ID: 917130100

View in Genome Browser
Species Human (GRCh38)
Location 1:171732669-171732691
Sequence CAGCAGTACTTAAAGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917130100 Original CRISPR CAGCAGTACTTAAAGGAAAA TGG Intronic
900484378 1:2914504-2914526 CAGCAGGCCCTGAAGGAAAAGGG - Intergenic
902218711 1:14950916-14950938 CAGCAGTACCCACAGGAGAAAGG + Intronic
902269879 1:15296150-15296172 CAGCAGTTATCAAAGGAAGAAGG + Intronic
902445747 1:16462866-16462888 AAGCATTACTTAAAGGCAACAGG - Intergenic
904977871 1:34472463-34472485 CATCAGTTCTGAAAGGAAAGTGG + Intergenic
906127400 1:43435657-43435679 CGGCAGTAACTAAAGGAAGATGG + Intronic
907410874 1:54282463-54282485 CAGCAGTGTTTAAAGAGAAAAGG - Intronic
908068055 1:60429064-60429086 CAAAAGTTCTTAATGGAAAAAGG + Intergenic
908578845 1:65491807-65491829 TAGGAGTACTTAAAGTAAAATGG + Intronic
908633453 1:66136197-66136219 GAGCAGAACTTAAAGTAGAAAGG - Intronic
909062736 1:70897873-70897895 CATCAGTTCTTCAAAGAAAAAGG + Intronic
910188685 1:84573317-84573339 CGGCAGTACTTAAACCAGAAGGG - Intronic
910793041 1:91070756-91070778 GAGGGGTACTTAAAGGAGAAAGG + Intergenic
911957502 1:104256293-104256315 AAGCAGAACATAAAGGGAAAAGG - Intergenic
912209500 1:107543047-107543069 TAGCAATACCGAAAGGAAAAGGG - Intergenic
912279929 1:108302649-108302671 CAGCAATACTTGAATGTAAATGG - Intergenic
912288297 1:108391708-108391730 CAGCAATACTTGAATGTAAATGG + Intronic
912435911 1:109660969-109660991 CAACATTACTTAAAGGAAGTTGG + Intronic
912437855 1:109674551-109674573 CAACATTACTTAAAGGAAGTTGG + Intronic
912440365 1:109693010-109693032 CAACATTACTTAAAGGAAGTTGG + Intronic
914088819 1:144478477-144478499 CAGCAGAATTTAAATGTAAAAGG - Intergenic
914407473 1:147390047-147390069 CAGCAGTGCTTAGGGGAAGAGGG - Intergenic
915618407 1:157060704-157060726 ATGCAGTACTTGAAGGAGAACGG - Intergenic
917130100 1:171732669-171732691 CAGCAGTACTTAAAGGAAAATGG + Intronic
917821854 1:178770779-178770801 CAGAAGTACTAAGAGGTAAAAGG - Intronic
919088937 1:192955162-192955184 TAGCATTACTTAAAGGAAGATGG - Intergenic
919182176 1:194100654-194100676 AAGCAGTAGTAAAAGAAAAATGG - Intergenic
921248778 1:213276827-213276849 TAGCAGTACATAAAGGTGAAAGG + Intergenic
921665134 1:217860044-217860066 AAGCAGTGCCTAGAGGAAAATGG - Intronic
921693199 1:218176992-218177014 CAGCAATACTTAAAAAAACATGG - Intergenic
923042174 1:230327258-230327280 CAGCAATACTTAAATGGACAAGG + Intronic
923393719 1:233540258-233540280 CTTCAGTACGTAAAGGGAAAGGG + Intergenic
924503402 1:244657777-244657799 CAGCAGTATGTGAAGGAAGATGG + Intronic
924641847 1:245840779-245840801 GAGCAGGTCTGAAAGGAAAAGGG + Intronic
1063585814 10:7351254-7351276 CAGCAGTTGTTAAATGAATAAGG - Intronic
1065375354 10:25034819-25034841 CAACAGCATTTAAGGGAAAAGGG - Intronic
1066071719 10:31822358-31822380 CAGAAGGACTTGATGGAAAAGGG + Intronic
1067305345 10:45059048-45059070 CAGCAGTACTTAATCAGAAAGGG - Intergenic
1068045020 10:51875709-51875731 AAGTAATACTTAAAGCAAAAAGG + Intronic
1068110766 10:52678202-52678224 CAACAGTACTGAAAAGAAATTGG + Intergenic
1069120597 10:64565198-64565220 CAGCATTACATAATGGTAAAGGG - Intergenic
1069371171 10:67749056-67749078 GGGCAGTACTTAATGGTAAAGGG + Intergenic
1071730433 10:88243292-88243314 CAGCAGAGCTTCAGGGAAAATGG - Intergenic
1072269674 10:93763977-93763999 AAGCAGTACTTAAATCAAAAAGG - Intronic
1073945177 10:108741976-108741998 CAGCAACAATTAAAGGAATATGG + Intergenic
1074340515 10:112624214-112624236 CAGCAATACTAAATGGAATATGG + Intronic
1074642314 10:115400678-115400700 CAGCATTACATAATGGTAAAGGG - Intronic
1074684047 10:115942155-115942177 GTGCATTATTTAAAGGAAAAGGG - Intronic
1075491424 10:122873764-122873786 GAGCAGTGCTTACAGGGAAACGG - Intronic
1076332950 10:129684606-129684628 CAACAGCATTGAAAGGAAAAAGG + Intronic
1078353119 11:10611732-10611754 AATCAGTACTGAAAGGAAGATGG + Intronic
1079600778 11:22310885-22310907 TAGCAATACTTAAAGGATAAGGG + Intergenic
1080149651 11:29036022-29036044 CAGCAGGATTTAAAGGAGGAAGG + Intergenic
1080420616 11:32106921-32106943 CAGCAAAACTTAAAGCTAAATGG - Intergenic
1080422791 11:32126698-32126720 CAGAGGCACTTAAAGGAATAAGG - Intergenic
1081043445 11:38240722-38240744 CAGCATTACATAATGGTAAAGGG - Intergenic
1081317497 11:41648790-41648812 GAGCATTACGTAAAGGTAAAGGG - Intergenic
1082745608 11:56958310-56958332 CAGCACTACTTATTGAAAAAAGG + Intergenic
1082793368 11:57362776-57362798 CAACAGTACTTAAATGCAATGGG + Intronic
1083484258 11:62973547-62973569 CAACAGTACTTATAGGAGAAAGG - Intronic
1084159323 11:67336942-67336964 AAGAAGTACTTAAAGGAAAGTGG + Intronic
1084308255 11:68300455-68300477 CTTCAGTACTTGAAGCAAAATGG - Intergenic
1085159115 11:74324835-74324857 GAGAAGTACTTAAAAGGAAAGGG + Intergenic
1087110167 11:94457409-94457431 GAGCAGTAGCTAAAGGAAAATGG + Intronic
1088716396 11:112553502-112553524 CAGCAGGGCTTAATGGAAATGGG - Intergenic
1088765766 11:112975030-112975052 TTGCAGTTCTTAAAGGAAAAGGG + Intronic
1089576582 11:119448583-119448605 CAGCAGTACAGAAAGCAAACTGG - Intergenic
1090086595 11:123655216-123655238 AAGGAGTAATTAAAGGAAAAGGG - Intronic
1091911341 12:4232815-4232837 CAGCAGCATTTAGAGGGAAAAGG - Intergenic
1092651855 12:10643375-10643397 CAGCAGAACATAAAGGTAATGGG - Intronic
1093566352 12:20609594-20609616 AAGCAGTACTGAGGGGAAAACGG + Intronic
1095602660 12:44031593-44031615 CAGCAGCATTTTAAGCAAAAAGG - Intronic
1095722631 12:45417402-45417424 CAGCAGCTCTTAAAGGAGGAAGG + Intronic
1096336717 12:50762483-50762505 CAGCATTACTGAAAGAAAAGTGG - Intergenic
1096761029 12:53842098-53842120 AAGCAGTACTTCTAGGAAAAGGG + Intergenic
1097351517 12:58554392-58554414 CAGAAGCACTCAAAGAAAAATGG - Intronic
1097972321 12:65647529-65647551 CGGCAGAAGATAAAGGAAAATGG + Intergenic
1099967112 12:89459554-89459576 CAACATTTTTTAAAGGAAAATGG + Intronic
1100787179 12:98090614-98090636 CATTATTAATTAAAGGAAAATGG + Intergenic
1101037459 12:100719086-100719108 TTTCAGTAATTAAAGGAAAAAGG + Intronic
1101748751 12:107565240-107565262 CTGCAGGACTTGAAGGAAATGGG + Intronic
1104042139 12:125137524-125137546 CAGCAGAACTTAAAACTAAAAGG - Intronic
1105971390 13:25432066-25432088 CAGCAGTAAATAAAAGAATAAGG - Intronic
1106071136 13:26412253-26412275 TAGCAGTAGCTGAAGGAAAAGGG - Intergenic
1106687171 13:32073010-32073032 CAGGAGCACTTAAAAGAAAAAGG + Intronic
1107040967 13:35946916-35946938 CTACAGTATTTAAAGGAAAAAGG + Intronic
1108425743 13:50298070-50298092 CAGCATTACATAACGGTAAAGGG - Intronic
1108712268 13:53045135-53045157 CAGCAGTAATCCAAGGACAACGG + Intronic
1108965730 13:56298496-56298518 TAGAAATACTTAGAGGAAAAAGG + Intergenic
1109070683 13:57763187-57763209 CAGCAGTATTTAAATCAGAAAGG - Intergenic
1109328883 13:60902729-60902751 CAGCATTACATAATGGTAAAAGG + Intergenic
1110185545 13:72670411-72670433 CAATAGGACTTAAAAGAAAAAGG + Intergenic
1111064056 13:83067008-83067030 AAGCAGTAATTAAAGCAAAGTGG + Intergenic
1111745401 13:92262127-92262149 GAGAAGTACTGGAAGGAAAAGGG - Intronic
1111769256 13:92575685-92575707 CAGCAGTGCTGAGAGGAATATGG - Intronic
1111849344 13:93552735-93552757 GAGCAATACTTAAAAGAAATTGG - Intronic
1111993739 13:95141919-95141941 CATCAATACATAAAGGAAACTGG + Intronic
1112647863 13:101355453-101355475 TGGCATTACTTAAAGGTAAAGGG + Intronic
1113090317 13:106611223-106611245 AAGCAGTACATACATGAAAAAGG + Intergenic
1113118316 13:106898264-106898286 CAGCAAAACTACAAGGAAAAAGG - Intergenic
1113201322 13:107868802-107868824 CAGCGCTCCTTAAAGGAAAATGG - Intergenic
1114497834 14:23146155-23146177 CAGCAGTAACTCAAGGATAAAGG + Intronic
1115137181 14:30124651-30124673 CAGGAGTACAAAAATGAAAATGG + Intronic
1116129877 14:40841661-40841683 CAGGTTTACTGAAAGGAAAATGG - Intergenic
1119539817 14:75430542-75430564 GAGCCTTAATTAAAGGAAAATGG - Intronic
1120076738 14:80167665-80167687 CACCAATACTTAAAATAAAATGG - Intergenic
1127001510 15:54513438-54513460 GACCTGTACTTAAAGGAAACTGG + Intronic
1127564016 15:60168805-60168827 CAGAAGTATTTCAAGTAAAAAGG + Intergenic
1128396899 15:67235680-67235702 CAGCAGTAGGGAAAGGAAAAAGG + Intronic
1128433333 15:67621078-67621100 CAGCAAAATTGAAAGGAAAAGGG + Intronic
1129994878 15:79996053-79996075 CAGCAGGACTAAATGGAAAAGGG - Intergenic
1130205091 15:81868406-81868428 CAGCAGTAGTTTCTGGAAAAGGG - Intergenic
1131574645 15:93574901-93574923 AAGCTGTGCTTACAGGAAAATGG - Intergenic
1132033597 15:98459849-98459871 CAGCAGTTAAAAAAGGAAAAGGG + Intronic
1132052700 15:98621118-98621140 AAGCAGTATATAAAGCAAAAAGG + Intergenic
1132194824 15:99906330-99906352 CAGCAGTACTGAGAGTAATATGG + Intergenic
1133658180 16:7887493-7887515 CAGCTGCACTAAAAGGAAGAGGG + Intergenic
1133888503 16:9854827-9854849 CAGCAGTGCTTCCAGGAATAAGG + Intronic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1135070608 16:19348582-19348604 CAGCAGTACAGAAAGTAAAAAGG - Intergenic
1135600916 16:23782562-23782584 CAGAAGTACATGAAGTAAAAAGG + Intergenic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1138244600 16:55458112-55458134 CAGAAGAACATAAAGAAAAAGGG + Intronic
1138641180 16:58388578-58388600 GATCAGTACTGAAGGGAAAACGG + Intronic
1139052033 16:63135876-63135898 CAGCAATATTTAAAGAAATATGG + Intergenic
1140100141 16:71909017-71909039 CAGCTGTACTTAAAGCAACATGG - Intronic
1140625576 16:76790046-76790068 GATCAGAACTTAAAGGAACAAGG - Intergenic
1142068621 16:88076854-88076876 CAGCAGGACTCAAACGAAAGGGG - Exonic
1142132903 16:88438906-88438928 GAGCAGTACGAAGAGGAAAAAGG + Exonic
1143692784 17:8584439-8584461 AAGCAGTTTTTAAAGGAAAGAGG + Intronic
1143985905 17:10913820-10913842 CTGAACTACTTGAAGGAAAAGGG + Intergenic
1144837632 17:18165307-18165329 CAGAAGTTCTAAAATGAAAATGG + Intronic
1144860960 17:18301705-18301727 GAACAGCACTAAAAGGAAAAGGG - Intronic
1145897884 17:28471133-28471155 CTGCATTAATTAAAGGAGAAGGG + Intronic
1148247256 17:46041559-46041581 CACCACTACTTCAAGGAAGAAGG + Intronic
1148657100 17:49293833-49293855 GAGAAGTACTTAATGAAAAAAGG - Intronic
1149767742 17:59294003-59294025 CTGCAGTACCCAAAGGAAAGTGG - Intergenic
1151260784 17:72914494-72914516 CACCAGTCCTTGATGGAAAATGG - Intronic
1158406414 18:57163845-57163867 CAGCAGAACTTTAAGGCAAATGG - Intergenic
1162144009 19:8602200-8602222 CAGCAGTACAGACAGAAAAAAGG - Intronic
1162343168 19:10104746-10104768 CATCACAACTTAAAGGGAAATGG + Intergenic
1162852333 19:13440361-13440383 CAGCAGTACTTTATAGAAAGGGG + Intronic
1165967083 19:39591110-39591132 CATAAGTACTTAAAGGATATAGG + Intergenic
1165972573 19:39644632-39644654 CACAAGTACTTAAAGGATATAGG + Intergenic
1166762117 19:45231637-45231659 CAGAAGTTCGTAAAGGGAAAAGG + Intronic
1168669994 19:58233732-58233754 CAGCAGCACTTAAACTAAACAGG - Intronic
925165371 2:1712661-1712683 CAGCAGAACTAAAATGAAAACGG + Intronic
926065739 2:9838248-9838270 CAGCAGAAGTTAAAGGCAGAAGG + Intergenic
927042976 2:19248318-19248340 CAACAGAACTCTAAGGAAAAAGG - Intergenic
927293532 2:21427548-21427570 TAGCAGCACTGAAAGGAAGAAGG - Intergenic
929177737 2:38998767-38998789 AATCAGTACTTTAGGGAAAAAGG - Intronic
929212663 2:39374847-39374869 CAGCTGTAAAAAAAGGAAAAAGG + Intronic
929419624 2:41777549-41777571 CAACAGTATTTAAATGGAAATGG + Intergenic
929633782 2:43494330-43494352 CAGCAGGAATGAAAGAAAAAGGG - Intronic
930732488 2:54741668-54741690 TAGCAGTGCTTAAAGAATAAGGG + Intronic
931541570 2:63335223-63335245 CTTCAGTATTTAAAGGGAAAAGG - Intronic
931587624 2:63845432-63845454 CAACAGAACTAAAAGAAAAAAGG + Intronic
935069304 2:99679606-99679628 AAGCAGAAATAAAAGGAAAATGG + Intronic
936686251 2:114829969-114829991 CAGCAGAGCTTAGAGGAAAATGG - Intronic
939190768 2:138914248-138914270 CAGCAGTTTTTAAAGTATAATGG + Intergenic
939204532 2:139083380-139083402 CAGCAGCACTTAAAGTGCAAAGG + Intergenic
939433713 2:142145725-142145747 AAGCAGTAGTTATAGGATAATGG + Intergenic
941144242 2:161823835-161823857 CATCAGTATTTAAAGCAGAAAGG + Intronic
941641676 2:167995717-167995739 GAGCAGAAATTAAAGGAGAATGG + Intronic
942229017 2:173842382-173842404 CAGTGCTACTGAAAGGAAAAGGG + Intergenic
942715271 2:178884600-178884622 CTTCAGTATTTAAAGGAGAAAGG - Intronic
942944604 2:181658631-181658653 CAGCAGTCATTAGAGGGAAAAGG + Intronic
943312315 2:186341780-186341802 CAACAGTATTCAAAGGAAAATGG + Intergenic
945381553 2:209146855-209146877 CAGCAGGGCTTAAAGCAGAAAGG + Intergenic
946589473 2:221228375-221228397 CAAGTGTTCTTAAAGGAAAAGGG - Intergenic
947679285 2:232014975-232014997 CAGAGGTAGTAAAAGGAAAATGG + Exonic
947783808 2:232796232-232796254 CTTCAGTATTTAAAGGAAAAAGG - Intronic
1168855863 20:1008312-1008334 CAGCAGTATATAATGGAGAATGG - Intergenic
1170320299 20:15089672-15089694 CAGCAGGACTCAAGGGCAAAGGG - Intronic
1170573406 20:17645601-17645623 CAGCACAACTGAAAGAAAAAAGG + Intronic
1170765311 20:19284954-19284976 CAGCAGTTATTAAGGGAAATGGG - Intronic
1174697884 20:52578846-52578868 GAGCAGTAATCAAAGAAAAACGG - Intergenic
1175518072 20:59581487-59581509 CAGCAGTCCTTAAAGTAATGGGG - Intronic
1176015460 20:62928958-62928980 CAGCAATTCTTAAAAAAAAATGG + Intronic
1176927852 21:14771864-14771886 CCTCAGCACTTACAGGAAAACGG + Intergenic
1178213611 21:30568016-30568038 CACCACTCCTTACAGGAAAAGGG + Intergenic
1179205109 21:39269271-39269293 CACCTGTACATAAAGAAAAAAGG + Intronic
1183518040 22:38279056-38279078 CATGAGTACCTAAAGAAAAATGG + Intergenic
1184801774 22:46765303-46765325 CACCACTACTGATAGGAAAACGG - Intronic
949519544 3:4837262-4837284 CCACAGTACATAAAGTAAAAAGG - Intronic
949722201 3:7002788-7002810 CAATAGTACTTAAATGAACATGG - Intronic
951870200 3:27353454-27353476 CAGAAGTATTTAGAGGCAAAAGG + Intronic
952005135 3:28835018-28835040 CAGCAGTTTTTAAAACAAAATGG - Intergenic
952138370 3:30450142-30450164 CAGAAGTATTTAAGGGTAAAGGG - Intergenic
952166224 3:30752071-30752093 CAGCAGTACTTTAACGAAATAGG - Intronic
953117783 3:40009979-40010001 CATCATTCCTTAAAGGAGAAAGG - Intronic
953352333 3:42224667-42224689 CAATAGGACTGAAAGGAAAAAGG + Exonic
954407367 3:50352835-50352857 CACCAGAAATTAAAGTAAAAAGG - Intronic
954474200 3:50728632-50728654 AAGCAATATTTAAAGTAAAATGG - Intronic
956451522 3:69379607-69379629 AAACAGAACTTAAAGGAATATGG - Intronic
956896792 3:73668997-73669019 CAGGTGTTCTTAAAGGAAAATGG - Intergenic
956951262 3:74285878-74285900 CAGCAATACTTACAGAAAATTGG - Intronic
958686974 3:97411127-97411149 CAGCATTACCTGAAAGAAAATGG + Intronic
960432665 3:117588816-117588838 CAGCTCTATTTAAAAGAAAAAGG + Intergenic
960509385 3:118530391-118530413 CTTCAGTACTTAAAGGGAAAAGG + Intergenic
960550622 3:118972261-118972283 TTACAGTACTTAAAGGAAACAGG - Intronic
960718659 3:120603727-120603749 CAGCAATAGTTAGAGTAAAAAGG + Intergenic
961029405 3:123588768-123588790 CTTCAGTACTTAAAGGGGAAAGG - Intergenic
961941480 3:130641938-130641960 CAAAAGTACTTAAACTAAAATGG + Intronic
962035919 3:131651397-131651419 CTTCAGTAATGAAAGGAAAAAGG - Intronic
962157833 3:132967562-132967584 CAGCAGTGGATAATGGAAAATGG - Intergenic
963064948 3:141256102-141256124 AAGCAATAGTTCAAGGAAAAGGG + Intronic
964020065 3:151999269-151999291 CAGATGTATTTAAAGAAAAAGGG + Intergenic
964460354 3:156918384-156918406 CAGTGGTACTTTAAGGAAATTGG + Intronic
964645538 3:158955095-158955117 CAACAATACCAAAAGGAAAAAGG + Intergenic
964784297 3:160377458-160377480 GAGCAGTACTTGCAGGAAGATGG - Exonic
966297036 3:178436033-178436055 CAACACTACTTAAATGCAAACGG + Intronic
966389782 3:179439785-179439807 CTTCAGTATTTAAAGGAGAAAGG - Intronic
966736584 3:183191564-183191586 CAGCAGCACTAAGATGAAAAAGG - Intronic
967777576 3:193400201-193400223 AAGCAGTAATTGAAGGAACAGGG - Intergenic
970517277 4:16845353-16845375 CACCAGTGCTCAAAGGAAACAGG - Intronic
970899221 4:21139352-21139374 CAGAAGTACTTCAGGTAAAATGG + Intronic
975096889 4:70466662-70466684 CAGCATTACATAATGGTAAAGGG + Intronic
975153726 4:71047485-71047507 GGGCAGTACATAAAGGTAAAAGG + Intergenic
976043406 4:80915056-80915078 AAGCAGTGCTTAGGGGAAAACGG - Intronic
977642346 4:99371264-99371286 CAGCAGTTGTAAAAGCAAAAGGG + Intergenic
978104258 4:104882556-104882578 CAGCAGTAATTCAAGTAAATAGG - Intergenic
978122506 4:105097519-105097541 CAGAAGTCCTTAAGAGAAAAGGG + Intergenic
979032755 4:115671915-115671937 CAGCATTATTGAAAGGACAAAGG + Intergenic
979485722 4:121267755-121267777 CAGAAGTACATAAATGCAAAAGG + Intergenic
980204421 4:129699072-129699094 TGGCAGTACTTAAAGGCAGAAGG - Intergenic
980613431 4:135187063-135187085 AAGCAGTACTTTAATGATAATGG + Intergenic
980859713 4:138484473-138484495 CTACAGTAATTAAAGGCAAAAGG - Intergenic
981793621 4:148569215-148569237 CAGCAGTGGTCAAAGGAAAAAGG + Intergenic
981844712 4:149154403-149154425 CAGCAGCCCTTAAAGGGACAGGG + Intergenic
986419763 5:7567419-7567441 CATTGGTAATTAAAGGAAAAAGG - Intronic
986834454 5:11619804-11619826 CACCAGTAGTTAATGGAGAAGGG - Intronic
987736003 5:21844393-21844415 CAGCGGTACTTAAATGGAAGTGG + Intronic
988012237 5:25503888-25503910 AAGCAGCGCTTAGAGGAAAATGG - Intergenic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
989484541 5:41974284-41974306 CAGAAATACTTGAAGGAAAAAGG - Intergenic
990506642 5:56451837-56451859 CAGCAGTCCTTAAAAGAGAATGG + Intergenic
991203255 5:64019005-64019027 AAGCAGTTGTTAAAGGAGAAAGG - Intergenic
991463238 5:66881790-66881812 CAGAAGTCCCTAAAGGTAAAGGG - Intronic
994057479 5:95434532-95434554 CAGCTGTAATTAAAGTAAAAGGG - Intronic
994302123 5:98158844-98158866 CGGCACTAGTTAGAGGAAAAGGG + Intergenic
996898506 5:128515777-128515799 TAGTACAACTTAAAGGAAAAAGG - Intronic
997804456 5:136901833-136901855 CAGCATTACATAATGGTAAAGGG - Intergenic
998248816 5:140535117-140535139 CAGCACTAGATACAGGAAAATGG - Intronic
998989200 5:147796450-147796472 AAGAAGTACTTAAAGAAAGATGG + Intergenic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1001248344 5:170123487-170123509 TAGGAGTACTTAAAGTAAAATGG - Intergenic
1001978807 5:176023322-176023344 CAGCAGAACTTAAAATTAAAAGG + Intronic
1002238609 5:177820440-177820462 CAGCAGAACTTAAAATTAAAAGG - Intergenic
1002373304 5:178771448-178771470 CAGCAGAACTTAAAATTAAAAGG + Intergenic
1002659615 5:180782799-180782821 CTTCAATATTTAAAGGAAAAAGG + Intergenic
1002809403 6:612728-612750 CAGCAGCAATAAAAGGAACAGGG + Intronic
1003422537 6:5971322-5971344 CAGCAGTCCATAATGGAACATGG - Intergenic
1003932940 6:10944627-10944649 AAGCAGTACTTAGAGAGAAATGG - Intronic
1004946747 6:20622802-20622824 CAACTGTACTTAAATGTAAATGG - Intronic
1005676708 6:28162395-28162417 AAGCAGTGCTTAAAGGCAACGGG + Intergenic
1007815780 6:44524674-44524696 CAGCAGGCCTTAAAGGATTATGG + Intergenic
1008308643 6:49937220-49937242 CAGCAGTAATTTTAGGAAATAGG + Intergenic
1008676886 6:53828428-53828450 CAGCTGTACATATTGGAAAACGG - Intronic
1009276579 6:61689313-61689335 CAGAACAACTCAAAGGAAAAAGG - Intronic
1009955486 6:70447869-70447891 CAGCAGTACTGAGTGGATAAAGG - Intronic
1010163919 6:72893153-72893175 CAGCAGTCCTTACATCAAAAAGG - Intronic
1011034176 6:82955569-82955591 AAGCAGAACTTAAAGAAATATGG + Intronic
1012124863 6:95416102-95416124 CAAAAGTACTTAATGGAAAGGGG + Intergenic
1013871421 6:114766277-114766299 CTTCAGTATTTAAAGGGAAAGGG + Intergenic
1014997141 6:128162062-128162084 CAGCACTACAAAAAGGAAATGGG + Intronic
1015408687 6:132867090-132867112 CAGCAAGACTTAAAGCAAAGTGG - Intergenic
1016771462 6:147856949-147856971 GAGCAGAACTCAATGGAAAAGGG - Intergenic
1017089951 6:150750405-150750427 CTGCAGAACTTCAAGGAAAACGG - Intronic
1017210149 6:151846914-151846936 GAGTATTACTTCAAGGAAAAAGG + Intronic
1017483633 6:154882485-154882507 CAGTAGCTATTAAAGGAAAAGGG + Intronic
1018486648 6:164247138-164247160 CAGCAGAACTTAGCAGAAAATGG + Intergenic
1020683997 7:11270979-11271001 TACCACTACTAAAAGGAAAAAGG - Intergenic
1020852292 7:13369882-13369904 CAGTAGTTATTGAAGGAAAAAGG + Intergenic
1021434067 7:20594470-20594492 CAGGAGTAATTGAAGAAAAAGGG + Intergenic
1022168464 7:27797368-27797390 CTGGAATATTTAAAGGAAAAGGG + Intronic
1023352820 7:39337316-39337338 CAGCAGCTATGAAAGGAAAAGGG - Intronic
1024281477 7:47722878-47722900 AAGAAGTAATTAAAGTAAAATGG - Intronic
1025094503 7:56087017-56087039 CAGCTGTACTGAAATGGAAATGG + Exonic
1025188093 7:56876536-56876558 CAGCTGTACTGAAATGGAAATGG + Intergenic
1025683830 7:63700386-63700408 CAGCTGTACTGAAATGGAAATGG - Intergenic
1027757814 7:82237513-82237535 AAGAAGTACTTAAACGAATAAGG - Intronic
1028012935 7:85672249-85672271 AAGCAGTACTTACAGCATAAAGG + Intergenic
1028683693 7:93568608-93568630 CACCAATATTTAAAGGGAAATGG - Intronic
1029802874 7:102967968-102967990 CACTAGTTCTTAAAGGAGAATGG - Intronic
1030551342 7:110964239-110964261 CACAAGTACTTAGAGGAAAGAGG + Intronic
1030834178 7:114263007-114263029 CAACAGAGCTAAAAGGAAAAAGG - Intronic
1031295125 7:119992016-119992038 CAGCATTACATAATGGTAAAGGG + Intergenic
1033177619 7:139139990-139140012 CAGCTGGATTTAAAGGTAAAGGG + Exonic
1034454285 7:151157683-151157705 AAGCAGTACCTAAAGGAAGCGGG - Intronic
1035226018 7:157432626-157432648 CAGCCGTCCTTAGAGGAGAAGGG + Intergenic
1035774313 8:2175770-2175792 CTACTGTACTTAAAGTAAAAAGG - Intergenic
1038113491 8:24526251-24526273 CAGTTGTCCTTAAGGGAAAAAGG - Intronic
1038880265 8:31603739-31603761 CTGCAGCAATTAAAAGAAAAAGG - Intergenic
1040833496 8:51705952-51705974 AAGCAGTATTTAAAAGATAATGG + Intronic
1041698460 8:60762185-60762207 GAGCAGTAGTTAGAGGAAGATGG - Intronic
1041830911 8:62152079-62152101 CATCAGGAGTTAAAGGGAAAAGG + Intergenic
1042630202 8:70807667-70807689 CAGCATTACATAATGGTAAAGGG + Intergenic
1042808568 8:72798805-72798827 CACCAGTTCTTAAAGGAATCGGG - Intronic
1046327296 8:112666029-112666051 TAGTAGTACATAAAGCAAAAAGG + Intronic
1047358492 8:124145605-124145627 CAGCAGCACCTAAAGCAAAAAGG - Intergenic
1048356188 8:133655898-133655920 CAGCAATACTTGACGGAAACAGG + Intergenic
1048924093 8:139255016-139255038 TAGCAGAGCTTAAAGGAAAAGGG + Intergenic
1049863901 8:144920922-144920944 CAGCAGAAGTTAATGTAAAATGG - Intergenic
1052287280 9:26800376-26800398 AAGAATTACTTAAAAGAAAAAGG + Intergenic
1054337616 9:63820845-63820867 CTGCAGTTCTTAAAACAAAACGG + Intergenic
1054842506 9:69759091-69759113 CCACAGTACTTCAAGTAAAATGG + Intronic
1055491052 9:76805642-76805664 CAGCAGTAGCTAAAGAAACACGG + Intronic
1056058832 9:82861115-82861137 CAGCAAACCTGAAAGGAAAAAGG + Intergenic
1057494140 9:95546536-95546558 CAGCAGTACCCAAAGAAACAAGG - Intergenic
1058051529 9:100411459-100411481 CAGCAGTTCATGAAGGAAATGGG - Intergenic
1059524941 9:114982260-114982282 CCACAGTAAATAAAGGAAAAAGG + Intergenic
1060086866 9:120711555-120711577 CAGAAGTCCACAAAGGAAAAAGG - Intronic
1061325305 9:129860377-129860399 CAGCAGTTCTCTCAGGAAAATGG + Intronic
1186251657 X:7673921-7673943 CAGCACTACTCAATGGGAAAAGG + Intergenic
1187017509 X:15344828-15344850 TAGGAGTACTTTGAGGAAAAAGG + Intergenic
1187766400 X:22647470-22647492 CAGCAGTCCATAAAGGAAATTGG + Intergenic
1188210171 X:27414324-27414346 AAGCAATACTTCAAGAAAAATGG + Intergenic
1190447071 X:50536800-50536822 CAGCAGTACTTGAAACCAAAAGG + Intergenic
1190529914 X:51364020-51364042 CAGCATTACATAATGGTAAAGGG + Intergenic
1191158979 X:57307019-57307041 CAGCGGTACTCAGAGGACAAAGG - Intronic
1191592640 X:62904922-62904944 CAGCATTACATAATGGTAAAGGG - Intergenic
1192502781 X:71664534-71664556 GAGCAGGACTTAACAGAAAAGGG + Intergenic
1192503992 X:71669971-71669993 GAGCAGGACTTAACAGAAAAGGG - Intergenic
1192509982 X:71715914-71715936 GAGCAGGACTTAACAGAAAAGGG + Intronic
1192516715 X:71765639-71765661 GAGCAGGACTTAACAGAAAAGGG - Intronic
1192522743 X:71816035-71816057 GAGCAGGACTTAACAGAAAAGGG - Intergenic
1192529114 X:71871038-71871060 GAGCAGGACTTAACAGAAAAGGG + Intergenic
1193730617 X:85097974-85097996 CATCAGTAATTAAATGTAAATGG + Intronic
1194000705 X:88425253-88425275 CAGCATCACTTAGAAGAAAAAGG + Intergenic
1194686104 X:96918881-96918903 CAGCAGTAACTAAGGTAAAAGGG + Intronic
1194795244 X:98203093-98203115 CATCAGTTGTGAAAGGAAAAAGG - Intergenic
1195153669 X:102099657-102099679 GAGCATTACATAAAGGCAAATGG + Intergenic
1196396607 X:115269790-115269812 CACCAGTTTTTAGAGGAAAAGGG + Intergenic
1196661106 X:118269737-118269759 CAGAAGAAATTAAAGGAATATGG + Intergenic
1196669965 X:118355581-118355603 AAGGTGCACTTAAAGGAAAAAGG - Intronic
1196861777 X:120035509-120035531 CTTCAGTATTTAAAGGCAAAAGG - Intergenic
1197803626 X:130377975-130377997 CAGAAGTAGTTAAAAAAAAAAGG - Intergenic
1197969538 X:132100812-132100834 AAACAGTGCTTAAAGGAAACAGG - Intronic
1198834714 X:140792362-140792384 AAGTAGTAATTAAGGGAAAAGGG - Intergenic
1199372194 X:147063398-147063420 CAGCAGAAGTTAAAAGAATAGGG + Intergenic
1199595477 X:149503350-149503372 CCCCAGTACTTCAAGGAGAATGG - Intronic
1199598401 X:149525861-149525883 CCCCAGTACTTCAAGGAGAATGG + Intronic
1201321771 Y:12707077-12707099 AATCAGTACTTAGTGGAAAAAGG - Intronic