ID: 917118056

View in Genome Browser
Species Human (GRCh38)
Location 1:171622289-171622311
Sequence AAATCTCCACAGATGTCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917118056_917118065 29 Left 917118056 1:171622289-171622311 CCCTGCGACATCTGTGGAGATTT No data
Right 917118065 1:171622341-171622363 TTTCAGCTGCTGCTTTCTAAGGG No data
917118056_917118059 -10 Left 917118056 1:171622289-171622311 CCCTGCGACATCTGTGGAGATTT No data
Right 917118059 1:171622302-171622324 GTGGAGATTTCTCAAGGACACGG No data
917118056_917118062 -1 Left 917118056 1:171622289-171622311 CCCTGCGACATCTGTGGAGATTT No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118056_917118061 -2 Left 917118056 1:171622289-171622311 CCCTGCGACATCTGTGGAGATTT No data
Right 917118061 1:171622310-171622332 TTCTCAAGGACACGGCTCCAGGG No data
917118056_917118064 28 Left 917118056 1:171622289-171622311 CCCTGCGACATCTGTGGAGATTT No data
Right 917118064 1:171622340-171622362 GTTTCAGCTGCTGCTTTCTAAGG No data
917118056_917118060 -3 Left 917118056 1:171622289-171622311 CCCTGCGACATCTGTGGAGATTT No data
Right 917118060 1:171622309-171622331 TTTCTCAAGGACACGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917118056 Original CRISPR AAATCTCCACAGATGTCGCA GGG (reversed) Intergenic
No off target data available for this crispr