG - Intronic
1024451207 7:49545524-49545546 CAAGAACCACATGTGGTGGGAGG - Intergenic
1024667080 7:51558092-51558114 TGGGAAGCACAAGGGGTCAGAGG - Intergenic
1024760196 7:52586958-52586980 AAGGAAGCTCAAGGAGAGGGAGG + Intergenic
1025198773 7:56949639-56949661 GAGGAGGGAGAAGGGGTGGGAGG - Intergenic
1025673173 7:63627294-63627316 GAGGAGGGAGAAGGGGTGGGAGG + Intergenic
1027181806 7:75946000-75946022 CAGGGAGCACACAGGCTGGGGGG - Intronic
1027510395 7:79072050-79072072 CTGGAAGCACAAGGGGTAGGGGG - Intronic
1028114459 7:86981867-86981889 TGGGAAGCACAAGGGGTCAGGGG + Intronic
1028236974 7:88373839-88373861 CGGGAAGCACAGGGGGTCAGGGG - Intergenic
1028396059 7:90369754-90369776 CGGGAAGCACAAGGGATCGGGGG - Intronic
1028413041 7:90551466-90551488 CAGGAAGCATGAGGGGTTGGGGG - Intronic
1028430038 7:90736084-90736106 CAGGAAGCGCAAGGGGTAAAGGG - Intronic
1028526295 7:91790656-91790678 CAGAAAGAGCAAGGGGTTGGGGG + Intronic
1028544841 7:91986331-91986353 CAGGAAGAGTAAGGGGTTGGAGG - Intronic
1028692082 7:93663971-93663993 GGGGAAACACAAGGGGTTGGGGG - Intronic
1028836109 7:95376955-95376977 CAGGAAGTGCAAGGGGTCAGGGG + Intronic
1028998438 7:97127058-97127080 CAGGAAGCGCAAGGAGTTGCGGG - Intronic
1029017549 7:97329928-97329950 CAGGAAGCGCAAGGGGTCAGGGG + Intergenic
1029062250 7:97810550-97810572 CAGGAAGCGCAAGGGGTCAGGGG + Intergenic
1029801655 7:102954138-102954160 CAGGAAGCACAAGGGGTCGGGGG + Intronic
1029810028 7:103038007-103038029 CAGGAAGTGCAAGGGGTCAGGGG + Intronic
1029902715 7:104059001-104059023 CGGGAAGTGCAAGGGGTCGGGGG + Intergenic
1029951993 7:104595995-104596017 CGGGAAGCACAAGGGGTTGGGGG - Intronic
1030166428 7:106560379-106560401 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1030177704 7:106671940-106671962 CGGGAAGCACAGAGGGTCGGGGG + Intergenic
1030181040 7:106709587-106709609 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1030735533 7:113043495-113043517 CAGGGAGCCCAAGGGGAGGGAGG + Intergenic
1031157051 7:118122406-118122428 CAGGAAGCGCAAGGGGTCGGGGG + Intergenic
1031483616 7:122304948-122304970 GAGGAAGCAAAAGGGGGGTGGGG - Intronic
1032684110 7:134213296-134213318 CAGGAAGCAGGAGGAGTGGCAGG + Intronic
1032784975 7:135193673-135193695 CTGGAATGACAAGGGGCGGGAGG + Intronic
1033509314 7:142039068-142039090 CAGGAACAAGACGGGGTGGGGGG + Intronic
1033798249 7:144872825-144872847 CAGGAAACACTGGTGGTGGGTGG - Intergenic
1033887506 7:145966770-145966792 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1034250916 7:149689989-149690011 CAGGCAGGGCATGGGGTGGGGGG + Intergenic
1034394171 7:150807735-150807757 AGGGAAGCGCAAGGGGTTGGGGG + Intergenic
1034741336 7:153476309-153476331 CAGGAAGCAGATGGGGCTGGAGG - Intergenic
1035236457 7:157500707-157500729 CGGGGAGAACAAGGGGAGGGAGG - Intergenic
1035466712 7:159084254-159084276 CAGGCCGCACGAGGTGTGGGCGG + Intronic
1035508632 8:156463-156485 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1035546796 8:487709-487731 CAGGAGGCACAGGGTTTGGGTGG - Intergenic
1036140286 8:6201367-6201389 CTGGAAGCACGAGTGGTGAGAGG + Intergenic
1036288283 8:7463526-7463548 CAGAAAGCACCCAGGGTGGGTGG + Exonic
1036333192 8:7848002-7848024 CAGAAAGCACCCAGGGTGGGTGG - Exonic
1036473982 8:9076543-9076565 CAGTAAGGAAAAGAGGTGGGTGG + Intronic
1036804527 8:11820803-11820825 CAGGAAGTGCAAGGGGTCAGGGG - Intronic
1036862970 8:12368904-12368926 CCAGAAACACAGGGGGTGGGAGG - Intergenic
1037898806 8:22675687-22675709 CAGGAAGGACAACGGGGGGCTGG + Intergenic
1038395619 8:27243596-27243618 CAGGAAGCACACGGGGTGTGTGG - Intronic
1038584667 8:28778067-28778089 CAGGAAGCACACGTGGGGGACGG + Intronic
1038687148 8:29729035-29729057 CAGGGAGCACAGGGGGTGCTGGG - Intergenic
1038873329 8:31520057-31520079 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
1039624373 8:39032605-39032627 CAGGAAGCACAAGAGGTCAGGGG - Intronic
1039634079 8:39144157-39144179 CGGGAAGCTCAAGGGGTCAGGGG - Intronic
1039680928 8:39735538-39735560 CAGGAAGCACAAGGGGTTAGGGG + Intergenic
1039832348 8:41225186-41225208 TGGGAAGCACAAGGGGTCAGGGG + Intergenic
1040082399 8:43300523-43300545 CAGCAAGCAAAAGTGGTGTGAGG - Intergenic
1040383327 8:46894156-46894178 CGGGAAGCACAAGGGGTCAGGGG + Intergenic
1040473024 8:47752169-47752191 CGGGAAGCACGAGGGGTTGGGGG + Intergenic
1040556678 8:48485764-48485786 CAGGAAGCACAAGGGGTTGGGGG + Intergenic
1041221515 8:55656324-55656346 CACGAAGCACAATGGGTCAGGGG + Intergenic
1041271186 8:56110988-56111010 CAGAAAGGATAAGGGGTGGCTGG - Intergenic
1041665948 8:60444915-60444937 CGGGAAGCACAAGGGGTCAGGGG - Intergenic
1041771956 8:61481411-61481433 CAGGAAGCGCAAGGGGTCAGAGG + Intronic
1041815780 8:61968985-61969007 CAGGAAGCACAAGGAGTCGAGGG - Intergenic
1041909828 8:63077368-63077390 CAGGAAGTGCAAAGGGTTGGGGG + Intronic
1042308745 8:67358878-67358900 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1042645311 8:70980196-70980218 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1042878936 8:73466470-73466492 CAGGAAGAAAAAGGGGGTGGAGG + Intronic
1042879331 8:73469934-73469956 AAGGCAGCACAAGCAGTGGGAGG + Intronic
1042931271 8:74016070-74016092 CAGGAAGTGCAAGGGGTCAGGGG + Intronic
1043395548 8:79832199-79832221 CAGGAAAGGCCAGGGGTGGGGGG + Intergenic
1043605167 8:81991041-81991063 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1043938898 8:86174321-86174343 TGGGAAGCAGAAGGGGTGGGGGG - Intergenic
1044320182 8:90792289-90792311 AAAGAGGCACAAGGTGTGGGGGG + Intronic
1044449210 8:92314101-92314123 CAGGAAGCATAAGGGGTTGGGGG - Intergenic
1044576997 8:93780304-93780326 CAGGAAGCGCAAGGGGTTGGGGG - Intronic
1044597047 8:93969766-93969788 TGGGAAGCACAAGGGGTTAGGGG - Intergenic
1044809090 8:96039050-96039072 TGGGAAGCACAAGGAGTGGGGGG - Intergenic
1045071190 8:98506334-98506356 CAGGAAGCACAAGGGGTCAGGGG - Intronic
1045123380 8:99063278-99063300 CGGGAAGTGCAAGGGGTCGGGGG + Intronic
1045423785 8:102042790-102042812 CAGAAAGCAGAGGGGGTTGGGGG + Intronic
1045614890 8:103898005-103898027 AAGGAAGCACAACGCGTGGTAGG - Intronic
1045646993 8:104308772-104308794 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1045797670 8:106065138-106065160 CGGGAACCACAAGGGGTCGGGGG + Intergenic
1045887246 8:107113242-107113264 AAGGAAGAAAAAGAGGTGGGAGG + Intergenic
1045928390 8:107597233-107597255 TAGGAAGCACAAGTGGTCGGGGG - Intergenic
1046050441 8:109015205-109015227 CAGTAAGAGCATGGGGTGGGTGG + Intergenic
1046607881 8:116390910-116390932 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1046880881 8:119306984-119307006 CGGGAAGCACAAGGGGTCAGGGG + Intergenic
1047129332 8:122001450-122001472 CAGGAAGCGCAAGGGGTCGGGGG + Intergenic
1047339379 8:123966084-123966106 CAGGAAGCACTGGGGGAGGCTGG - Intronic
1047520422 8:125591665-125591687 CGGGAAGCAGAGGGGCTGGGTGG + Intergenic
1048437128 8:134428710-134428732 CAGGATCCAAAATGGGTGGGAGG + Intergenic
1048894681 8:138980790-138980812 GAGGAAGCACAAGAGAGGGGAGG + Intergenic
1049062420 8:140286549-140286571 CAGGAAGCACTGAGGGAGGGAGG + Intronic
1049261558 8:141641746-141641768 CAGGAAGCACAGGGGCAGGTGGG + Intergenic
1049749242 8:144275675-144275697 CAGCCACCACCAGGGGTGGGGGG + Intronic
1049758078 8:144319639-144319661 CAGGAAGCAGAAGAGGCAGGCGG - Intronic
1050203673 9:3175811-3175833 CAGGAAGCAAGAGTGGAGGGGGG - Intergenic
1050386970 9:5101089-5101111 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1050678713 9:8085415-8085437 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1050700227 9:8330134-8330156 CAGGAAGCACAAGGGGTCAGGGG - Intronic
1051124780 9:13791724-13791746 CAGGAAGTGCAAGGGGTCGGGGG + Intergenic
1051308778 9:15746808-15746830 TGGGAAGCACAAGGGGTCAGGGG + Intronic
1051452046 9:17207598-17207620 CAGGAAGTACAAGGAGCTGGGGG - Intronic
1051529511 9:18084656-18084678 AAGGAAGCAGAAAGGGAGGGAGG - Intergenic
1051614810 9:18997152-18997174 CAGGAAGAACAAGGGGTTGGGGG + Intronic
1052125205 9:24765664-24765686 CAGGAAGCACAAGGGGTTGGGGG - Intergenic
1052217308 9:25982748-25982770 CCGGAAGCACAAGGGATCTGGGG + Intergenic
1052300552 9:26947911-26947933 CAAGTAGCACCACGGGTGGGTGG - Intronic
1052469019 9:28869424-28869446 GAGGATGAACAAGGAGTGGGGGG + Intergenic
1052686552 9:31764714-31764736 CAGAAAACACAAGGGCTGAGGGG + Intergenic
1052800000 9:32957991-32958013 CAGGAAGCCCAAGGGGTCAGGGG + Intergenic
1052887706 9:33666209-33666231 CAGGAAGCACAAGGGGTCGGGGG + Intergenic
1052963371 9:34319549-34319571 CAGGAAGATGAAGGGGTGGTCGG - Intronic
1053056769 9:34997630-34997652 CAGGAAGCCAAAGGGAAGGGAGG - Exonic
1053307729 9:36995864-36995886 CAGGGAGCACAGGGGGGTGGAGG - Intronic
1053751742 9:41263939-41263961 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1054257269 9:62828268-62828290 CAGGAAGTGCAAGGGGTTTGGGG - Intergenic
1054334048 9:63787457-63787479 CAGGAAGTGCAAGGGGTTGGGGG + Intergenic
1054700314 9:68406384-68406406 AAGGTAGCACAGGGGGTGAGGGG + Intronic
1054857242 9:69914339-69914361 CAGGAGGCAGAAGGGGTGGGGGG - Intergenic
1054879904 9:70134288-70134310 CTGGAAGCACCGGGTGTGGGGGG - Intronic
1054889962 9:70240490-70240512 CAGGAATTGCAAGGGGTTGGGGG + Intergenic
1055053241 9:72000426-72000448 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1055126981 9:72730312-72730334 GGGGAAGAACAAGGGGTGAGAGG + Intronic
1055617062 9:78083786-78083808 CAGGAAGCGCAAGAGGTCAGGGG + Intergenic
1056417398 9:86390147-86390169 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1056494086 9:87138841-87138863 CAGAGAGCACAAGAGGTGAGGGG - Intergenic
1056511451 9:87309940-87309962 CAGGAGGCACCAGGAGTGGTGGG - Intergenic
1056547795 9:87627477-87627499 GAGCAAGCAAAGGGGGTGGGTGG - Intronic
1056844467 9:90025332-90025354 CAAGTAGCCCAAAGGGTGGGAGG + Intergenic
1056997170 9:91473644-91473666 CAGGAAGCACAAGGAGTCAGGGG - Intergenic
1057268692 9:93635220-93635242 CACGAAGGAGAAGGGCTGGGTGG - Intronic
1057335285 9:94150411-94150433 CAGGAAGCAAAAGGAATGGCAGG + Intergenic
1057371706 9:94479881-94479903 CAGGAACCACAGTGGGTGTGGGG - Intergenic
1057498097 9:95575849-95575871 CAGGAAGCACAGGTGGAGTGGGG + Intergenic
1057698171 9:97342110-97342132 CGGGAAGCGCAAGGGGTCGGGGG - Intronic
1057818807 9:98315659-98315681 AAGGAAGCACTGGGGGTTGGGGG - Intronic
1057854377 9:98591326-98591348 CAGGATGGAGAAGGGATGGGTGG + Intronic
1058011970 9:99988739-99988761 CAGGAAGCACAAGGGATTGGGGG + Intronic
1058081992 9:100710376-100710398 CAGGAAGCACAAGGGGCCAAGGG - Intergenic
1058093317 9:100829850-100829872 CAGGAAGCACAAGGGGTTGGAGG - Intergenic
1058614289 9:106809365-106809387 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1058742641 9:107959204-107959226 CAGGTAGACCAAGGGGTGGCTGG - Intergenic
1058819220 9:108713662-108713684 TGGGAAGCACAAGGGGTCAGGGG + Intergenic
1059025703 9:110626570-110626592 CAGGAAGCTCAACCAGTGGGTGG - Intergenic
1059386880 9:113971576-113971598 CAGGACTGACGAGGGGTGGGTGG - Intronic
1059440841 9:114306048-114306070 CAGCAGGCACAAGTGCTGGGAGG - Intronic
1059460306 9:114425300-114425322 CAGGTAACACAAGGAGTGGAGGG + Intronic
1060155850 9:121319175-121319197 CAGGAAGCAGTGGGGGTGGTTGG + Intronic
1060269688 9:122131853-122131875 CAGGAAGCCCAGCGGGTGGCCGG - Intergenic
1061093275 9:128439027-128439049 CAGGCAGCTGGAGGGGTGGGAGG + Intergenic
1061236340 9:129344766-129344788 CAGAAAGAACAAGGGCTGGTGGG + Intergenic
1061285695 9:129621218-129621240 GAGGCAGCACCAGGGCTGGGAGG - Intronic
1061372453 9:130205214-130205236 CAGCAAGGACAAGGGCTGGGAGG + Intronic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061552418 9:131345326-131345348 CAGGAAGTGCAAGGGGTCAGGGG - Intergenic
1061868753 9:133509029-133509051 CAGGAAGCAGATGGGGCAGGTGG - Intergenic
1062028861 9:134353008-134353030 CAGAGAGCACAGGTGGTGGGAGG - Intronic
1062290015 9:135790238-135790260 CAGGTGGCACAGGGAGTGGGTGG - Intronic
1062340936 9:136093786-136093808 CCGGGAGAAGAAGGGGTGGGTGG + Intronic
1062615925 9:137395639-137395661 CAGGGAGGGCAGGGGGTGGGAGG + Intronic
1062759346 9:138330436-138330458 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1203599796 Un_KI270748v1:1208-1230 CAAGAAGTGCAAGGGGTTGGGGG - Intergenic
1186585613 X:10870014-10870036 CGGGAAGCTCAAGGGGTCAGGGG + Intergenic
1186866403 X:13724808-13724830 CAGAAAGTGCAAGGGGTCGGGGG + Intronic
1186937246 X:14463806-14463828 CGGGAAGCACAAGGGGTCAGGGG - Intergenic
1186980018 X:14948686-14948708 CAGAAAGCAGAATGAGTGGGTGG + Intergenic
1187248395 X:17574634-17574656 TAGGAAGCACAAGGGGTCGGGGG - Intronic
1187491589 X:19757255-19757277 CAGGAACCAAAAGGGGAGGCAGG - Intronic
1187511631 X:19924953-19924975 CTGGAAGATAAAGGGGTGGGAGG - Intronic
1187705446 X:22005388-22005410 CGGGAAGCACCAGGGGTCGGAGG - Intergenic
1187729499 X:22238317-22238339 CGGGAAGCACAAGGGGTTGGGGG + Intronic
1187829194 X:23363588-23363610 CAGGAAGCGCAAGGGGTCAGGGG - Intronic
1188084091 X:25882422-25882444 CCAGAAGCACAAGGGGTCGGGGG + Intergenic
1188123071 X:26334187-26334209 CGGGAAGGGCAAGGGGTCGGGGG + Intergenic
1188309156 X:28596363-28596385 AAGGAAGAAGAAGGGGAGGGAGG - Intronic
1188944268 X:36278526-36278548 TAGGAAGCACAAGGGGTTTGGGG - Intronic
1189326873 X:40117987-40118009 GAGGGAGGAAAAGGGGTGGGGGG - Intronic
1189978494 X:46486324-46486346 CAGGAAGCGCAAGGGGTCAGGGG - Intronic
1190622223 X:52298907-52298929 CAGGAAGCACAAGGGGTCGGGGG + Intergenic
1190828726 X:54042361-54042383 CAGGAAAGAAAAGGGGGGGGGGG + Intronic
1190939877 X:55029955-55029977 CAGGCCACAAAAGGGGTGGGGGG - Intronic
1191002402 X:55674314-55674336 CAGGAAGCACAAGGGGTCAAGGG - Intergenic
1191012466 X:55774850-55774872 CGGGAAGCGCAAGGGGTCAGGGG - Intergenic
1191043260 X:56107656-56107678 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
1191051165 X:56194273-56194295 CAGGAAGTGAAAGGGGTTGGGGG + Intergenic
1191121706 X:56912901-56912923 CAGGAAGAACAAGGGGTCAGAGG - Intergenic
1191122514 X:56921094-56921116 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1191153986 X:57251909-57251931 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1191197866 X:57744179-57744201 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1191645630 X:63478201-63478223 TAGGAAGCACAAGTGGTCGGGGG + Intergenic
1191711353 X:64152788-64152810 CAAGAAGCATAAGGGGTTGGGGG + Intergenic
1191757313 X:64607420-64607442 TGGGAAGCACAAGGGGTGAGGGG - Intergenic
1191795584 X:65018412-65018434 TGGGAAGCACAAAGGGTTGGTGG + Intronic
1192183315 X:68929707-68929729 CAGGAAGCACAATGTTTGGCAGG - Intergenic
1192371881 X:70521071-70521093 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1192393610 X:70755802-70755824 CGGGAAGCACAAGGGGTCTGGGG + Intronic
1192591412 X:72363045-72363067 CAGGAAAGACAAGGGCAGGGTGG + Intronic
1192612892 X:72585629-72585651 CGGGAAGCGCAAGGGGTTGGGGG + Intronic
1192629061 X:72760935-72760957 CAGGAAGCACAAGGGGTCGGGGG - Intergenic
1192637227 X:72831209-72831231 CAGGAAGCACAAGGGGTCAGGGG - Intronic
1192644487 X:72889605-72889627 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1192652649 X:72959879-72959901 CAGGAAGCACAAGGGGTCGGGGG + Intergenic
1192805384 X:74504310-74504332 CAGGAGGCAAGATGGGTGGGTGG - Intronic
1192825891 X:74695897-74695919 CAGGAACCACAAGGGGTCAGGGG + Intergenic
1192857307 X:75025744-75025766 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1192936423 X:75863175-75863197 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1192949165 X:75998063-75998085 TGGGAAGCACAAGGGGTAGGGGG - Intergenic
1192973792 X:76261440-76261462 CGGGAAGTGCAAGGGGTTGGGGG - Intergenic
1193001536 X:76568224-76568246 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1193281547 X:79656391-79656413 CTGGAAGCACAAGGGGTTGGGGG - Intergenic
1193338548 X:80319454-80319476 CAGGAAGTACAAGGGGTTGGGGG + Intergenic
1193477214 X:81981638-81981660 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1193640941 X:84009007-84009029 CTGGAGGCACAGGGGGTAGGGGG + Intergenic
1194098520 X:89673999-89674021 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1194576419 X:95619191-95619213 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
1194726895 X:97409579-97409601 CGGGAAGCACAAGGGGTCAGAGG + Intronic
1195508243 X:105684241-105684263 GGGGAAGCACAAGGGGTTGGGGG + Intronic
1195547283 X:106126780-106126802 CGGGAAGCACAAGGGGTCGGGGG - Intergenic
1195729297 X:107949487-107949509 CAGAAAGCACAAGGGGTGGGGGG - Intergenic
1195774863 X:108391768-108391790 CAGGAAGCACAAGGGGTCGGGGG - Intronic
1195810698 X:108825467-108825489 CAGGAAGCACAAGGGGTCGAGGG - Intergenic
1195947379 X:110229714-110229736 CGGGAAGCGCAAGGTGTTGGGGG + Intronic
1196012541 X:110904265-110904287 CAGGAAGTGCAAGGGGTTGGGGG - Intergenic
1196094492 X:111784630-111784652 CAGGAAGCACAAGGGGTTGGGGG + Intronic
1196158987 X:112461988-112462010 CAGGAAGTGCAAGGGGTCAGGGG + Intergenic
1196545804 X:116962849-116962871 CTGGAAGCACAAGGGGTCAGGGG - Intergenic
1197186252 X:123590485-123590507 AAGGAAGCACAGAGGATGGGTGG - Intergenic
1197346144 X:125327215-125327237 CATGAAGCAGGAGGGGTGGAAGG + Intergenic
1197699499 X:129588074-129588096 CAGGAAGCAAAAGGGAAGGGTGG - Intronic
1198293725 X:135263751-135263773 CAGGAAGCACAAGGGGTCAGGGG - Intronic
1198571264 X:137959862-137959884 CGGGAAGCACAAGGGGTCAGGGG + Intergenic
1198572327 X:137971159-137971181 TGGGAAGCACAAGGGGTCAGGGG + Intergenic
1198595445 X:138230918-138230940 CAGGAAGTACAAGGGGTCAGGGG + Intergenic
1198725853 X:139676258-139676280 CGGGAAGCACAAGGGGTCAGGGG - Intronic
1199180963 X:144853829-144853851 GGGGAAGCACAAGGGGTCGAGGG + Intergenic
1199292317 X:146119044-146119066 CGGGAAGCGCAAGGGGTCAGGGG + Intergenic
1199344145 X:146719245-146719267 AGGGAAGCACAAGGGGTTGGGGG + Intergenic
1199383751 X:147200479-147200501 CGGGAAACACAAGGGTTTGGGGG + Intergenic
1199744999 X:150766909-150766931 CAGAAAGCACCCGGGGCGGGGGG + Exonic
1199796182 X:151200008-151200030 CGGGAAGCACAAGGGGTTGAGGG + Intergenic
1199814328 X:151384560-151384582 CAGGAAGCAAAAGGAGGGGTTGG + Intergenic
1199968548 X:152841241-152841263 CAGGAAGTGCAAGGGGTTGGGGG - Intronic
1200059440 X:153477686-153477708 CAGGACGCACAAGGAGATGGTGG + Intronic
1200243090 X:154507921-154507943 CGGGTAGCACCGGGGGTGGGGGG + Intronic
1200371424 X:155728746-155728768 TGGGAAGCACAAGGGGTCAGGGG - Intergenic
1200378447 X:155808976-155808998 CAGGAAGCGCAAGGGGTCGGGGG + Intergenic
1200451542 Y:3335374-3335396 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1200810518 Y:7479766-7479788 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1201182136 Y:11358985-11359007 CGGGAAACATAAGGGGTTGGGGG + Intergenic
1201583144 Y:15532192-15532214 CAGGAAATGCAAGGGGTTGGGGG - Intergenic
1201590562 Y:15610533-15610555 CAGGAAGTGCAAGGAGTGTGGGG + Intergenic
1201913582 Y:19158234-19158256 CAGGAAGTTCAAGGGGTCAGGGG + Intergenic
1201938673 Y:19435090-19435112 CAGGAAGCACAAAGGGTTGGGGG + Intergenic
1202040191 Y:20674701-20674723 CAGGAAGCACAAGGGGTCAGTGG + Intergenic
1202057335 Y:20848630-20848652 CAGGAAGTGCAAGGGGTCAGGGG - Intergenic
1202085233 Y:21129445-21129467 CAGGAAGTGCAAGGGGTCAGGGG - Intergenic
1202257541 Y:22937665-22937687 TAGCAAGCACAAGGGGTCGATGG - Intergenic
1202410531 Y:24571412-24571434 TAGCAAGCACAAGGGGTCGATGG - Intergenic
1202460250 Y:25098660-25098682 TAGCAAGCACAAGGGGTCGATGG + Intergenic