ID: 917122776

View in Genome Browser
Species Human (GRCh38)
Location 1:171659044-171659066
Sequence CATAATATTTAGAAATTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917122776_917122781 16 Left 917122776 1:171659044-171659066 CCATCTAATTTCTAAATATTATG No data
Right 917122781 1:171659083-171659105 CTCAAGTATGAACTTTAGGCCGG No data
917122776_917122778 12 Left 917122776 1:171659044-171659066 CCATCTAATTTCTAAATATTATG No data
Right 917122778 1:171659079-171659101 AGCCCTCAAGTATGAACTTTAGG No data
917122776_917122784 25 Left 917122776 1:171659044-171659066 CCATCTAATTTCTAAATATTATG No data
Right 917122784 1:171659092-171659114 GAACTTTAGGCCGGGCGTGGTGG No data
917122776_917122782 17 Left 917122776 1:171659044-171659066 CCATCTAATTTCTAAATATTATG No data
Right 917122782 1:171659084-171659106 TCAAGTATGAACTTTAGGCCGGG No data
917122776_917122783 22 Left 917122776 1:171659044-171659066 CCATCTAATTTCTAAATATTATG No data
Right 917122783 1:171659089-171659111 TATGAACTTTAGGCCGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917122776 Original CRISPR CATAATATTTAGAAATTAGA TGG (reversed) Intergenic
No off target data available for this crispr