ID: 917131897

View in Genome Browser
Species Human (GRCh38)
Location 1:171751627-171751649
Sequence TTTTTCTGCGTGTCATCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917131897_917131902 27 Left 917131897 1:171751627-171751649 CCAGTAGATGACACGCAGAAAAA No data
Right 917131902 1:171751677-171751699 TAGCCATTGACTCTGCGTAATGG No data
917131897_917131898 -10 Left 917131897 1:171751627-171751649 CCAGTAGATGACACGCAGAAAAA No data
Right 917131898 1:171751640-171751662 CGCAGAAAAATAGCTAAAAATGG No data
917131897_917131899 -7 Left 917131897 1:171751627-171751649 CCAGTAGATGACACGCAGAAAAA No data
Right 917131899 1:171751643-171751665 AGAAAAATAGCTAAAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917131897 Original CRISPR TTTTTCTGCGTGTCATCTAC TGG (reversed) Intergenic
No off target data available for this crispr