ID: 917118752

View in Genome Browser
Species Human (GRCh38)
Location 1:171627531-171627553
Sequence GCACTTTTTACTTTTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917118752_917118761 23 Left 917118752 1:171627531-171627553 CCTTCTTTAAAAGTAAAAAGTGC No data
Right 917118761 1:171627577-171627599 AGTTGGCTGTGCCATTGGTGTGG No data
917118752_917118762 30 Left 917118752 1:171627531-171627553 CCTTCTTTAAAAGTAAAAAGTGC No data
Right 917118762 1:171627584-171627606 TGTGCCATTGGTGTGGAAGTCGG No data
917118752_917118760 18 Left 917118752 1:171627531-171627553 CCTTCTTTAAAAGTAAAAAGTGC No data
Right 917118760 1:171627572-171627594 ATAGTAGTTGGCTGTGCCATTGG No data
917118752_917118755 6 Left 917118752 1:171627531-171627553 CCTTCTTTAAAAGTAAAAAGTGC No data
Right 917118755 1:171627560-171627582 TCTTCTACCCCCATAGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917118752 Original CRISPR GCACTTTTTACTTTTAAAGA AGG (reversed) Intergenic
No off target data available for this crispr