ID: 917114569

View in Genome Browser
Species Human (GRCh38)
Location 1:171589531-171589553
Sequence GGTCCTTGTGGATCACTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917114566_917114569 -8 Left 917114566 1:171589516-171589538 CCACATGTAGCCAGGGGTCCTTG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 917114569 1:171589531-171589553 GGTCCTTGTGGATCACTATCTGG 0: 1
1: 0
2: 0
3: 3
4: 50
917114560_917114569 21 Left 917114560 1:171589487-171589509 CCACAGGCCTCATGAGCCATGCT 0: 1
1: 0
2: 9
3: 279
4: 2291
Right 917114569 1:171589531-171589553 GGTCCTTGTGGATCACTATCTGG 0: 1
1: 0
2: 0
3: 3
4: 50
917114561_917114569 14 Left 917114561 1:171589494-171589516 CCTCATGAGCCATGCTCGTTTGC 0: 1
1: 0
2: 0
3: 10
4: 62
Right 917114569 1:171589531-171589553 GGTCCTTGTGGATCACTATCTGG 0: 1
1: 0
2: 0
3: 3
4: 50
917114559_917114569 28 Left 917114559 1:171589480-171589502 CCGCTGACCACAGGCCTCATGAG 0: 1
1: 0
2: 1
3: 35
4: 296
Right 917114569 1:171589531-171589553 GGTCCTTGTGGATCACTATCTGG 0: 1
1: 0
2: 0
3: 3
4: 50
917114562_917114569 5 Left 917114562 1:171589503-171589525 CCATGCTCGTTTGCCACATGTAG 0: 1
1: 0
2: 0
3: 3
4: 65
Right 917114569 1:171589531-171589553 GGTCCTTGTGGATCACTATCTGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917114569 Original CRISPR GGTCCTTGTGGATCACTATC TGG Intronic
904190346 1:28737959-28737981 CATCCTCGTGGATCACTCTCTGG + Intronic
905880545 1:41460509-41460531 TGCCCTTGTGGATCCCAATCAGG + Intergenic
909946088 1:81664615-81664637 GTTCTTTCTGAATCACTATCTGG - Intronic
917114569 1:171589531-171589553 GGTCCTTGTGGATCACTATCTGG + Intronic
917274428 1:173317076-173317098 GGGCCTTTTGGAACACTCTCTGG + Intergenic
922014396 1:221630368-221630390 GGCTCTTGTGGACCATTATCAGG + Intergenic
922158899 1:223063439-223063461 GGTCCATGTGGATAAATGTCGGG - Intergenic
922758176 1:228108195-228108217 GGTCCCTGGGGATTACTGTCAGG - Intronic
1070745834 10:78933267-78933289 GGTGCCTTTGGATCACTCTCTGG - Intergenic
1071263923 10:83946720-83946742 AGTCCATGTTGATCACTACCTGG + Intergenic
1075366982 10:121899892-121899914 GGTTCTTGTGAATAACCATCTGG + Exonic
1080068705 11:28052322-28052344 GGGCCTTGTAGGTTACTATCAGG - Intronic
1090763667 11:129858260-129858282 GGTCCGTGTGGAACTCTTTCTGG - Intronic
1099913358 12:88861013-88861035 GCTCCTTGGAGATCACTAGCTGG - Intergenic
1101626577 12:106448932-106448954 GTCCATTGTGGATCACGATCAGG + Intronic
1106946735 13:34836288-34836310 TGTCCTTGTATATCTCTATCTGG - Intergenic
1116701554 14:48250673-48250695 TGTCCTTGTGTGTCACCATCTGG - Intergenic
1117779129 14:59214269-59214291 AGTTCATGTGGATCACTATGAGG + Intronic
1119264525 14:73256091-73256113 GGTCCTTGGGGCTCACCAGCAGG + Intronic
1121971973 14:98366718-98366740 GGTCCCTGTGCATCACAATGAGG + Intergenic
1134841645 16:17406432-17406454 GGTTCCTGTGAATCACCATCTGG + Intronic
1138346230 16:56321996-56322018 GGTGCTGGCAGATCACTATCAGG + Intronic
1164794941 19:31018514-31018536 GGTCCTTGGGGATCACACTTGGG + Intergenic
1165322676 19:35095991-35096013 GGGCCTTGTGGGTCACTGTAAGG + Intergenic
931135164 2:59391024-59391046 GGACTTTGTGGATAACTCTCTGG + Intergenic
932563874 2:72893714-72893736 GCTCCTTGTGGATGATCATCGGG + Intergenic
935243431 2:101197779-101197801 GGGCCTCGTGGATTACTCTCGGG - Intronic
936766588 2:115856945-115856967 GTTCCTTGTGGAGCACTAATAGG + Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947861618 2:233362800-233362822 TGTCCATGTGGATCATCATCCGG - Intronic
948578916 2:238971070-238971092 GGCCCTTGTGGATAACTAGCGGG - Intergenic
1169426650 20:5502253-5502275 GGTCCTGGTGGAGCACTTCCAGG - Intergenic
969337408 4:6519819-6519841 TGTCTCTGTGGATCACTTTCAGG - Intronic
973686095 4:53371321-53371343 GGTTCTTGTGGACCACTACCAGG - Intergenic
977312381 4:95403667-95403689 GGTCTTTGTCCATCTCTATCTGG + Intronic
977886463 4:102257603-102257625 GGTCCATGTGGGTCAGTCTCTGG + Intronic
982047090 4:151458839-151458861 GGGCATAGTGGATCTCTATCAGG + Intronic
985179543 4:187241742-187241764 AGTCCTTGTATATCTCTATCAGG - Intergenic
989113483 5:37929636-37929658 GGTCCTTGTGGGTCTCCATCAGG - Intergenic
989831149 5:45921093-45921115 GGTCATTGTGGATCTCTTTGAGG - Intergenic
991428229 5:66514390-66514412 TGTCCTTGTGGATGACTGTGAGG - Intergenic
992971676 5:82066520-82066542 GGGCCTTGTAGTTCACTAACTGG + Intronic
1008832556 6:55783931-55783953 GTTAGTTGTGGTTCACTATCTGG - Intronic
1017831729 6:158136701-158136723 GGCCCTTGGGGACCACTATGAGG + Intronic
1031753907 7:125613242-125613264 GGCCCATGTGGACCACTGTCTGG - Intergenic
1035044619 7:155955465-155955487 TTTCCTTGTGGACCACTAGCTGG + Intergenic
1036002586 8:4624797-4624819 GGTCTGTGTGGGTCACTTTCTGG - Intronic
1039008304 8:33065462-33065484 CTTTCTTGTGGATCAGTATCTGG + Intergenic
1041545414 8:59036961-59036983 GGTCTTTCTGGATTAATATCTGG + Intronic
1061020231 9:128009616-128009638 GGGCCTTGTGGGTCACAATGGGG - Intergenic
1062543904 9:137053418-137053440 GGGGCTTGTGGATCCCCATCTGG + Intronic
1185642895 X:1598261-1598283 AGACCGTGTGGATCACTGTCTGG + Intronic
1195451046 X:105013386-105013408 AGTACTTGTGGAACAGTATCAGG - Intronic
1199845683 X:151691508-151691530 GGGCCTTGTAGACCACTGTCAGG - Intergenic