ID: 917121605

View in Genome Browser
Species Human (GRCh38)
Location 1:171649390-171649412
Sequence CTGTTTCAAGGCCAGATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917121605_917121612 26 Left 917121605 1:171649390-171649412 CCCTAGATCTGGCCTTGAAACAG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 917121612 1:171649439-171649461 CTTTCTGTCTTTTACCTTTAGGG 0: 1
1: 0
2: 0
3: 53
4: 566
917121605_917121611 25 Left 917121605 1:171649390-171649412 CCCTAGATCTGGCCTTGAAACAG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 917121611 1:171649438-171649460 CCTTTCTGTCTTTTACCTTTAGG 0: 1
1: 0
2: 1
3: 54
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917121605 Original CRISPR CTGTTTCAAGGCCAGATCTA GGG (reversed) Intronic
903184971 1:21623629-21623651 CTGATTCAAGGCCAGGTCTAGGG - Intronic
903752753 1:25637455-25637477 CTGTTTTATGGCCAGCTATATGG + Intronic
906274113 1:44503657-44503679 CCCTTTCAAGGCCAGATCTGAGG + Intronic
907103227 1:51856405-51856427 CAGTTTCAAGTCCAGACCTCTGG + Intronic
907371505 1:54006520-54006542 CTGGTTCAGGGTCAGAACTAAGG + Intergenic
910537417 1:88314284-88314306 CTGTTTTAAGTAGAGATCTATGG - Intergenic
912745756 1:112244001-112244023 CTGTTTCAGGGCCACGTCTCTGG + Intergenic
917121605 1:171649390-171649412 CTGTTTCAAGGCCAGATCTAGGG - Intronic
921304815 1:213785370-213785392 GTGTTTCAAGAACAGATCCACGG - Intergenic
922246700 1:223806039-223806061 CTTGTTCAAGGCCAGGACTAGGG + Intronic
924197970 1:241628465-241628487 CTGTGCGAAGGCCAGATCTTGGG - Intronic
924948220 1:248859877-248859899 CTGGTTCAAGGCCTGAGCCAGGG - Intergenic
1062999781 10:1905808-1905830 TTTTTTCAAGGCGAGATCTGGGG + Intergenic
1064883576 10:20084472-20084494 CTGTTACAAGGCCTGCTATAAGG - Intronic
1065596773 10:27320457-27320479 TAGCTCCAAGGCCAGATCTACGG + Intergenic
1071826179 10:89328422-89328444 CTGATTCAAGGGTAGACCTAAGG + Intronic
1073073721 10:100810390-100810412 CTGTTTCCAGCCTAGATCTTTGG + Intronic
1074153770 10:110781320-110781342 CTGTTTCAGGGCCATATGTCTGG - Exonic
1074469079 10:113710896-113710918 TTCTTTCAAGTCCAGATCAACGG - Intronic
1077894171 11:6441366-6441388 CTGTGTCAAGCCCTGCTCTAAGG + Intronic
1081391526 11:42535178-42535200 CTCAGTCCAGGCCAGATCTAAGG - Intergenic
1085753140 11:79179817-79179839 CTGTTTTAAGAGCAGAGCTATGG + Intronic
1091433710 12:457643-457665 CAGTTTAAAGGCCAAATTTATGG - Intergenic
1092692274 12:11127452-11127474 TTTTTTCAATGCCAGATTTATGG + Intronic
1095942291 12:47735171-47735193 CTTTTTAAAGGACTGATCTAGGG + Intronic
1099562782 12:84198756-84198778 GTGTTTCAAGGTCAGAGCTAAGG - Intergenic
1099947791 12:89264719-89264741 CAGTTTCAAGTCCTTATCTATGG - Intergenic
1105702140 13:22941699-22941721 CTGTTTCCAGGCCAGCTCGAAGG + Intergenic
1107987757 13:45790310-45790332 CTGTTTCAAACCAAGATCTATGG + Intronic
1109744157 13:66598973-66598995 TTGTTACAAGGGCAGCTCTAAGG - Intronic
1110474408 13:75896984-75897006 CTGTTGCAATGACAGATCTCTGG + Intergenic
1112736190 13:102421903-102421925 CTATTTCAAGCCCAGAAATAAGG + Intergenic
1114998424 14:28389823-28389845 CTGTTTTATGGCCAGAAATATGG + Intergenic
1115716799 14:36114536-36114558 CTCTTGCAAGGTCAGATCAAGGG - Intergenic
1116761359 14:49019163-49019185 CAGTTTCAAGAGCTGATCTAGGG + Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1122267051 14:100551436-100551458 CTGTTTGAAAGCCAGATTTCTGG - Intronic
1126312841 15:47336737-47336759 CTGTTTCAGAGTCAGTTCTAGGG - Intronic
1127337475 15:58003380-58003402 CTGATTCAAGGCAAAATCTTAGG + Intronic
1127706715 15:61554674-61554696 TTCATTCAAGGCCACATCTAAGG - Intergenic
1129634498 15:77300680-77300702 CTGTTTCAGGGTCCTATCTAGGG + Intronic
1129872698 15:78951022-78951044 CTGTTACAGGGCCAGGACTAGGG - Intergenic
1132830182 16:1924068-1924090 CTGATTCAAGGCCAGCACTGTGG + Intergenic
1134448553 16:14348866-14348888 CTGTTTTAGGGCCTGATCCAGGG + Intergenic
1137661862 16:50214212-50214234 CTGTTTCAGGTCCAGATATTTGG + Exonic
1139606091 16:68019765-68019787 CTTTTTCAAGGCCAGTAATAGGG - Intronic
1147655508 17:42088476-42088498 CTGTTTCACCGCCAGGTCTGCGG + Intergenic
1149265069 17:54919562-54919584 CTGTTTTAATGCCAGAGCTCAGG + Intronic
1150351466 17:64448192-64448214 CTATTTCAAAGGCTGATCTAAGG + Intergenic
1156738249 18:40290652-40290674 CTTTTCCAAGGCCAGTTATAAGG - Intergenic
1161731104 19:5961093-5961115 CTCTGTGGAGGCCAGATCTAAGG - Intronic
924985759 2:268053-268075 CTGTTTTAGGTCCAGATCTTGGG + Intronic
932303663 2:70686426-70686448 CAGTTTCAAGGGCAGAGCTGTGG - Intronic
933833586 2:86229212-86229234 CTGTGCCAAGGCCAAATCTATGG + Intronic
941173163 2:162164196-162164218 CTCTTTTGAGGCCAGATTTATGG - Intergenic
944466448 2:200005146-200005168 CTGTTTCTTGGCCAGTTCCAAGG - Intronic
944931946 2:204528969-204528991 TTGTTTCCAGGACAGAGCTATGG + Intergenic
946298525 2:218806850-218806872 CTGGTTCATGGTCAGCTCTATGG + Intronic
946745815 2:222844606-222844628 GAGTCTCAAGCCCAGATCTACGG - Intergenic
949082595 2:242116334-242116356 CTTTTGCAATGTCAGATCTATGG + Intergenic
1169852396 20:10066500-10066522 GTGTTTAAAGGCCTGATCTGGGG - Intergenic
1172562515 20:35902012-35902034 CTGTTTCAAGGCCTGGTGTGGGG + Intronic
1174402098 20:50281673-50281695 CTGTTTGAAGGTCAGGTCAATGG + Intergenic
1176018321 20:62949792-62949814 CTAGTTCAAGGCCAGGTTTACGG + Intergenic
1176904948 21:14489122-14489144 CTGTTTCATGGCCACATGAAGGG - Intronic
1177042917 21:16134887-16134909 CAGTTTCAAGGCCAGAACTCAGG - Intergenic
1183479544 22:38056071-38056093 CTGTTTCCAGGCCAGAATTTTGG - Intergenic
949913969 3:8942229-8942251 CTGTTACAAGGACAGCACTAAGG - Intronic
951851630 3:27147550-27147572 CTGTTTAAAGGCCAGAGGCAAGG + Intronic
960474952 3:118112403-118112425 TTGTTTCAAAGCCAAATCTGAGG - Intergenic
961867356 3:129963501-129963523 CTGGTTCAAGGACAGATGTATGG - Intergenic
964254707 3:154762846-154762868 CTGTTTCAAGGGTTGATATAAGG + Intergenic
964384434 3:156132092-156132114 CTGTTTCAAGCACAGCTCTGTGG - Intronic
966538725 3:181065116-181065138 GTGTTTCATTGCCAGATCTCAGG - Intergenic
967752968 3:193135602-193135624 ATGTTTCAAGCACAGCTCTAAGG + Intergenic
971526817 4:27630249-27630271 CTTTTTCAAGGCTCAATCTAAGG - Intergenic
977714562 4:100167386-100167408 CTGGCTTAAGGCCAGATGTAGGG - Intergenic
977725778 4:100295467-100295489 TTGTTTCAAGGACAGTTTTATGG - Intergenic
977768552 4:100829841-100829863 GTGTTTTAAACCCAGATCTACGG + Intronic
978284616 4:107061534-107061556 CTGTCTCAAGGCCCTATCCAAGG + Intronic
978555190 4:109972334-109972356 CTGTCTCAAGGCAAGATCGCTGG - Intronic
979616473 4:122748207-122748229 CTTTTTCTAGGCCATTTCTAAGG - Intergenic
989094531 5:37769374-37769396 CTGCTTCAGGGCCAGATGTGAGG + Intergenic
993834421 5:92799244-92799266 ATTTTTGAAGGCTAGATCTATGG - Intergenic
998649889 5:144106751-144106773 CTGTTTCTAGTCCTGAGCTATGG + Intergenic
999349203 5:150851167-150851189 CTGTTCCAGGGCCATATGTAGGG - Intronic
999670890 5:153958321-153958343 CTATTTCCAAGCCAGTTCTAGGG + Intergenic
1000733545 5:164868599-164868621 CTTTGTCAAGGGCAGAACTAAGG - Intergenic
1001156044 5:169273162-169273184 CTGTTTCAAGGCCAGAGGCAGGG - Intronic
1002037723 5:176485552-176485574 CTATTTCAAGGACAGAGTTAAGG + Intronic
1005334237 6:24776834-24776856 CTGATTCAAAGACAGATTTAAGG - Intronic
1006685967 6:35834293-35834315 CTGCTTCAAGGCCAGAATTTTGG + Exonic
1010252653 6:73724217-73724239 CTTTTCCAAGGCCAGGGCTATGG - Intronic
1013635008 6:112020856-112020878 CTACCCCAAGGCCAGATCTAGGG - Intergenic
1014305467 6:119735870-119735892 CTGTTTCATGTCCAGAGCCAAGG - Intergenic
1016760734 6:147733790-147733812 CTGTTTTAAAGCCAGTTTTAAGG + Intronic
1019332095 7:465286-465308 ATGTTTCAAGGCCATCTCTCAGG + Intergenic
1020046888 7:5046748-5046770 CAGTCTCCAGGGCAGATCTAAGG - Intronic
1020292247 7:6730628-6730650 CAGTCTCCAGGGCAGATCTAAGG - Intergenic
1022489150 7:30803465-30803487 CTGTTTCAGGGTCAGATGGATGG + Intronic
1022955972 7:35380677-35380699 CAGCTTCAAGGACAGAGCTAAGG + Intergenic
1023600791 7:41880146-41880168 ATCTTTCAAGGCCAGAGCTCTGG - Intergenic
1028697582 7:93733374-93733396 CTGTTTCATGGGCAGTTCCATGG - Intronic
1033180130 7:139168985-139169007 CTGTTCCAAGGTCTGATATATGG + Intronic
1040899783 8:52406462-52406484 CTCCTTCAAGGCCAGATCGCTGG - Intronic
1040901494 8:52421818-52421840 ATGTTCCAAGCCCAGATCTTTGG + Intronic
1043184142 8:77124294-77124316 ATGATTCTAGGCCAGATCAAAGG + Intergenic
1044322774 8:90823204-90823226 CTGAATCAAGCACAGATCTAGGG - Intronic
1044577897 8:93791546-93791568 CTGTTTCAGGACCCAATCTAGGG + Intronic
1049237064 8:141517736-141517758 CAGCTTCAAGGTCAGATCCAGGG - Intronic
1049432765 8:142572989-142573011 CTTTTTAAAGGGCAGAGCTAAGG + Intergenic
1053659190 9:40254083-40254105 CTTTTTAAAAGCCAGAACTATGG - Intronic
1053909561 9:42883449-42883471 CTTTTTAAAAGCCAGAACTATGG - Intergenic
1054371314 9:64400385-64400407 CTTTTTAAAAGCCAGAACTATGG - Intronic
1054525409 9:66122139-66122161 CTTTTTAAAAGCCAGAACTATGG + Intronic
1054678939 9:67890102-67890124 CTTTTTAAAAGCCAGAACTATGG - Intronic
1055771178 9:79718527-79718549 CTGCTACAGGGCCAGATCTCAGG - Intronic
1059420982 9:114192341-114192363 ATGGTACAAGGCCAGACCTAGGG - Intronic
1061475402 9:130862446-130862468 CCGTTCCAAGGCCAGTTTTAAGG - Intronic
1187004209 X:15215939-15215961 CTGTCTCATGGGCAGATCTCAGG + Intergenic
1188909734 X:35831979-35832001 CAGTTATAAGTCCAGATCTAAGG - Intergenic
1190374071 X:49771818-49771840 CTGTTTCTATGCCAGTACTATGG + Intergenic
1192903392 X:75523327-75523349 CTGTTTCAAGGCTGGATGCAGGG + Intronic
1193955000 X:87849247-87849269 CTGTTCCAAGGACACATCTCAGG - Intergenic
1194177586 X:90669872-90669894 CTGTTTCATGGCAAGAATTAAGG - Intergenic
1195913899 X:109916605-109916627 CTGGTTGACAGCCAGATCTATGG - Intergenic
1196088470 X:111712156-111712178 CTTTTTTAAGTCCAGAACTATGG - Intronic
1197235464 X:124057776-124057798 CTGTTTCAATTTCATATCTAAGG - Intronic
1197744574 X:129923154-129923176 GTGTCCAAAGGCCAGATCTAAGG + Intronic
1199200613 X:145084438-145084460 GTGTTTCAATCCCAGATCTTTGG + Intergenic
1200524256 Y:4252007-4252029 CTGTTTCATGGCAAGAATTAAGG - Intergenic