ID: 917133286

View in Genome Browser
Species Human (GRCh38)
Location 1:171763756-171763778
Sequence TTCAGGCTACACCAAGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917133275_917133286 21 Left 917133275 1:171763712-171763734 CCTCCCTTCTGGGTAAGGCAGCC No data
Right 917133286 1:171763756-171763778 TTCAGGCTACACCAAGGTGTGGG No data
917133277_917133286 17 Left 917133277 1:171763716-171763738 CCTTCTGGGTAAGGCAGCCAAAG No data
Right 917133286 1:171763756-171763778 TTCAGGCTACACCAAGGTGTGGG No data
917133276_917133286 18 Left 917133276 1:171763715-171763737 CCCTTCTGGGTAAGGCAGCCAAA No data
Right 917133286 1:171763756-171763778 TTCAGGCTACACCAAGGTGTGGG No data
917133279_917133286 0 Left 917133279 1:171763733-171763755 CCAAAGTCTTTCACCCTCTGGCC No data
Right 917133286 1:171763756-171763778 TTCAGGCTACACCAAGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917133286 Original CRISPR TTCAGGCTACACCAAGGTGT GGG Intergenic