ID: 917121168

View in Genome Browser
Species Human (GRCh38)
Location 1:171645845-171645867
Sequence GGCCATGGTGGGATTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 6, 3: 33, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917121168_917121174 -4 Left 917121168 1:171645845-171645867 CCCTGCTGAATCCCACCATGGCC 0: 1
1: 0
2: 6
3: 33
4: 227
Right 917121174 1:171645864-171645886 GGCCCTTACGGCTCTGAGCAAGG 0: 1
1: 0
2: 1
3: 2
4: 90
917121168_917121178 21 Left 917121168 1:171645845-171645867 CCCTGCTGAATCCCACCATGGCC 0: 1
1: 0
2: 6
3: 33
4: 227
Right 917121178 1:171645889-171645911 CCCTTCAGATTGTGCCTTGCAGG 0: 1
1: 0
2: 1
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917121168 Original CRISPR GGCCATGGTGGGATTCAGCA GGG (reversed) Intronic
902753395 1:18533105-18533127 GGCCAAGTTGGGATTCAACCAGG + Intergenic
905889296 1:41509619-41509641 GGCCAGGGTGGGGTGCAGAAGGG + Exonic
907220643 1:52904849-52904871 GAGCAGGGTGGGAATCAGCATGG + Intronic
910095295 1:83514866-83514888 GGCCATGTGAGGACTCAGCAAGG - Intergenic
910216242 1:84847763-84847785 GGCCAGGTTGGGAATCAGGAAGG - Intronic
910702331 1:90089702-90089724 GTCCAGGGTGAGATACAGCATGG + Intergenic
912778543 1:112522867-112522889 GCCAATGGTGGGATTAAGGAGGG + Intronic
915447623 1:155983091-155983113 GGCCAAGGTAGGAGTCAGCTGGG - Intronic
917121168 1:171645845-171645867 GGCCATGGTGGGATTCAGCAGGG - Intronic
918181804 1:182090763-182090785 TGCCATGCTGGGATTCTGTAGGG - Intergenic
1063535236 10:6876730-6876752 GGCCATGTGGGGAAGCAGCAGGG + Intergenic
1066156624 10:32684564-32684586 GGCCACCTTGGGATTCATCAAGG - Intronic
1066281049 10:33918654-33918676 GGGCATGGTGGGGGTCAGGATGG + Intergenic
1067944534 10:50681848-50681870 GGTCATGGTGGGCTTCTGCCGGG - Intergenic
1069562347 10:69439606-69439628 GGCCTTGTTGGGGTTCAGCCAGG - Intergenic
1070663815 10:78329219-78329241 GAGAATGGTGGGATTCAGCAGGG - Intergenic
1070747062 10:78940100-78940122 GCTCATGCTGGGATGCAGCAAGG - Intergenic
1070866035 10:79708719-79708741 GGTCATGGTGGGCTTCCGCCGGG - Exonic
1070879828 10:79846850-79846872 GGTCATGGTGGGCTTCCGCCGGG - Exonic
1071632937 10:87230940-87230962 GGTCATGGTGGGCTTCCGCCGGG - Exonic
1071646386 10:87363158-87363180 GGTCATGGTGGGCTTCCGCCGGG - Exonic
1072768445 10:98115659-98115681 GGCCATGGTGGAGTTCTGCCGGG - Intergenic
1075727106 10:124616325-124616347 GGCAAGGGTGGGAAGCAGCACGG - Intronic
1076137905 10:128057419-128057441 GGCCTTGGTGGGATGGAGGAAGG + Intronic
1076227591 10:128792799-128792821 GACCTGGGTGGGATTCAGGATGG + Intergenic
1076395043 10:130132221-130132243 GAACATGGTGGGATTGACCATGG + Intergenic
1076779474 10:132716228-132716250 GGCCAGGATGGGGTTCAGGATGG - Intronic
1077135153 11:994650-994672 GGCCAGGGGGGCATCCAGCAGGG - Intronic
1077798166 11:5512801-5512823 GGCCATGTTGGGGCTCAGAAGGG + Intronic
1079735550 11:23993539-23993561 GGCCATGTTGGGATGCACCAAGG + Intergenic
1081458680 11:43250893-43250915 GGCCATGGAGGGACTGAGGAGGG - Intergenic
1082688944 11:56276522-56276544 GTAGATGATGGGATTCAGCATGG - Exonic
1083815917 11:65132428-65132450 GGCCATGGTGGGCTTGAGGGTGG - Intronic
1084945699 11:72637199-72637221 GGCCATGGTGATATAAAGCAGGG - Intronic
1086815779 11:91368691-91368713 GTACATAGTGGTATTCAGCATGG + Intergenic
1087158228 11:94924969-94924991 CACCATGGTGGGATAAAGCAAGG - Intergenic
1089202649 11:116733683-116733705 GGCCATGGTGGGAGGAAGCATGG - Intergenic
1092679145 12:10957980-10958002 AGCCATTGTGGAAATCAGCATGG + Intronic
1093771069 12:23019311-23019333 GGTCATGCTTGGATTCAGAAAGG - Intergenic
1093978700 12:25452296-25452318 GGCCACGCTGAGATTCATCAAGG + Intronic
1096626228 12:52897687-52897709 GGCTATGTTGGGAATGAGCAGGG - Intronic
1097479254 12:60100569-60100591 GGGCAGGGTGGCCTTCAGCAGGG + Intergenic
1098041271 12:66355975-66355997 GGCCATGCTGGGAATCAGGAAGG + Intronic
1099477195 12:83121983-83122005 GGGCATGGTGGGAGTCAGACCGG - Intronic
1099651960 12:85439907-85439929 GGGCATGTTGGGATTCATCAAGG - Intergenic
1101251163 12:102938096-102938118 AGCCATGTTGGAATTCAGCAAGG + Intronic
1101827775 12:108233813-108233835 GGGCATGGTGGGAGACATCAGGG + Intronic
1102902778 12:116651267-116651289 GGGCATGGGGGAATTGAGCAAGG + Intergenic
1103047481 12:117749356-117749378 AGCCAAGGTGGGATTCACCTTGG + Intronic
1103207480 12:119141563-119141585 GGCCCAGGTGGGATCCAGCTGGG - Intronic
1104719686 12:131038456-131038478 GGCCTGGGTGGGAATAAGCAGGG - Intronic
1104830830 12:131750107-131750129 GGCCCTGGTGGGAGGCAGGACGG - Intronic
1105881176 13:24607557-24607579 GGCTGTGTTGGGATTCATCAAGG - Intergenic
1106023488 13:25936278-25936300 GACCAACGTGGGAATCAGCAAGG - Intronic
1107484416 13:40812902-40812924 GGCTGTGTTGGGATTCATCAGGG + Intergenic
1107774372 13:43822729-43822751 GCCCATGGTGGGGTTCTGCCAGG + Intergenic
1114131594 14:19799742-19799764 GGCCATGTTAGGATTCATCAAGG + Intronic
1115855654 14:37627005-37627027 GGTCATGGTGGGATCCCTCATGG + Intronic
1116411135 14:44625457-44625479 GGCCATGATGCAATTCAGCCTGG - Intergenic
1117387672 14:55232319-55232341 GGCCAGGGTGGGTTTCTGCCTGG - Intergenic
1118817692 14:69324518-69324540 GGCCAGTGTGGGATGCAGCATGG + Intronic
1121516636 14:94556560-94556582 GGGCATGGTGGGAATGAGAATGG - Intergenic
1122784776 14:104158624-104158646 GGCAGTGGTGGGGATCAGCAGGG - Intronic
1123121448 14:105918811-105918833 GGTCATGGTGGGTTCCAGCTGGG + Intronic
1123503655 15:20915752-20915774 AGCCATGATGGGGATCAGCATGG + Intergenic
1123574659 15:21655447-21655469 GGCCATGTTAGGATTCATCAAGG + Intergenic
1123597142 15:21926717-21926739 AGCCATGATGGGGATCAGCATGG + Intergenic
1123611273 15:22097943-22097965 GGCCATGTTAGGATTCATCAAGG + Intergenic
1124954414 15:34350724-34350746 GGTCATAGTGGGCTTCAGCCGGG - Exonic
1126101063 15:45118460-45118482 GGCCAAGGTAGGTGTCAGCAAGG + Intronic
1128338022 15:66800867-66800889 GGCACTGGTGGGATTTGGCAAGG + Intergenic
1128512069 15:68319448-68319470 GGCCATGGTGGGAACCAGCAGGG + Intronic
1129177765 15:73852454-73852476 GTCCAAGGTGGGATTCTGGAAGG - Intergenic
1129678031 15:77642940-77642962 GGCCATGCAGCGAGTCAGCAAGG + Intronic
1131302413 15:91211078-91211100 GGGCAGGGTGTCATTCAGCAAGG + Intronic
1202969247 15_KI270727v1_random:216590-216612 AGCCATGATGGGGATCAGCATGG + Intergenic
1202983523 15_KI270727v1_random:389699-389721 GGCCATGTTAGGATTCACCAAGG + Intergenic
1132666029 16:1081717-1081739 GGGCAGGGTGGGCTTCTGCAGGG + Intergenic
1132993074 16:2807424-2807446 GCCCATTGTGGGTGTCAGCAGGG + Intergenic
1133302455 16:4790948-4790970 AGCCCTTGAGGGATTCAGCACGG + Intronic
1133915602 16:10106808-10106830 GGACATGGAGGGATTCATGAAGG + Intronic
1135880306 16:26249166-26249188 GGCCATGGTAAGAATCAGTATGG - Intergenic
1136409787 16:30069554-30069576 GACCATGTTGGGCTTCAGCAAGG - Exonic
1138120934 16:54400642-54400664 GGCCTCGGTGGGAGTCTGCAGGG - Intergenic
1141853722 16:86666525-86666547 GGCAATGGTGGTCTTTAGCATGG + Intergenic
1143681988 17:8482416-8482438 GGGCAGGGTGGGAGTCAGGAAGG + Intronic
1145898303 17:28473696-28473718 GGCCATGGTGTGGAGCAGCAAGG - Exonic
1145924215 17:28633699-28633721 GCCCATGCTGGGATCCAGCCTGG - Exonic
1146006490 17:29163756-29163778 GGCCTTGCTGTGGTTCAGCAGGG + Intronic
1147156668 17:38547637-38547659 GGCCATGGTGGGACTTGGGATGG + Intronic
1149035397 17:52128447-52128469 GGCCATTGTCAGATTCAGCAGGG - Intronic
1150341272 17:64369675-64369697 GGCCATGCTGGATTGCAGCATGG + Intronic
1150737510 17:67753103-67753125 GTCCAAGGTGGGATTGAGGAGGG - Intergenic
1150917035 17:69447747-69447769 GGCCATTGGGGCATTCAGAAGGG + Intronic
1151258604 17:72899229-72899251 GGGCAAGGTGGGGTACAGCAGGG - Intronic
1151335787 17:73438831-73438853 TGCCATGGGGGTATTCAGAAGGG + Intronic
1152845148 17:82595127-82595149 GGGCAACGTGGGATGCAGCAGGG + Intronic
1153223840 18:2883134-2883156 GGCCCTCTTGGGATTCTGCAGGG + Intronic
1153783348 18:8513482-8513504 GGCCATGGAGGGATCCAGACTGG - Intergenic
1153946040 18:10018320-10018342 GGCCATGGTGTGATTGTGAAGGG + Intergenic
1153954051 18:10081117-10081139 GTGCTCGGTGGGATTCAGCAAGG - Intergenic
1154172885 18:12063642-12063664 GGGCCTGGTGGGATTCAGATTGG - Intergenic
1155164841 18:23223769-23223791 GGCCATGCTGGGCTTCAGAAGGG - Intronic
1155398892 18:25416617-25416639 GGCCATGGGGGGATTGAGGAGGG + Intergenic
1156479473 18:37427060-37427082 TGCCATGGTGGGCTTCACCCAGG - Intronic
1156918993 18:42496042-42496064 GGCCATGGTTGTATTCATGAAGG - Intergenic
1157413268 18:47481585-47481607 GGCCAAGGTGGGAGTCAGATGGG + Intergenic
1158331544 18:56368197-56368219 GGGCATGGTGGGAGTGAGAATGG - Intergenic
1158448630 18:57543297-57543319 GGCCTTTGGGGGATTCAGAAGGG + Intergenic
1159359608 18:67382340-67382362 GGACACGATGGGATTCATCAAGG - Intergenic
1160554594 18:79717304-79717326 GGCCTTGGTGGGGTGCAGCCGGG + Intronic
1160554604 18:79717331-79717353 GGCCCTGGTGGGGTACAGCTGGG + Intronic
1160806217 19:993340-993362 GGCCACAGTGGGATTCCGGAGGG + Intronic
1160817120 19:1041345-1041367 GGCCATGGTGAGACTGGGCAGGG - Exonic
1160914406 19:1489940-1489962 GGCCCTCGGGGGCTTCAGCAGGG - Intronic
1161452203 19:4352816-4352838 GGCTGGGGTGGGATTTAGCAGGG + Intronic
1162904069 19:13813132-13813154 GGCCATGGTGGGCTGCAGGCTGG - Exonic
1164713187 19:30373879-30373901 GGCCAAGGTGGGCCTCAGCAAGG + Intronic
1166374004 19:42316838-42316860 GGCCATGAGGGGAGACAGCAGGG - Intronic
1167433948 19:49468478-49468500 GGCCAGGGCGGGAGCCAGCAGGG - Exonic
1167596159 19:50429220-50429242 GGCCAGAGTGGTCTTCAGCATGG - Exonic
1168019199 19:53596284-53596306 CACCATGCTGGGATTCACCAGGG - Intergenic
925295353 2:2772835-2772857 GGCCTTGGAGGGCTTCAGGAAGG + Intergenic
925397301 2:3544317-3544339 GGTCATGGTGTAGTTCAGCATGG - Intronic
926298622 2:11586514-11586536 AACCCTGGGGGGATTCAGCAGGG + Intronic
926790129 2:16562329-16562351 GGCCATGGGGGGTTTCCTCAGGG - Intronic
927250969 2:20994479-20994501 GGCCTGGGTGTGCTTCAGCAGGG + Intergenic
927381845 2:22488372-22488394 GGCCATATGGGGATTCTGCAAGG + Intergenic
927475771 2:23413291-23413313 CCCCATGGTTGGCTTCAGCATGG - Intronic
929823638 2:45292929-45292951 GGCCATGATGGGAATGAGGAAGG - Intergenic
929982275 2:46692687-46692709 GGTCATGGTGGGCTTCACTAAGG - Intergenic
930301931 2:49627561-49627583 GGCCATGATGGTACTAAGCAAGG - Intergenic
931223558 2:60309928-60309950 GGCAGTGGTGGGAGGCAGCAGGG + Intergenic
934465779 2:94261873-94261895 GGCTATGCATGGATTCAGCAAGG - Intergenic
934850242 2:97694805-97694827 CGCCATGATGGGAAACAGCATGG - Intergenic
935209972 2:100931126-100931148 GCACATGGTGGAATGCAGCATGG - Intronic
935355103 2:102190509-102190531 GGCCATGCTGGGACACAGAAAGG - Intronic
935671783 2:105562275-105562297 GGCCATGGTGCCATTCATGAAGG - Intergenic
939275701 2:139993392-139993414 GGACATGTTGGGATTCATCAAGG - Intergenic
940970059 2:159886227-159886249 GTCCATGGTGTGGTTCAGCTTGG + Intronic
943235925 2:185319521-185319543 GGCCATGTGAGGATACAGCAAGG - Intergenic
944099991 2:196014546-196014568 GGTCAGGGTGGGTTTCAGCTTGG - Intronic
945118769 2:206436973-206436995 AGCCATTGTGGAATACAGCATGG + Intergenic
948717539 2:239874939-239874961 GCCCACGGTGGGAAGCAGCAAGG + Intergenic
949006364 2:241651119-241651141 GACCAGGGTGGGCTCCAGCATGG - Intronic
1171100224 20:22375801-22375823 GGCCCTTGTGGGATACAGAATGG - Intergenic
1171139098 20:22725254-22725276 GGCCATGGGAGTATTCAGTAAGG - Intergenic
1171945638 20:31374988-31375010 GGCCAAGGTGGGGGTAAGCAGGG - Intergenic
1172847792 20:37940259-37940281 GGACAGGGTGGGCTCCAGCAGGG + Intronic
1173254064 20:41380931-41380953 GGGCAGGGAGGGATTCTGCAGGG + Intergenic
1173295074 20:41748724-41748746 GGTCACGTTGGGATTCATCAAGG - Intergenic
1173921996 20:46753162-46753184 GGCTATCGTGAGATTAAGCAGGG + Intergenic
1174404372 20:50294051-50294073 GGCCGTGATGGGAATCAGCAGGG + Intergenic
1175277549 20:57782564-57782586 GGCCATGGTGGAGCTCAGGAAGG - Intergenic
1175662179 20:60823192-60823214 AGCCAGGGTGGGGTTCAGAAAGG - Intergenic
1176341130 21:5697086-5697108 GGCCACGGTGGCCTTCAGGATGG - Intergenic
1176473384 21:7129239-7129261 GGCCACGGTGGCCTTCAGGATGG - Intergenic
1176503697 21:7627370-7627392 GGCCACGGTGGCCTTCAGGATGG + Intergenic
1176675962 21:9777809-9777831 GTCTATGGTGGGTTTCATCAAGG - Intergenic
1176689370 21:9884219-9884241 GGACATGTTAGGATTCAGCAAGG - Intergenic
1178797796 21:35761216-35761238 AGCCAGGGTCAGATTCAGCAAGG + Intronic
1181897560 22:26123916-26123938 TGCCATGTTGTGATGCAGCATGG + Intergenic
1182319044 22:29466417-29466439 GGGCAAGCTGGGAGTCAGCAGGG - Intergenic
1182496464 22:30711816-30711838 CACCATGGTGGGCTTCAGCAAGG - Intronic
1182621800 22:31622543-31622565 GGCCAAGGTGGGGCTCAGCAGGG - Intronic
1182761643 22:32727049-32727071 GGCCATGGTGGTTTGCTGCATGG + Intronic
1183207099 22:36426907-36426929 GGCCAAGGTGGCACACAGCATGG - Intergenic
1184087622 22:42274592-42274614 GGCAAGGGTGGGATCCTGCAGGG + Intronic
1185178013 22:49341323-49341345 GGCCATGGTGGGGTTATTCATGG - Intergenic
950582199 3:13869925-13869947 AGCTATGGTGGGAATGAGCAGGG - Intronic
951757827 3:26111600-26111622 GGCCCTGTTAGGATTCAACAGGG - Intergenic
954971951 3:54658821-54658843 TGTCTTGGTGGGAGTCAGCAAGG + Intronic
955088275 3:55724272-55724294 GGTCATGGCGGGAGCCAGCAGGG + Intronic
955316282 3:57941816-57941838 GACCATGGTGGGGTTGACCATGG - Intergenic
957593246 3:82226360-82226382 GGCCACATTGGGATTCACCAAGG - Intergenic
959899023 3:111639289-111639311 GGGCATGGTGGGAGTGAGAATGG + Intronic
961660081 3:128463828-128463850 GGCCAAGGTGGGGTTCAGGCAGG + Exonic
965794647 3:172427412-172427434 AGCCATCATGGGAATCAGCACGG - Intergenic
965849656 3:173009240-173009262 GGCCAAGTTGGAATTCACCAAGG + Intronic
966718331 3:183036234-183036256 GGCCATAGTGGGGTTCATCCTGG - Intronic
968008425 3:195258077-195258099 GGTCAGCGTGGGATTCTGCAGGG - Intronic
968699265 4:2047049-2047071 GGCCACGGTGGGAGGGAGCAGGG - Intergenic
968703637 4:2068000-2068022 GGCCATGGTGGGGTGAAGGATGG + Exonic
969339125 4:6529377-6529399 GGCCAGGCTGGGAGCCAGCAGGG + Intronic
970222023 4:13821315-13821337 GGCCATGCAGGGAAGCAGCAGGG - Intergenic
970918573 4:21366000-21366022 GGCCATGGTGATGTTCAGAATGG + Intronic
971262420 4:25069347-25069369 GGCCAAGGTGGGAGCCAGAAGGG - Intergenic
971310098 4:25518316-25518338 TGCCATGTTAGGATACAGCAAGG - Intergenic
973020534 4:45200170-45200192 GGCCATGGTGGCAGACATCAAGG - Intergenic
975389626 4:73801799-73801821 GGACATATTGGGATTCATCAAGG + Intergenic
977846592 4:101774007-101774029 GGCTACGTTGGGATTCATCAAGG - Intronic
979175114 4:117652649-117652671 GGCCATGTTGGGATTCATCAAGG - Intergenic
980352764 4:131702032-131702054 GGACATGTTGGGATTCAGCAAGG - Intergenic
982155082 4:152511297-152511319 GGGCATGGTGGGATTCGGTGGGG - Intronic
983547376 4:168978422-168978444 GGACATGTTGGGATTCATAAAGG + Intronic
983653538 4:170056937-170056959 GGTCCTGGTGGTATTCAACATGG - Intergenic
984558619 4:181242031-181242053 GGCCATAGTGTGATTGGGCAAGG + Intergenic
985399578 4:189580933-189580955 GTCAATGGTGGGTTTCATCAAGG + Intergenic
987878347 5:23710386-23710408 GGCCACACTGGGATTCAGCAAGG + Intergenic
988675512 5:33428721-33428743 AGCCATGTTGGGATCCATCAAGG - Intergenic
991076757 5:62548353-62548375 CCCCAAGGTGGGAGTCAGCATGG - Intronic
991433443 5:66572057-66572079 GAACACGGTGGGATTCACCATGG - Intergenic
993372484 5:87109895-87109917 GGCCATGGGAGGACACAGCAGGG - Intergenic
994302449 5:98161430-98161452 GGTCATGGTGCCATTTAGCATGG - Intergenic
996338969 5:122415241-122415263 GGCCATGGTAGGAGCCTGCATGG + Intronic
997231129 5:132243850-132243872 GGCCATGGTGGGAGTGAGATTGG - Intronic
997690221 5:135823161-135823183 GGCCAGGGTGGGATTCACGAAGG + Intergenic
999790431 5:154934695-154934717 GGAGATGGTTGGATTCAGCCAGG - Intronic
999972321 5:156877423-156877445 GGCTATGACGGGCTTCAGCATGG - Intergenic
1002161104 5:177314555-177314577 GGGCATGGGGGGATCCAGCCTGG + Intergenic
1002212179 5:177605607-177605629 GGGGATGGTGGGAGTCAGCCCGG - Intronic
1002256653 5:177962592-177962614 GGCCATGGTGATATTGAGGAGGG + Intergenic
1002820418 6:719468-719490 GGCCATGGGAGGACACAGCAAGG + Intergenic
1002954004 6:1843852-1843874 GGGCCTGGTGGGATGGAGCATGG - Intronic
1004079934 6:12382285-12382307 GGCCCAGGTGGGAGTCAGGAAGG + Intergenic
1006154669 6:32007762-32007784 GGCGATGGTGGCATTGAGCAAGG - Intergenic
1006160981 6:32040497-32040519 GGCGATGGTGGCATTGAGCAAGG - Exonic
1007511915 6:42380427-42380449 GGCTATGCTGGGCTTCAGCCTGG - Intronic
1007665021 6:43508863-43508885 GGCCAGGGCTGGGTTCAGCAAGG + Exonic
1007958108 6:45935364-45935386 GCACATGGTGGAGTTCAGCAAGG - Intronic
1010127686 6:72452459-72452481 GATCATGCTGGGATTCATCAGGG + Intergenic
1010165136 6:72906228-72906250 GGGCATGGTGGGATTGAGACCGG - Intronic
1011013318 6:82726522-82726544 TGCCATGGTGGGTTTGAGCAGGG + Intergenic
1018438306 6:163783198-163783220 GGCCTGGGTGGGCTTCAGGAAGG + Intergenic
1019079697 6:169422008-169422030 GGCCATGGTGGGCTGCTGGAAGG - Intergenic
1021202304 7:17740952-17740974 GATCGTGCTGGGATTCAGCAAGG + Intergenic
1034093237 7:148383010-148383032 GGAGATGGTGAGATTCACCAAGG + Intronic
1034543880 7:151777165-151777187 GGCCATGGCCAGGTTCAGCATGG + Intronic
1034682505 7:152939867-152939889 GGTCATGGAGGGATTCCCCAGGG + Intergenic
1037388069 8:18364544-18364566 GTACATGTTGGGATTCATCAGGG + Intergenic
1037820351 8:22132079-22132101 GGCCAAGGTTGGCTTCCGCAGGG - Intronic
1038324758 8:26564443-26564465 GGCCGGGGTGGGAAACAGCATGG + Intronic
1039557333 8:38485868-38485890 GGCCATTGTGGGATTCCAGAAGG + Intergenic
1039787405 8:40846258-40846280 GGCCATGGTGGAATGGATCATGG - Intronic
1039930181 8:41979537-41979559 GGCCAAGGTGGGCTCCAGCCTGG + Intronic
1040532243 8:48275342-48275364 GGCCGTGGCTGGATTCAGCATGG + Intergenic
1041871039 8:62634642-62634664 GGCCCTGGTGGGGCTCTGCAGGG + Intronic
1042466732 8:69136542-69136564 GGCCATTGTGGGAGACAGCAGGG + Intergenic
1043320720 8:78982659-78982681 GGAGATGGTGGGCTCCAGCAAGG - Intergenic
1045410030 8:101907930-101907952 TGCCATGCTGGGATTCCACAAGG + Intronic
1046286026 8:112093173-112093195 GGTCATGTTGGGATTCATCAAGG - Intergenic
1046732123 8:117737120-117737142 GACCTTGGTGGGATTCTCCAAGG - Intergenic
1047145962 8:122199546-122199568 GGTCATGGTGGGATGGAGAATGG + Intergenic
1047547907 8:125838309-125838331 GGACATGTTGGGATTCATCAAGG + Intergenic
1047939677 8:129816769-129816791 GATCATGCTGGGATTCACCAAGG - Intergenic
1048670942 8:136719040-136719062 GGAAAGGGTGGGATCCAGCAGGG - Intergenic
1049632526 8:143666361-143666383 GGCCACGCAGGGATACAGCATGG - Intergenic
1050216412 9:3330371-3330393 GGCACTGGTGGGATTCAGATGGG - Exonic
1053169672 9:35869532-35869554 GTAGATGGTGGGGTTCAGCATGG + Exonic
1053779951 9:41597679-41597701 GGACATGTTGGGATTCAGCAAGG + Intergenic
1054167908 9:61807922-61807944 GGACATGTTGGGATTCAGCAAGG + Intergenic
1054669638 9:67772982-67773004 GGACATGTTGGGATTCAGCAAGG - Intergenic
1056732948 9:89181629-89181651 GGTCATGCTGGGATCCAGCATGG + Intergenic
1056887479 9:90457259-90457281 TGCCATGATCTGATTCAGCAGGG - Intergenic
1057036615 9:91816309-91816331 CGCCTTGGAGGGTTTCAGCAAGG - Intronic
1059779293 9:117508942-117508964 GGACACGTTGGGATTCATCAAGG - Intergenic
1059880934 9:118688102-118688124 GGCCAAGGTAGAAGTCAGCATGG + Intergenic
1061225710 9:129279745-129279767 GGCCACGGGGGGATGCAGCAGGG + Intergenic
1203421937 Un_GL000195v1:907-929 GGCCACGGTGGCCTTCAGGATGG + Intergenic
1203446018 Un_GL000219v1:57115-57137 GGCAATAGTGGAATCCAGCAGGG + Intergenic
1187397837 X:18933563-18933585 GGCCAGGGTGGCATGCAGCTTGG - Intronic
1189383613 X:40519075-40519097 AGCCATGGAGGTATTCAGGAAGG + Intergenic
1190940862 X:55039805-55039827 GGCCAGGCTGGGATTCAGCCCGG + Intergenic
1193399251 X:81022085-81022107 GGCCATGTTAGGATTAATCAAGG - Intergenic
1193541287 X:82775582-82775604 GGGCATGGTGGGAGTCAGACCGG - Intergenic
1193726208 X:85041909-85041931 GGACATGCTGGAATTCATCAAGG - Intronic
1194981829 X:100449537-100449559 AACCATGTTGGGATTCATCAAGG + Intergenic