ID: 917122164

View in Genome Browser
Species Human (GRCh38)
Location 1:171654397-171654419
Sequence TCCTAGAACCCAGGATCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 135}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917122159_917122164 -5 Left 917122159 1:171654379-171654401 CCACAATATAGCCCTGCCTCCTA 0: 1
1: 0
2: 2
3: 18
4: 163
Right 917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 135
917122151_917122164 25 Left 917122151 1:171654349-171654371 CCCGACTTCCCTTGAACTGATTT 0: 1
1: 0
2: 3
3: 20
4: 188
Right 917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 135
917122154_917122164 16 Left 917122154 1:171654358-171654380 CCTTGAACTGATTTTTTCCCCCC 0: 1
1: 0
2: 4
3: 20
4: 293
Right 917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 135
917122153_917122164 17 Left 917122153 1:171654357-171654379 CCCTTGAACTGATTTTTTCCCCC 0: 1
1: 0
2: 1
3: 37
4: 345
Right 917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 135
917122158_917122164 -4 Left 917122158 1:171654378-171654400 CCCACAATATAGCCCTGCCTCCT 0: 1
1: 0
2: 2
3: 11
4: 159
Right 917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 135
917122156_917122164 -2 Left 917122156 1:171654376-171654398 CCCCCACAATATAGCCCTGCCTC 0: 1
1: 0
2: 1
3: 17
4: 167
Right 917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 135
917122152_917122164 24 Left 917122152 1:171654350-171654372 CCGACTTCCCTTGAACTGATTTT 0: 1
1: 0
2: 4
3: 21
4: 296
Right 917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 135
917122157_917122164 -3 Left 917122157 1:171654377-171654399 CCCCACAATATAGCCCTGCCTCC 0: 1
1: 0
2: 1
3: 11
4: 147
Right 917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 135
917122155_917122164 -1 Left 917122155 1:171654375-171654397 CCCCCCACAATATAGCCCTGCCT 0: 1
1: 0
2: 1
3: 16
4: 139
Right 917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG 0: 1
1: 0
2: 0
3: 4
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917122164 Original CRISPR TCCTAGAACCCAGGATCACG TGG Intergenic
900633488 1:3651026-3651048 TCCCAGAACCCAGGGCCAGGCGG - Intronic
902533781 1:17107212-17107234 TCCTGGAACCCAAGAGCACCAGG - Intronic
902674075 1:17996236-17996258 TCCTGGATCCCAGGCTCACTGGG + Intergenic
903167449 1:21530862-21530884 TGCTTGAACCCAGGATGTCGAGG - Intronic
903554344 1:24182114-24182136 TGCTTGAACCCAGGAGGACGAGG + Intronic
904277115 1:29391886-29391908 TCCTAAAGACCAGGATCACTGGG - Intergenic
906273951 1:44502235-44502257 TCCCAGAACACTGGATCATGCGG - Intronic
908596684 1:65696005-65696027 TGCTTGAACCCAGGATCCAGAGG - Intergenic
909881802 1:80889242-80889264 TTCTAGAACCTAGGGTCACTGGG - Intergenic
911198584 1:95020652-95020674 TGCTTGAACCCAGGATCCAGAGG + Intronic
914810183 1:151022040-151022062 TCCTTGAACCCAGGAGCTCAAGG - Intronic
916522312 1:165575172-165575194 TCCTATTACCAAGGATCAGGTGG - Intergenic
917122164 1:171654397-171654419 TCCTAGAACCCAGGATCACGTGG + Intergenic
918262207 1:182806370-182806392 TCCAAGAAGCCAGGATCCCGGGG - Intronic
919626547 1:199915976-199915998 CCCTTGAACCCAGGAGCTCGAGG - Intergenic
921019561 1:211223766-211223788 TCCTAGACCCAAGGAGGACGAGG - Intergenic
921822895 1:219637776-219637798 TCCTAGAAGGCAGGATCACTCGG + Intergenic
924547078 1:245039389-245039411 TGCTTGAACCCAGGAGCTCGAGG + Intronic
1063568816 10:7195786-7195808 TCCTGGAACCTGGGACCACGTGG + Intronic
1064237158 10:13587025-13587047 TCCTCGAACCCAGCCTCACTGGG - Exonic
1064687466 10:17878744-17878766 TGCTTGAACCCAGGATTTCGAGG - Intronic
1066640835 10:37552599-37552621 TGCTTGAACCCAGGAACAGGTGG + Intergenic
1069555417 10:69394625-69394647 AGGTAGAACCCAGGATCAGGAGG + Intronic
1070166108 10:73899230-73899252 TCCCAGAACCCAGGCTCTCTGGG + Intergenic
1070765025 10:79051431-79051453 TCCTGCAACACAGGGTCACGTGG + Intergenic
1071025991 10:81114024-81114046 TCCCAGCACTGAGGATCACGAGG - Intergenic
1075088977 10:119432362-119432384 TGCTTGAACCCAGGATTTCGAGG + Intronic
1075587084 10:123666074-123666096 GCCTGCAACCCAGGATCCCGGGG + Intergenic
1079543913 11:21609645-21609667 TGCTAGAACCCGGGATGCCGAGG + Intergenic
1083306635 11:61765101-61765123 TCCAGGAACGCAGGAGCACGAGG - Intronic
1083465436 11:62842511-62842533 TCCTCAAACCCGGGATCCCGCGG + Intergenic
1083781203 11:64918720-64918742 TCCTTGAACCCAGGAGCCAGAGG - Intronic
1085526157 11:77165423-77165445 ACCCAGAACCCAGGATCCCCAGG - Intronic
1086331614 11:85760164-85760186 TTCTGGAACCCAGGATGAAGAGG - Intronic
1088997046 11:115010265-115010287 TACTTGAGCCCAGGATCTCGAGG - Intergenic
1089525866 11:119096047-119096069 TCCTTGAACCCAGGAGTTCGAGG - Intergenic
1092993890 12:13929796-13929818 CCCTAGAACCCAGTAACACCGGG + Intronic
1096839112 12:54370114-54370136 TCCTGGAACCCCGTATCTCGGGG + Exonic
1098016530 12:66110451-66110473 TGCTTGAACCCAGGATCCAGAGG + Intergenic
1100573043 12:95860639-95860661 TGCTTGAACCCAGGAGCTCGAGG - Intronic
1101431396 12:104630524-104630546 TCCGAGAAGCCAGGCTGACGGGG + Intronic
1103491152 12:121321613-121321635 TGCTAGAACCCAGGAGGAGGAGG - Intronic
1103541336 12:121668628-121668650 TGCTTGAGCCCAGGATCTCGAGG + Intronic
1104537821 12:129634388-129634410 TGCTTGAACCCAGGATGTCGAGG + Intronic
1105380376 13:19881536-19881558 TCCTTGAACCCAGGAGGAGGAGG + Intergenic
1107898385 13:44988773-44988795 TCCTTGAACCCAGGAAGTCGAGG - Intronic
1111772872 13:92621733-92621755 TGCTTGAACCCAGGATGCCGAGG + Intronic
1111928359 13:94486812-94486834 TCCCAGAACCCAGGAACATAAGG - Intergenic
1112124454 13:96449043-96449065 TCCTTGAACCCAGGAAGTCGAGG - Intronic
1112265409 13:97919254-97919276 TGCTTGAACCCAGGAGCTCGAGG + Intergenic
1116849175 14:49891979-49892001 TGCTTGAACCCAGGATGAGGAGG + Intergenic
1119778488 14:77262667-77262689 TCCTTGAACCCAGGATTTCAAGG + Intergenic
1122608279 14:102962766-102962788 TCCTTGAACCCAGGATGCAGAGG + Intronic
1123824444 15:24067414-24067436 TTCTGGAACCCAGGACCATGGGG - Intergenic
1124590995 15:31052689-31052711 TCCTTGAACCCAGGAGGAAGAGG + Intronic
1132110395 15:99098514-99098536 TCCTGGAGCCCAGAATCACATGG - Intronic
1132191655 15:99867524-99867546 TGCTTGAACCCAGGATGCCGAGG - Intergenic
1132777692 16:1604857-1604879 TTCTAGAAACCAGGATAAAGGGG + Intronic
1133036245 16:3035882-3035904 TCCCAGAACCCAGGTTCTCAGGG + Intronic
1134092558 16:11399372-11399394 CACTGGAACCCAGGACCACGTGG + Intronic
1136528516 16:30849533-30849555 TGCTTGAACCCAGGATGCCGGGG - Intronic
1137895406 16:52206394-52206416 TGCTTGAACCCAGGAGCTCGAGG + Intergenic
1147812079 17:43178844-43178866 TCCTTGAACCCAGGAGCTCTAGG - Intronic
1152111969 17:78361488-78361510 TCCTAGATACCAGGATAATGAGG + Intergenic
1152568448 17:81110798-81110820 ACCTAGAACCCTGGAGCACTCGG - Intronic
1152706009 17:81844083-81844105 TCCTGTATCCCAGGATCTCGAGG - Exonic
1154987012 18:21562241-21562263 TCCCAGCACTCTGGATCACGAGG + Intronic
1156748319 18:40419329-40419351 CGCTTGAACCCAGGATCAAGTGG - Intergenic
1160120072 18:76122219-76122241 TCTTAGAAATGAGGATCACGAGG - Intergenic
1161291244 19:3494421-3494443 TCCAAGAACCCAGGAGGTCGGGG + Intronic
1162071365 19:8154311-8154333 TCCTTGAACCCAGGAGGAGGAGG - Intronic
1162440370 19:10688606-10688628 TCCTACAACCCAGGGTCACACGG + Exonic
1164427895 19:28158895-28158917 TCCTAGAACCCAGGAGTTTGAGG - Intergenic
1164767068 19:30780413-30780435 CCATAGAACCCAGGAGCACAGGG - Intergenic
1166691155 19:44821786-44821808 TCCTTGAGCCCAGGAATACGAGG + Intergenic
924999878 2:396482-396504 TCCTGGAACCCAGAAGCAGGTGG + Intergenic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
926003862 2:9356360-9356382 TCCTAGAGCCCAGGGTCGGGTGG - Intronic
928526161 2:32143182-32143204 TGCTTGAACCCAGGATATCGAGG + Intronic
930032848 2:47069054-47069076 TTCTAGAACCCGGGATCCAGAGG + Intronic
931231952 2:60382567-60382589 ACCTAGAATCCAGGAGCAGGTGG - Intergenic
932298220 2:70644308-70644330 TCCTAGAACCCAGCAGGACATGG - Intronic
937175836 2:119933579-119933601 TGCTAGAACCCAGGAGGAAGAGG + Intronic
937601840 2:123746309-123746331 TTCTACAACCCAGGATCCTGGGG - Intergenic
938980610 2:136522657-136522679 TCCTAGCATCCAGAATAACGGGG + Intergenic
939487341 2:142831234-142831256 TGCTTGAACCCAGGAGCTCGAGG - Intergenic
1172540525 20:35712007-35712029 TCCTTGAACCCAGGAGGAAGAGG + Intronic
1173257072 20:41401385-41401407 TCATAAAACACAGGATCACCAGG - Intergenic
1177279462 21:18961950-18961972 GCCTGGAGCCCAGGATCACCAGG - Intergenic
1182032599 22:27171249-27171271 TCCCAGAACCCAGGATCTTTGGG + Intergenic
1182873907 22:33673779-33673801 TCCTAGAACCCAGGAAGCAGAGG - Intronic
1184695032 22:46134220-46134242 GCCCAGACCCCAGGATCACCAGG - Intergenic
949166623 3:950485-950507 TCCCAGGTTCCAGGATCACGGGG + Intergenic
956088158 3:65635614-65635636 TCCTAAAACCCTGGATTACAAGG - Intronic
957135760 3:76287006-76287028 ACCTGGATCCCAGGATCAAGAGG + Intronic
960503321 3:118464056-118464078 TCACAGAACACAGGATCACCAGG + Intergenic
960798233 3:121511312-121511334 TCCTTGAACCCAGGAGCCAGAGG + Intronic
962146419 3:132844617-132844639 TCCAAGAATCCAGGATCTCCTGG + Intergenic
974175535 4:58317311-58317333 TCCCACAACTCAGGATCAAGAGG - Intergenic
982645146 4:158014514-158014536 TGCTTGAACCCAGGATGAGGAGG + Intergenic
982907322 4:161090994-161091016 TGCTTAAACCCAGGAGCACGAGG + Intergenic
983465787 4:168087792-168087814 TCCTTGAGGCCAGGATCACAGGG - Intergenic
984423838 4:179558492-179558514 TCCAAGAGCCCTGGATCCCGAGG - Intergenic
986324910 5:6665176-6665198 GCCATGAACCCAGGAACACGTGG + Intronic
989971540 5:50531001-50531023 TGCTTGAACCCAGGATTTCGAGG + Intergenic
990380283 5:55216253-55216275 TCCCAGACCCCAGCATCACCTGG + Intergenic
998154804 5:139778843-139778865 TGCTTGAACCCAGGATGTCGAGG + Intergenic
1003365168 6:5466879-5466901 TCCTTGAACCCATGAGCACATGG + Intronic
1005469710 6:26150428-26150450 CCCTTGAACCCAGGATTTCGAGG - Intergenic
1008348090 6:50454205-50454227 TGCTTGAACCCAGGAGCTCGAGG + Intergenic
1008390702 6:50948094-50948116 TCCTAGAACCCTAGTTCACTGGG + Intergenic
1010965595 6:82203645-82203667 TCCTAGAACCTAGGAAAAGGAGG - Intronic
1015536498 6:134272222-134272244 TCCTTGAACCCAGGAACGGGAGG - Intronic
1019656931 7:2200909-2200931 TCCTGGAACCCACGGTCACTCGG - Intronic
1029933629 7:104399543-104399565 TCCTTGAACCCAGGAGCCAGAGG - Intronic
1034399693 7:150854176-150854198 TCCGAGAGCCCAAGATCATGTGG + Intronic
1039594336 8:38777709-38777731 TGCTAGAGCCCAGGAGCTCGAGG + Intronic
1040660058 8:49562281-49562303 TGCTAGACCCCAGGAACACATGG + Intergenic
1044700357 8:94959936-94959958 CCCCAGCACCAAGGATCACGTGG + Intronic
1045104570 8:98878980-98879002 TCCTTGAACCCAGGAGGCCGAGG - Intronic
1046910515 8:119621316-119621338 TCCTAGCATCCAGGATCTCCTGG + Intronic
1050277977 9:4019814-4019836 TGCTTGAACCCAGGATTTCGAGG - Intronic
1050475773 9:6039595-6039617 TCCTTGAACCCAGGAGGAAGAGG - Intergenic
1055602795 9:77937352-77937374 TGCTTGAACCCAGGATGAGGAGG + Intronic
1055696181 9:78887145-78887167 TGCTTGAACCCAGGAGCTCGAGG - Intergenic
1057783402 9:98068735-98068757 TCCTTGAACCCAGGAGCTTGAGG + Intronic
1058225696 9:102359238-102359260 TGCTTGAACCCAGGAGCAGGAGG + Intergenic
1058965685 9:110036262-110036284 TCCTAGAAACCCTGATCAAGTGG + Intronic
1059222541 9:112638416-112638438 CTCTTGAACCCAGGAGCACGAGG + Intronic
1060119599 9:120975730-120975752 TCCTAGGACCCAGAACCATGAGG + Intronic
1060549310 9:124477644-124477666 TCCCACAACCCGGGTTCACGCGG - Intronic
1062401729 9:136375799-136375821 TCCTGGAACACAGGAACACCAGG + Exonic
1185943725 X:4350970-4350992 TGCTTGAACCCAGGAGAACGAGG + Intergenic
1187135308 X:16542300-16542322 TGCTTGAACCCAGGAGAACGAGG - Intergenic
1188055153 X:25531992-25532014 TCCTGGAACCCAGGATTGAGTGG - Intergenic
1188572963 X:31611642-31611664 TCCTTGAACCCAGGAACTGGAGG - Intronic
1188929377 X:36087615-36087637 TTCTAACACCCAGGATCACTGGG + Intronic
1194689286 X:96963204-96963226 TCCTACATCCCAGGAACACGTGG - Intronic
1195220074 X:102738306-102738328 GTCTAGAACCCAGGATGATGGGG - Intronic
1196571948 X:117276033-117276055 TCCTAGATCCCAAGATAACCAGG + Intergenic