ID: 917123403

View in Genome Browser
Species Human (GRCh38)
Location 1:171664410-171664432
Sequence TTATCAGGAGGGCCTTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917123403_917123412 13 Left 917123403 1:171664410-171664432 CCATGGAAAGGCCCTCCTGATAA No data
Right 917123412 1:171664446-171664468 CCTGCCAACATTAGCATGAGTGG No data
917123403_917123413 14 Left 917123403 1:171664410-171664432 CCATGGAAAGGCCCTCCTGATAA No data
Right 917123413 1:171664447-171664469 CTGCCAACATTAGCATGAGTGGG No data
917123403_917123416 25 Left 917123403 1:171664410-171664432 CCATGGAAAGGCCCTCCTGATAA No data
Right 917123416 1:171664458-171664480 AGCATGAGTGGGCTCGGAAGTGG No data
917123403_917123415 19 Left 917123403 1:171664410-171664432 CCATGGAAAGGCCCTCCTGATAA No data
Right 917123415 1:171664452-171664474 AACATTAGCATGAGTGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917123403 Original CRISPR TTATCAGGAGGGCCTTTCCA TGG (reversed) Intergenic
No off target data available for this crispr