ID: 917118064

View in Genome Browser
Species Human (GRCh38)
Location 1:171622340-171622362
Sequence GTTTCAGCTGCTGCTTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917118063_917118064 -10 Left 917118063 1:171622327-171622349 CCAGGGGTAATTTGTTTCAGCTG No data
Right 917118064 1:171622340-171622362 GTTTCAGCTGCTGCTTTCTAAGG No data
917118056_917118064 28 Left 917118056 1:171622289-171622311 CCCTGCGACATCTGTGGAGATTT No data
Right 917118064 1:171622340-171622362 GTTTCAGCTGCTGCTTTCTAAGG No data
917118057_917118064 27 Left 917118057 1:171622290-171622312 CCTGCGACATCTGTGGAGATTTC No data
Right 917118064 1:171622340-171622362 GTTTCAGCTGCTGCTTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917118064 Original CRISPR GTTTCAGCTGCTGCTTTCTA AGG Intergenic
No off target data available for this crispr