ID: 917114484

View in Genome Browser
Species Human (GRCh38)
Location 1:171588731-171588753
Sequence CTCATTATCAGAGCTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917114484_917114490 24 Left 917114484 1:171588731-171588753 CCCCACACAGCTCTGATAATGAG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 917114490 1:171588778-171588800 AGGAGTTGACTTTTCAGCGAAGG 0: 1
1: 0
2: 1
3: 8
4: 114
917114484_917114488 4 Left 917114484 1:171588731-171588753 CCCCACACAGCTCTGATAATGAG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 917114488 1:171588758-171588780 TTTCCTTTTAACTTTTTTTAAGG 0: 1
1: 2
2: 25
3: 266
4: 2606
917114484_917114491 25 Left 917114484 1:171588731-171588753 CCCCACACAGCTCTGATAATGAG 0: 1
1: 0
2: 1
3: 17
4: 210
Right 917114491 1:171588779-171588801 GGAGTTGACTTTTCAGCGAAGGG 0: 1
1: 0
2: 2
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917114484 Original CRISPR CTCATTATCAGAGCTGTGTG GGG (reversed) Intronic
901507616 1:9695495-9695517 CTCATTCTCTGATCTGTATGTGG - Intronic
902561768 1:17281987-17282009 CCCATTGTCAGAGCCTTGTGGGG + Intronic
904463006 1:30691568-30691590 TTCATTCTCATAGCAGTGTGGGG - Intergenic
905092034 1:35437397-35437419 CTCATGAACAGATCTGTGGGTGG - Intronic
905392399 1:37645615-37645637 CCCATTATTAGAGATGTGGGTGG + Intergenic
905719700 1:40186672-40186694 CTCATTCTGAAAGCTCTGTGAGG + Intronic
905873492 1:41418019-41418041 GTCAGTGTCTGAGCTGTGTGAGG + Intergenic
908741689 1:67335361-67335383 ATCATTAACAGTGCTGTGTTAGG + Intronic
910044324 1:82893271-82893293 CACATTATAAGAGTTCTGTGAGG - Intergenic
911854301 1:102857398-102857420 TTCATTCTGAGAGCTGTGGGAGG + Intergenic
912101231 1:106208524-106208546 CTCATTTTAATTGCTGTGTGGGG - Intergenic
913182923 1:116339999-116340021 CTCATGCTAACAGCTGTGTGAGG - Intergenic
913529424 1:119723072-119723094 CACATGATCAGATTTGTGTGTGG - Intronic
914310483 1:146461635-146461657 TTCATTTTCAGAGCTGGGTTTGG + Intergenic
915629890 1:157144881-157144903 CTCATTACTTGAACTGTGTGTGG + Intergenic
915886037 1:159722465-159722487 CTCACAGTCAGAGCTGTGAGAGG + Intergenic
917114484 1:171588731-171588753 CTCATTATCAGAGCTGTGTGGGG - Intronic
917624909 1:176835850-176835872 CTCATTATCAGAGGTCCCTGAGG + Intronic
918358749 1:183733084-183733106 CTCTTACTCAGAGCTCTGTGAGG - Intronic
923050306 1:230387027-230387049 CTCCTTTTCAGAGCTCAGTGAGG - Intronic
924021416 1:239787675-239787697 CTCATTAACAGAGGAGTGTGAGG - Intronic
924611494 1:245577422-245577444 CTAATTCTCTGAGCTCTGTGTGG - Intronic
1062816905 10:507485-507507 TGCACTATCAGAGGTGTGTGAGG + Intronic
1065578715 10:27150313-27150335 CTCATTATTATAGCTGTTTGAGG - Intronic
1065708054 10:28489308-28489330 CTCAGTCCCAGAGCTGTGGGAGG + Intergenic
1066271515 10:33828840-33828862 CTCAGCATCTGAGCTGAGTGTGG + Intergenic
1066389777 10:34969383-34969405 CGCCTCATCAGAGCAGTGTGTGG + Intergenic
1068607770 10:59024906-59024928 CTCATTATAATTGCTGTCTGAGG - Intergenic
1071751626 10:88484420-88484442 CTCATTATCATAGATGAGTGAGG - Intronic
1073046420 10:100641684-100641706 CCCATCATCAGAGCTGTGTTTGG + Intergenic
1074944972 10:118272463-118272485 CTCATTACCAGAGGTTTGTATGG - Intergenic
1076545927 10:131245799-131245821 CTTTGTATCAGAGCTCTGTGGGG + Intronic
1076563647 10:131383416-131383438 CTAATTCTCAAAGCCGTGTGGGG - Intergenic
1077699889 11:4431595-4431617 CTCATCCTCCGAGCTGTGTTAGG - Intergenic
1078950531 11:16127782-16127804 CTCATTATCCATGCTGTTTGAGG - Intronic
1079968551 11:27007787-27007809 CTCATTATATGGGCTGTTTGTGG + Intergenic
1085312951 11:75526638-75526660 CTCAAGAGCAGAGTTGTGTGAGG + Intergenic
1085382087 11:76129064-76129086 CTAATTCACAGGGCTGTGTGAGG - Intronic
1090347349 11:126082339-126082361 AACGTTTTCAGAGCTGTGTGAGG - Intergenic
1090539627 11:127686964-127686986 CTCTTTATCAGATCCATGTGTGG + Intergenic
1090770388 11:129914626-129914648 CTCATTCTCAGAGCTGGGGCTGG - Intronic
1092503644 12:9072697-9072719 CTCATTGCCAGAGCTGCCTGGGG - Exonic
1093616935 12:21236594-21236616 CAGATTATCAGAGATGTGAGGGG + Intronic
1097598823 12:61667261-61667283 TTCATTGTCAGTTCTGTGTGGGG + Intergenic
1101804667 12:108052976-108052998 CTCATCATCAGAACAGTATGGGG + Intergenic
1102733322 12:115134548-115134570 CTCATGACCAGTGCTGTGGGTGG + Intergenic
1103988999 12:124785879-124785901 CTCATGATAGGAGCTGTGAGGGG - Intronic
1103999505 12:124851560-124851582 CTCATTAGCAGGACTGTGCGAGG - Intronic
1104324903 12:127786510-127786532 ATCATTATCTGAGTTTTGTGGGG + Intergenic
1104720608 12:131043238-131043260 CTCTTCACCAGAGCTGTGGGAGG - Intronic
1104863353 12:131937337-131937359 CATATTATCATAGTTGTGTGTGG + Intronic
1108035167 13:46283823-46283845 TCCATTATCAGAGTTTTGTGTGG + Intergenic
1108734628 13:53269736-53269758 CTCAGTAACAGAGCTGTGCCTGG + Intergenic
1112561274 13:100516863-100516885 GACATTATCAGAGCTGTCAGTGG + Intronic
1112653490 13:101423783-101423805 CTTATTATCAGAGAAGTTTGAGG - Intergenic
1115366504 14:32563474-32563496 CTCATTATTAGTACTGTGGGGGG + Intronic
1118604957 14:67495994-67496016 TTCACTGTCACAGCTGTGTGTGG + Intronic
1118857792 14:69637533-69637555 CTCTCTTTCTGAGCTGTGTGTGG + Intronic
1120047000 14:79819196-79819218 GTCATTATAAGAGCTGATTGAGG - Intronic
1121984662 14:98493106-98493128 CTCTTTCGCAGAGCTGTGTGAGG - Intergenic
1122713312 14:103676949-103676971 CTCCTTATCAGTGGGGTGTGAGG - Intronic
1123017330 14:105381666-105381688 CTCACAGGCAGAGCTGTGTGGGG + Intronic
1124686468 15:31786882-31786904 CTCATTATGAAATGTGTGTGAGG + Intronic
1125511295 15:40293841-40293863 CTCATGGCCAGAGCTGAGTGAGG - Intronic
1129048036 15:72754306-72754328 CTCGTCATCAGCGGTGTGTGGGG - Intronic
1130961020 15:88658723-88658745 CACATTGTCAGGGCTGTGTCTGG + Intergenic
1131061763 15:89408879-89408901 TTCATTTTCAGAGCTGCCTGTGG - Intergenic
1131494092 15:92889936-92889958 CACATTATCAGAGCAGTGTGAGG + Intronic
1131649051 15:94378968-94378990 CTCATTATCATAGGAGTCTGGGG + Intronic
1136044844 16:27607411-27607433 CTGTTTATCAGTGCTGTCTGTGG - Intronic
1137557267 16:49478509-49478531 CTCATTACTATAGCTGGGTGGGG - Intergenic
1138456005 16:57121152-57121174 CTCAGTGTCACAGATGTGTGAGG + Exonic
1138866067 16:60821411-60821433 CTCATTCTAAGAACTGCGTGTGG - Intergenic
1141050789 16:80761510-80761532 CTCATTTTGAGAGCTGTGGCAGG - Intronic
1141118936 16:81335783-81335805 GTCATTCTAAGATCTGTGTGAGG + Intronic
1141909332 16:87047857-87047879 CTCATTATCAGATCTAATTGTGG - Intergenic
1145284511 17:21495420-21495442 CGGGTTATCAGAGCTGTGGGTGG - Intergenic
1149309199 17:55377841-55377863 CGCATGAGAAGAGCTGTGTGTGG + Intergenic
1149668987 17:58388309-58388331 CACATTATCAGACCTGTTTCTGG + Intronic
1151967609 17:77439590-77439612 GTCATTTTCTGAGCTGAGTGGGG + Intronic
1152255644 17:79237807-79237829 GTCATTTTGTGAGCTGTGTGTGG - Intronic
1153120463 18:1718588-1718610 CTCATTTTCAGGGCTGGGCGTGG + Intergenic
1153147252 18:2047550-2047572 ATGTTTATAAGAGCTGTGTGTGG - Intergenic
1153483113 18:5567139-5567161 TTCTTCAGCAGAGCTGTGTGAGG - Intronic
1155747019 18:29367495-29367517 CTAAATTTCAGTGCTGTGTGGGG + Intergenic
1161775133 19:6257215-6257237 GACATTATCAGGGCTGGGTGCGG + Intronic
1162908285 19:13836194-13836216 CTCAGAATCAGACCTGTGTCTGG - Intergenic
1164798353 19:31054780-31054802 GTCATTATCAGAGGTTGGTGTGG - Intergenic
1166422499 19:42649974-42649996 CTGATGACCAGAGCTGTGTGTGG - Intronic
1166427233 19:42689629-42689651 CTGATGGTCAGGGCTGTGTGTGG + Intronic
1166438528 19:42789957-42789979 CTGATGGTCAGACCTGTGTGGGG + Intronic
1166467419 19:43044609-43044631 CTGATGGTCAGACCTGTGTGGGG + Intronic
1166473553 19:43100690-43100712 CTGATGGTCAGACCTGTGTGGGG + Intronic
1166487492 19:43225799-43225821 CTGATGGTCAGACCTGTGTGGGG + Intronic
926768836 2:16350084-16350106 CTGATTATCAGAGATGTCTGAGG - Intergenic
927317549 2:21702727-21702749 GTCATTTTCAGATCTGTTTGAGG + Intergenic
927697858 2:25250407-25250429 CTCATTTTCCCAGCTGTTTGGGG - Intronic
927853234 2:26512930-26512952 CCCAATAGCAGAGCTGTGAGTGG + Intronic
931919868 2:67003126-67003148 CTCATAATCAGTGCTGAGTCAGG + Intergenic
932718745 2:74122982-74123004 TTCATTATCAAGGCTGGGTGTGG - Intergenic
936694280 2:114928383-114928405 CTGATTTTCAGACTTGTGTGGGG - Intronic
937133039 2:119527604-119527626 TTAATTAACAGAGCTCTGTGAGG + Intergenic
937505324 2:122530404-122530426 CTCATAGTTAGAGCTGGGTGTGG + Intergenic
938762479 2:134438428-134438450 CTGATGATCAGAGCTGAGTGGGG - Intronic
941544371 2:166829625-166829647 CTCATTGTCAGAATTTTGTGAGG - Intergenic
946160436 2:217832434-217832456 CTTCTTCTCAGAGCTGTGTCAGG - Intronic
946941400 2:224773584-224773606 CTCATTCTCAGGGCTGTTTTAGG + Intronic
946964447 2:225022872-225022894 CTCATTATGAGAACTTTGTATGG + Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1171336270 20:24388520-24388542 CTCACCATGAGGGCTGTGTGAGG + Intergenic
1173905048 20:46621133-46621155 CTCATTATGAGAGTTTTATGAGG + Intronic
1174127697 20:48319378-48319400 CCCTTTCTCAGAGCTGTGAGAGG - Intergenic
1174761275 20:53209465-53209487 CATTTTATCAGAGCTGTTTGGGG + Intronic
1177806737 21:25882547-25882569 GTCACTGTTAGAGCTGTGTGTGG + Intronic
1178809683 21:35870039-35870061 CTGATTATCAGTGGTGGGTGTGG + Intronic
1179329509 21:40385104-40385126 TTCATTGTCACAGCTATGTGTGG - Intronic
1183573479 22:38671775-38671797 GTCAGTAGCAGAGCTGGGTGAGG - Intronic
1184521415 22:44996421-44996443 CTGATGATGAGAGCTGTCTGGGG - Intronic
1184528578 22:45040235-45040257 GTCATCATCAGAGCTGTGCCTGG - Intergenic
950318499 3:12027109-12027131 CTCATCATCAGAGGTGAATGTGG + Intronic
951671109 3:25182988-25183010 CTCCTTCTAAGAGCTGTGGGGGG - Intronic
952875969 3:37944736-37944758 TTCATTTTCACAGCTGTGGGAGG - Intronic
952972274 3:38659136-38659158 CCCCTCATCAGAGCAGTGTGGGG - Intergenic
953728160 3:45419220-45419242 TTCATTAACAAAGCAGTGTGTGG + Intronic
954914793 3:54139528-54139550 CTCATTCTTAGAGTTGTGTATGG + Intronic
955442589 3:58973556-58973578 TCCATTCTCAGAGCAGTGTGAGG - Intronic
957915444 3:86682602-86682624 CACATTCTCAGAGCTCTGAGAGG - Intergenic
959262748 3:104102595-104102617 CACATTTTCAGAGCAGTGAGAGG - Intergenic
959292622 3:104493737-104493759 CTCATTATGAGAGCTGAGGCGGG + Intergenic
960311229 3:116118699-116118721 CTCTTTATCAGGCATGTGTGTGG - Intronic
961036456 3:123645777-123645799 CTCATTCTCACAGCTCTGTGGGG - Intronic
963492556 3:146019201-146019223 ATAATTATCAGAGCAGGGTGTGG - Intergenic
963917798 3:150875701-150875723 CTCACTATGAGAGCTCTGTAAGG - Intronic
965056361 3:163721961-163721983 CCCATTTGCAGAGCTGTGGGTGG - Intergenic
965158676 3:165100511-165100533 GGCATTATCATAGCTGTGTCTGG + Intergenic
966622544 3:181981535-181981557 TTGATAATCAGAGCTGTGTTGGG + Intergenic
967807871 3:193731194-193731216 CTCATTCTCAGAGCTGGGGGAGG - Intergenic
968785735 4:2621102-2621124 CTCCTCATCAGTGGTGTGTGGGG - Intronic
970129608 4:12852922-12852944 ATCCTGATCAGAGTTGTGTGTGG + Intergenic
973272388 4:48274770-48274792 TTAATTCTCACAGCTGTGTGAGG + Intergenic
979090012 4:116471161-116471183 CTCATTATCAGAACAGCTTGAGG - Intergenic
979483313 4:121242693-121242715 CTCATCATCAGAGCTCTTTAGGG + Intergenic
981283590 4:142990116-142990138 CTCATTCTCATGTCTGTGTGGGG + Intergenic
981561274 4:146050879-146050901 GTCAATATCTGAGCTGGGTGAGG + Intergenic
983310923 4:166060097-166060119 CTCCTAATAAGAACTGTGTGTGG + Exonic
983336357 4:166398490-166398512 CTCAATTTCAGAGCTGTGGTGGG - Intergenic
983771821 4:171559978-171560000 CTCATTATCATAGGCCTGTGTGG - Intergenic
984512426 4:180694549-180694571 CTCAATATGAGATTTGTGTGGGG + Intergenic
984673175 4:182515896-182515918 CTGCTTCTTAGAGCTGTGTGTGG - Intronic
986553440 5:8984161-8984183 TCCATAATCAGACCTGTGTGTGG - Intergenic
986680557 5:10229361-10229383 CTCATGAGCAGTGCGGTGTGTGG + Intronic
988948451 5:36232074-36232096 TTTAATATCAGAGCTGTGTGGGG - Intronic
992221370 5:74577069-74577091 GTCATTCTCAGAGCTCTCTGTGG - Intergenic
995238588 5:109859193-109859215 CTGAATCTCAGTGCTGTGTGTGG + Intronic
995353046 5:111204149-111204171 CTCATTGGAAGAGATGTGTGTGG + Intergenic
995456052 5:112353563-112353585 CCCATTTTCAGACCTGTGGGAGG + Intronic
995897631 5:117033049-117033071 CTCTATTTCAGTGCTGTGTGAGG + Intergenic
995956569 5:117783806-117783828 TTCATTATCAGTGCTGTCTCAGG - Intergenic
996883322 5:128326209-128326231 TTCTTTATCAGAGCTTTATGTGG + Intronic
997460848 5:134051258-134051280 CTCAGCATCAGAGCTGGGTTGGG - Intergenic
998566197 5:143217908-143217930 GTCATTCTCAGAGCAGTGGGAGG - Intronic
998924962 5:147113133-147113155 TTCCTTATCAGGGCTGTCTGTGG + Intergenic
999480715 5:151945712-151945734 CTCAGTATCAGTCCTGTGTCAGG - Intergenic
1000156870 5:158560939-158560961 ATCCTTATGAGAGCTTTGTGAGG + Intergenic
1000255738 5:159536598-159536620 CTCATTACCTGTGCTGTTTGGGG - Intergenic
1000850866 5:166339024-166339046 CTCATTATAACACCAGTGTGAGG - Intergenic
1001078429 5:168647734-168647756 CTCATTATCACAACAGTATGGGG + Intergenic
1003043453 6:2711068-2711090 CTCATGTACACAGCTGTGTGTGG - Intronic
1003076372 6:2987008-2987030 CTCATCATCAGAGTTATGTATGG + Intergenic
1003577927 6:7314687-7314709 CTCTATGTCAGAGCTGTGTCTGG + Intronic
1003587330 6:7404309-7404331 CTCATCATGTGAGCTGTATGTGG - Intronic
1008019476 6:46559645-46559667 CTCATTTTCAGTGCTGTGGGTGG + Intronic
1008435623 6:51472758-51472780 CACATAATAACAGCTGTGTGTGG - Intergenic
1008774157 6:55015518-55015540 ATCATGAACAGAGTTGTGTGAGG + Intergenic
1010509980 6:76706482-76706504 CTCCTTATCAGATCTATGTTTGG + Intergenic
1010546383 6:77162198-77162220 GTCATTCTCATTGCTGTGTGTGG + Intergenic
1010890931 6:81309565-81309587 CTCATTATGAGATCTGTAAGGGG + Intergenic
1010931671 6:81811267-81811289 CTGAGTAACTGAGCTGTGTGAGG - Intergenic
1011170024 6:84495088-84495110 CTCTTGATCAGAGCTGAATGTGG - Intergenic
1014649319 6:124016739-124016761 GTCCTTATAACAGCTGTGTGAGG + Intronic
1015048738 6:128813107-128813129 ATAATTGTCAAAGCTGTGTGAGG - Intergenic
1015523736 6:134156349-134156371 CTCATTTTCTGAGCTAAGTGAGG + Intergenic
1015679589 6:135790580-135790602 CTCCTTAGCAGATATGTGTGTGG - Intergenic
1017501341 6:155026057-155026079 ATCATTATCAGAGCTCTGGCTGG - Intronic
1018475238 6:164133930-164133952 AACAATAGCAGAGCTGTGTGTGG - Intergenic
1018622566 6:165745409-165745431 CTAATAATCAGAGCTGTTTAAGG - Intronic
1019046043 6:169146973-169146995 CTCATTACCTGAGCTGGGTGGGG - Intergenic
1023474616 7:40563413-40563435 GTCATTATTTGGGCTGTGTGTGG + Intronic
1024124463 7:46278328-46278350 CTTACTATCAGAACAGTGTGGGG - Intergenic
1030677174 7:112396052-112396074 CTCATTATCTGAGCTGTCAGTGG + Intergenic
1031048819 7:116924294-116924316 CTCATAACATGAGCTGTGTGTGG + Intergenic
1031511478 7:122656215-122656237 CTCACTATTAGAACTTTGTGGGG - Intronic
1035122353 7:156579210-156579232 CTCATGATCACAGCTGGGTTAGG + Intergenic
1035261484 7:157664353-157664375 TTCATTATCAGACTTCTGTGGGG + Intronic
1036037421 8:5034333-5034355 CTAATTATCTGAGCTGAGTTGGG - Intergenic
1036470255 8:9046634-9046656 CTCATTTCCAGAGTTGTTTGGGG - Intronic
1037419777 8:18689830-18689852 CTTATTATTAGAGCTGGGAGAGG + Intronic
1038840761 8:31182715-31182737 CTGCTTATCAGAGCTATGTGTGG + Intergenic
1039421633 8:37448269-37448291 GTCATTGTCACGGCTGTGTGGGG - Intergenic
1040379143 8:46855404-46855426 CTCATTATCATGCCTGTTTGCGG - Intergenic
1041328126 8:56691328-56691350 ATCTTTATCAGATTTGTGTGTGG - Intergenic
1042560321 8:70069153-70069175 CCCTTTACCAGAGCTGTCTGGGG + Exonic
1042645600 8:70982770-70982792 CTCATATACAGAGCAGTGTGTGG - Intergenic
1042653291 8:71067098-71067120 CTAATTGTCACAGCTGGGTGTGG - Intergenic
1043099905 8:76030843-76030865 CCCATTCTGACAGCTGTGTGGGG - Intergenic
1044085623 8:87938762-87938784 CTCATCATCAGATCTAGGTGTGG + Intergenic
1045499369 8:102733167-102733189 GTAATTGTCAGAACTGTGTGAGG - Intergenic
1045675182 8:104599847-104599869 CCCATTATCAGAGGCGTGTGTGG + Intronic
1046658954 8:116927773-116927795 CTCATTAGAAGAGCTGGGTAAGG + Intergenic
1046721375 8:117622929-117622951 CTCTTTATCAGGTCTGGGTGTGG - Intergenic
1047050112 8:121101605-121101627 CTTATTATCAGAGTTTTGAGAGG - Intergenic
1048211956 8:132461921-132461943 CTCTTTATCAGATAGGTGTGTGG + Intronic
1049298874 8:141859224-141859246 CGCATCATGAGGGCTGTGTGGGG + Intergenic
1051535053 9:18148023-18148045 TACATTATAAGAGCTGTGTCAGG - Intergenic
1051986475 9:23095580-23095602 CTCACTATCAGAACAGTATGGGG - Intergenic
1059158028 9:112006883-112006905 CTCATGATCATAGCTGTGATGGG - Intergenic
1061154281 9:128847632-128847654 GTTATTGTTAGAGCTGTGTGTGG - Intronic
1185531327 X:821294-821316 CTCAATGCCAGAGTTGTGTGAGG + Intergenic
1188487470 X:30699003-30699025 TTCATTATCATAGCTATGTGAGG + Intronic
1192082387 X:68060890-68060912 CACAGGGTCAGAGCTGTGTGTGG + Intronic
1196427889 X:115590449-115590471 CTCACCATCCGAGGTGTGTGTGG - Intronic
1196632317 X:117956104-117956126 CACATTAGCAGAGTTGTCTGTGG - Intronic
1198409049 X:136347350-136347372 CTTATTGGCAGAGATGTGTGAGG - Exonic
1199089657 X:143676632-143676654 CTCAATATAAGGGCTGTGTCTGG - Intergenic
1199548082 X:149029435-149029457 CTCAGTAATAGAGCTGTGAGAGG - Intergenic
1200153182 X:153961463-153961485 CTCAGCCTAAGAGCTGTGTGGGG - Intronic
1202239375 Y:22751147-22751169 CTCAATATCAGAAATGTATGAGG + Intergenic
1202392362 Y:24384909-24384931 CTCAATATCAGAAATGTATGAGG + Intergenic
1202478422 Y:25285208-25285230 CTCAATATCAGAAATGTATGAGG - Intergenic