ID: 917118062

View in Genome Browser
Species Human (GRCh38)
Location 1:171622311-171622333
Sequence TCTCAAGGACACGGCTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917118055_917118062 4 Left 917118055 1:171622284-171622306 CCTCTCCCTGCGACATCTGTGGA No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118053_917118062 8 Left 917118053 1:171622280-171622302 CCATCCTCTCCCTGCGACATCTG No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118050_917118062 16 Left 917118050 1:171622272-171622294 CCCAAGACCCATCCTCTCCCTGC No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118048_917118062 18 Left 917118048 1:171622270-171622292 CCCCCAAGACCCATCCTCTCCCT No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118045_917118062 29 Left 917118045 1:171622259-171622281 CCCCTGCTCTGCCCCCAAGACCC No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118051_917118062 15 Left 917118051 1:171622273-171622295 CCAAGACCCATCCTCTCCCTGCG No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118057_917118062 -2 Left 917118057 1:171622290-171622312 CCTGCGACATCTGTGGAGATTTC No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118052_917118062 9 Left 917118052 1:171622279-171622301 CCCATCCTCTCCCTGCGACATCT No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118047_917118062 27 Left 917118047 1:171622261-171622283 CCTGCTCTGCCCCCAAGACCCAT No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118049_917118062 17 Left 917118049 1:171622271-171622293 CCCCAAGACCCATCCTCTCCCTG No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118056_917118062 -1 Left 917118056 1:171622289-171622311 CCCTGCGACATCTGTGGAGATTT No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data
917118046_917118062 28 Left 917118046 1:171622260-171622282 CCCTGCTCTGCCCCCAAGACCCA No data
Right 917118062 1:171622311-171622333 TCTCAAGGACACGGCTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917118062 Original CRISPR TCTCAAGGACACGGCTCCAG GGG Intergenic
No off target data available for this crispr