ID: 917118065

View in Genome Browser
Species Human (GRCh38)
Location 1:171622341-171622363
Sequence TTTCAGCTGCTGCTTTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917118056_917118065 29 Left 917118056 1:171622289-171622311 CCCTGCGACATCTGTGGAGATTT No data
Right 917118065 1:171622341-171622363 TTTCAGCTGCTGCTTTCTAAGGG No data
917118057_917118065 28 Left 917118057 1:171622290-171622312 CCTGCGACATCTGTGGAGATTTC No data
Right 917118065 1:171622341-171622363 TTTCAGCTGCTGCTTTCTAAGGG No data
917118063_917118065 -9 Left 917118063 1:171622327-171622349 CCAGGGGTAATTTGTTTCAGCTG No data
Right 917118065 1:171622341-171622363 TTTCAGCTGCTGCTTTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917118065 Original CRISPR TTTCAGCTGCTGCTTTCTAA GGG Intergenic
No off target data available for this crispr