ID: 917135718

View in Genome Browser
Species Human (GRCh38)
Location 1:171786441-171786463
Sequence CTGAGGGTATAAATGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917135713_917135718 24 Left 917135713 1:171786394-171786416 CCACACTGGACTTTCTTGGTCAT 0: 1
1: 0
2: 0
3: 19
4: 177
Right 917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG 0: 1
1: 0
2: 1
3: 20
4: 258
917135711_917135718 28 Left 917135711 1:171786390-171786412 CCTTCCACACTGGACTTTCTTGG 0: 1
1: 0
2: 1
3: 17
4: 192
Right 917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG 0: 1
1: 0
2: 1
3: 20
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917135718 Original CRISPR CTGAGGGTATAAATGGAAGA GGG Intronic
904954645 1:34272894-34272916 CAGAGGGTAGAAGTTGAAGAAGG - Intergenic
905325648 1:37149975-37149997 CAGAAGGTGTAAATGGAACAAGG - Intergenic
907071471 1:51539483-51539505 GTGGGGGCATAAAAGGAAGAGGG - Intergenic
908335228 1:63115929-63115951 CTGAGGATAGAAATGGTTGATGG + Intergenic
909345837 1:74585706-74585728 CTGTAGGTAGAAATGAAAGAGGG - Intronic
909461222 1:75916684-75916706 CAGAGGGTGGAGATGGAAGAGGG + Intergenic
910707323 1:90143627-90143649 CTGATGGTATAAATTGGTGAAGG + Intergenic
910751728 1:90638233-90638255 CTGAGGGTAGAAGTCCAAGAGGG - Intergenic
911577766 1:99598556-99598578 TTGAAGGAATAAATGAAAGAAGG - Intergenic
912163967 1:107020453-107020475 GTGAGGGTATTACTGGAACAGGG - Intergenic
912419019 1:109530992-109531014 CTGAGGGTATAAATAGCAGAGGG - Intergenic
912931773 1:113970038-113970060 CTCAGGGTATCAGTGGAATAAGG - Exonic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
914826200 1:151139482-151139504 CTGAAGGGATAAGTTGAAGAGGG + Intronic
914852556 1:151325985-151326007 GTAAGGGTATAACTGGAAAAAGG - Intronic
915305669 1:154976090-154976112 CTGAGAGGAAAAACGGAAGAGGG + Intronic
915431290 1:155868844-155868866 CTCAGGGGATAAATGGAAGTGGG + Intronic
915463006 1:156081040-156081062 CTGAGTGTAGGAATGGAAGGGGG - Intronic
915895343 1:159807576-159807598 CTGAGGGTAGAGATGGAGGCTGG + Intronic
917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG + Intronic
917226656 1:172790787-172790809 ATGTGGGGATAAATGGAGGAGGG + Intergenic
917555161 1:176078231-176078253 CTGATAGTATAAATTGAAGTTGG - Intronic
919504362 1:198379556-198379578 CTGAGGATATAAAGTGAAGAAGG + Intergenic
919953736 1:202391422-202391444 CTGCTGGTAAAAATGTAAGATGG + Intronic
920050355 1:203161153-203161175 TTGAGGAGAGAAATGGAAGAGGG - Intronic
920899614 1:210094404-210094426 CTGAGGGTGTACATGACAGATGG - Exonic
921900550 1:220445607-220445629 ATGAGGGTAGAAATGTAAAATGG - Intergenic
922206789 1:223455129-223455151 CTGAGGGTATATATAGGTGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923556647 1:235006060-235006082 CCGTGGGTGGAAATGGAAGATGG + Intergenic
923742090 1:236664288-236664310 CTGAGGGTACCAGAGGAAGAGGG - Intergenic
924328848 1:242922300-242922322 CTGAAGGAAGAAATGGAAGCTGG + Intergenic
924494817 1:244576738-244576760 CTGAGCCTAGAAATGGAAGGTGG - Intronic
1066792636 10:39082918-39082940 ATTTGGGTATAAATGGGAGAAGG - Intergenic
1068978626 10:63037494-63037516 ATTATGTTATAAATGGAAGAGGG + Intergenic
1070508019 10:77132966-77132988 CTCTGGAAATAAATGGAAGATGG + Intronic
1075333844 10:121595294-121595316 CTGAGGACAAAAATGGAGGAGGG + Intronic
1075799304 10:125142972-125142994 CTGAGGGTAAATGTGGGAGAGGG - Intronic
1075935682 10:126339130-126339152 GTAAGGGTAGAAAGGGAAGATGG - Intronic
1077556600 11:3228983-3229005 CTGAGGGTGGAAATGAGAGAGGG - Intronic
1077964905 11:7119289-7119311 TTGAGGATATAATTAGAAGATGG + Intergenic
1078006310 11:7535067-7535089 CTGATGGTGGAAATGAAAGAAGG - Intronic
1081290966 11:41325187-41325209 GTGAGGGAAGAAATGGAGGAAGG + Intronic
1081366954 11:42247438-42247460 ATGGGGGTATAAATGGAACATGG - Intergenic
1081378766 11:42389502-42389524 CTGTAGGTGCAAATGGAAGAAGG + Intergenic
1085014292 11:73162794-73162816 CCCAGGGCACAAATGGAAGAAGG + Intergenic
1086367708 11:86124590-86124612 ATAAGGGTATAACTGGAAGTGGG + Intergenic
1087070911 11:94079619-94079641 CTGAGGGAATACATGCATGAAGG + Intronic
1087153188 11:94877070-94877092 CTGAGGATGGAAATGGGAGATGG + Intergenic
1089937694 11:122382436-122382458 CTGATGAAAGAAATGGAAGAGGG + Intergenic
1091047855 11:132341019-132341041 CTGAGGATGTAAGAGGAAGAGGG + Intergenic
1091102696 11:132890107-132890129 TTTAGGTTATAAAAGGAAGAAGG - Intronic
1091194585 11:133720144-133720166 CTGGGGGTGGAAGTGGAAGAAGG + Intergenic
1092361820 12:7843122-7843144 CTGAGGGTCTAAAAAGATGAGGG - Intronic
1092378035 12:7971807-7971829 CTGAGGGTCTAAAAAGATGAGGG - Intergenic
1093204548 12:16231742-16231764 CTGAGGCTGAAAATGGAAAATGG + Intronic
1093334168 12:17880270-17880292 CTGTTGGTAGAAATGGAAAATGG + Intergenic
1093744661 12:22726506-22726528 CTGAGGGTAGAATAAGAAGAAGG - Intergenic
1094488668 12:30945105-30945127 CTGAGGGCAGAAAAGGAGGAGGG - Intronic
1096806827 12:54146064-54146086 CTAGAGGTATAAATGGTAGAGGG + Intergenic
1097028254 12:56074494-56074516 CTGACTGAATAAATGAAAGAAGG - Intergenic
1097336605 12:58390675-58390697 CTGAGGAGAAACATGGAAGAGGG - Intergenic
1097980775 12:65736083-65736105 CTTAGAGGATAAATGAAAGAGGG + Intergenic
1099011533 12:77297083-77297105 GTGAGGGTATTAAAGCAAGAAGG + Intergenic
1099374629 12:81884257-81884279 CTGAGGGAATCAAAGGAAGAGGG + Intergenic
1099783139 12:87226096-87226118 CTGATGGTAGAAATGAAAAATGG + Intergenic
1100699481 12:97131016-97131038 CAAAGGGAAAAAATGGAAGAGGG + Intergenic
1104452462 12:128881905-128881927 CTGAGGGGAGAAATGGAAATAGG - Intronic
1105522512 13:21143605-21143627 CTGAGGGTATAAAGTCAAGACGG + Intronic
1105530596 13:21215623-21215645 CTGAGGGCATAAACAGCAGAAGG - Intergenic
1105923996 13:24990141-24990163 CTGAGGGCATAAACAGCAGAAGG + Intergenic
1106456370 13:29930752-29930774 GGGAGGATATAAAGGGAAGAGGG + Intergenic
1107804154 13:44138605-44138627 AGGAGGGTAGAAATGGAAAATGG + Intergenic
1108189331 13:47921455-47921477 CTGAGGGTTTAAATGTTAAAGGG - Intergenic
1108985483 13:56581048-56581070 CTGAGGATAAACATGGAACAAGG - Intergenic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1114051013 14:18919847-18919869 CTGAGGTTATATATAGATGAAGG + Intergenic
1114111545 14:19482075-19482097 CTGAGGTTATATATAGATGAAGG - Intergenic
1114443175 14:22767225-22767247 CTGAGCGTGTAAAAGGATGATGG - Intronic
1115457594 14:33622778-33622800 TTGAGAGTAAAAATGAAAGAAGG + Intronic
1116275057 14:42822637-42822659 CTGTGGGTAAAAATGGGAAATGG - Intergenic
1118897774 14:69960530-69960552 CAGATGGTATAAATGGTAAATGG + Intronic
1119203228 14:72774402-72774424 CTGTTGGTAGAAATGGAAAATGG - Intronic
1120594170 14:86413652-86413674 CTCATGGTATAAATGGGATATGG - Intergenic
1122015383 14:98790780-98790802 ATGTGGGTATAAATGCATGATGG + Intergenic
1122704456 14:103611419-103611441 AAGGGGGTAAAAATGGAAGATGG + Intronic
1124151256 15:27180518-27180540 CTGAGGGTATACGTGGAGCAGGG - Intronic
1124883908 15:33666396-33666418 CTGAGAATAAAAATGAAAGAAGG + Intronic
1125101094 15:35913629-35913651 CTGAATGAATAAATGGTAGATGG - Intergenic
1126111891 15:45180033-45180055 CTGAGGGCATGAATAGAACAAGG - Intronic
1126688883 15:51272152-51272174 CTGAAGGGAAAAATCGAAGATGG - Intronic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128341943 15:66828526-66828548 CTGAGGACCTAAAAGGAAGAAGG - Intergenic
1128774973 15:70313402-70313424 GTGATGGTATTAATGGCAGATGG - Intergenic
1132655886 16:1041501-1041523 CTGAGAGTCTCAAGGGAAGAAGG - Intergenic
1134346217 16:13394129-13394151 CAGATGGTAGAAATGCAAGAAGG - Intergenic
1134846439 16:17444848-17444870 CTGAGGGAATGAATGGATAAAGG + Intronic
1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG + Intronic
1137295291 16:47086682-47086704 CTGAGGGTGAGAATGTAAGATGG + Intronic
1138932079 16:61671287-61671309 CTAAGGGAAGAAATGGAATACGG - Intronic
1138979955 16:62256042-62256064 CTGAAGATGGAAATGGAAGATGG - Intergenic
1139087002 16:63599026-63599048 CTGAAAGTGTAAATGGCAGAGGG - Intergenic
1139532457 16:67549057-67549079 CTGAGGGGACAGATGGAAGTGGG + Intergenic
1145496454 17:23908043-23908065 CTGAGGATTTAATTGGAAAAGGG + Intergenic
1146695873 17:34908854-34908876 GTGAGTGAATAAATGGATGAAGG - Intergenic
1147385221 17:40077147-40077169 ATGAGGGTATTAGGGGAAGAGGG - Intronic
1148130028 17:45256955-45256977 CTGAGGGCATAAACAGAAGTGGG + Intronic
1149266154 17:54930233-54930255 GTGAAAGTAGAAATGGAAGAGGG - Intronic
1151315160 17:73317339-73317361 CTGGGGTTGCAAATGGAAGAAGG - Intergenic
1151509035 17:74547109-74547131 CTGAGAGTGTAAATGGAGGGAGG - Intergenic
1155698934 18:28718595-28718617 CTTAGGTTAAAAATGGATGATGG + Intergenic
1156610897 18:38722914-38722936 ATGAGGTTATCAATGGAAGGGGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157365921 18:47064288-47064310 CTAAGGGAAAAAGTGGAAGAGGG + Intronic
1157403479 18:47405015-47405037 CTGGGGGTAAAAATGCAAGCTGG + Intergenic
1157660961 18:49443346-49443368 CTGAGAGTATAAAGGGATGAGGG - Intronic
1158236539 18:55322176-55322198 CTTAGGGTAAAAGTGGAACAGGG + Intronic
1158572089 18:58604928-58604950 ATGAGGGTATAAATGAATGGAGG - Intronic
1160290098 18:77584539-77584561 ATGAGGTTATGAATGGAACAAGG + Intergenic
1163019451 19:14474662-14474684 CTGGGTGTAAAAATGGAAGGTGG - Intronic
1168453564 19:56485715-56485737 CTTAGTGTATCAATAGAAGAAGG + Intergenic
1168580509 19:57551902-57551924 CTGATGGTCTAACTGGAGGATGG + Intronic
928019728 2:27694456-27694478 GTTAGGGTAGAAATGAAAGAGGG + Intronic
929616279 2:43311407-43311429 CTGGTGGTAAAAATGTAAGATGG + Intronic
929958479 2:46478704-46478726 CTGAGGGCCTAAATGGAACAAGG + Intronic
930554894 2:52883292-52883314 ATGAGTGTATATGTGGAAGAGGG + Intergenic
931574977 2:63709347-63709369 CTGAGGGTAAGAATGGAGGAGGG - Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932977071 2:76615589-76615611 CTGAGGGTAAAAATTGAAGGAGG - Intergenic
933546892 2:83725571-83725593 CTGAAGGGATAAATGCATGAGGG - Intergenic
938870743 2:135473750-135473772 CTGGGGGTCTAAAAGAAAGATGG - Intronic
939204318 2:139080576-139080598 CTGAGGGTTTAAATGAGAAAGGG - Intergenic
939753054 2:146072813-146072835 TTGAGGGTCTGAATAGAAGAAGG + Intergenic
940392434 2:153147850-153147872 TTGAGGATATAAAAGGGAGAAGG + Intergenic
940749952 2:157614203-157614225 CTGATGTTAGAAATGAAAGAAGG - Intronic
941180047 2:162248563-162248585 CTGAGGGTAAGAAAGGGAGATGG + Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
943808209 2:192150728-192150750 CTCAGGGAACAAATGGAGGATGG + Intronic
944259675 2:197662924-197662946 CTGAGGAAATAAATGGAAGGGGG - Intronic
945885396 2:215370596-215370618 CTGAGGAGAGAAATGGAACAAGG + Intronic
947870028 2:233429892-233429914 CAGAGGGGATAAATGGAACTGGG - Intronic
948698307 2:239745246-239745268 CGGAGGGTAAAAGTGGAAGCTGG - Intergenic
948871494 2:240801260-240801282 CAGAGAATATAAATGGAAAATGG + Intronic
1169304021 20:4472754-4472776 CTGAGCGTTTAAATGGCAGGTGG - Intergenic
1170132331 20:13034054-13034076 CTTAGGCAATAAATGGAAGGTGG + Intronic
1173896876 20:46557845-46557867 TTGAATGAATAAATGGAAGAAGG + Exonic
1173927904 20:46794404-46794426 CTCAGGGAATAAATGGAGGGAGG - Intergenic
1174289243 20:49496013-49496035 CTGAGTATATAGATGGATGAGGG - Intergenic
1174315495 20:49697378-49697400 CTGAGGGTTCAAATGAAGGATGG + Intronic
1176884398 21:14237040-14237062 CTGAGGGAATAAATGGAGAATGG + Intergenic
1180469491 22:15642222-15642244 CTGAGGTTATATATAGATGAAGG + Intergenic
949165187 3:931932-931954 TTGAGGGTATGAATGAACGATGG - Intergenic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
955628826 3:60950380-60950402 AAGAGGTTATGAATGGAAGATGG - Intronic
956201368 3:66709742-66709764 CTGAGGGGATAAACAGAAAAAGG - Intergenic
956333780 3:68141106-68141128 CTGAGGTTATTAATGCCAGAAGG - Intronic
956830828 3:73046172-73046194 CTGATGGTATAAAAGCAAGGTGG - Intronic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
960733799 3:120755761-120755783 CAGAGGGTAGAAATGGTAGTAGG - Intronic
961233029 3:125336994-125337016 GTGAGAGTAGAAATGGAAAATGG - Intronic
963368811 3:144370935-144370957 CTAAACATATAAATGGAAGAAGG + Intergenic
964791847 3:160460350-160460372 CTGGGGCCATAAATGGCAGAAGG - Intronic
964911656 3:161790156-161790178 GTGGTGGTAGAAATGGAAGACGG - Intergenic
965417508 3:168415224-168415246 ATCAGAGTATAAATGGGAGAAGG - Intergenic
970011784 4:11467634-11467656 CTGAGGGGTGAAAGGGAAGAAGG + Intergenic
971042670 4:22771666-22771688 CTGAGGATGTAAATGTAAGCTGG - Intergenic
971451697 4:26806949-26806971 GTGAGGGAATAAATGTCAGAAGG + Intergenic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973981510 4:56312099-56312121 CTGAGAAGATAAAAGGAAGAGGG - Intronic
974267899 4:59609481-59609503 CTGAGAGAATAAATTTAAGAAGG + Intergenic
974461290 4:62191431-62191453 GAGAGTGTATAAAAGGAAGAGGG + Intergenic
974527664 4:63064228-63064250 TTGAGGTTATAATTGGAGGATGG + Intergenic
974888999 4:67855970-67855992 CTGATGAAAGAAATGGAAGAGGG + Intronic
974925180 4:68289387-68289409 CTGAGGGTAAAGACAGAAGATGG + Intergenic
975566844 4:75765888-75765910 CTGAGGGTATTAAGTGAAGGTGG - Intronic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
977184643 4:93921453-93921475 CTCACGGTGTAAATTGAAGAGGG + Intergenic
979427420 4:120584787-120584809 CTGATGAAATAAATAGAAGAGGG + Intergenic
979604201 4:122619945-122619967 CTGAGAGTATAAATGCAATTGGG - Intronic
979823738 4:125206476-125206498 CTGAGGGTAAATCTGAAAGAAGG - Intergenic
980587551 4:134836494-134836516 CTGATGAAATAAATTGAAGAAGG - Intergenic
980661010 4:135857970-135857992 CTGGGAGTAAAAATGGGAGATGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
983959321 4:173733116-173733138 ATGAGGGTATAAAGGGAAAGGGG - Intergenic
984227886 4:177056894-177056916 CTGAGGAATTAAATGGAAAAAGG + Intergenic
984804888 4:183742872-183742894 ATGAGAATAAAAATGGAAGAAGG - Intergenic
985204081 4:187514793-187514815 CAGATGGTCAAAATGGAAGAAGG - Intergenic
986203089 5:5597518-5597540 CTGAGGTTATAATTTAAAGATGG - Intergenic
986624349 5:9709474-9709496 ATAAGGGTATAAATGCAAGGAGG - Intronic
988050199 5:26017978-26018000 CAGAAGGTATAAATTGAAAAGGG + Intergenic
992378561 5:76214683-76214705 CTGATGAAAGAAATGGAAGATGG - Intronic
992831686 5:80599317-80599339 CTGAGGGTTGCAATGGGAGAGGG + Intergenic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
992917851 5:81477814-81477836 TTGAGGGAATAAAAGGAATAGGG + Intronic
994805523 5:104442878-104442900 CTGAGTGTGTAATTGCAAGATGG + Intergenic
995508316 5:112883161-112883183 ATGGGGCTATAACTGGAAGAAGG - Intronic
995825352 5:116291015-116291037 CTGAGTCTATACATTGAAGAAGG + Intronic
996222972 5:120954914-120954936 CTGACGAAAGAAATGGAAGATGG - Intergenic
1001140629 5:169140842-169140864 CTGAGGTTTTGAATGGGAGAGGG - Intronic
1001299190 5:170521882-170521904 CTGAGTGACTACATGGAAGAAGG - Intronic
1005842805 6:29755267-29755289 CTTTGAGTATAAATGGAACAGGG - Intergenic
1008234899 6:49033284-49033306 CTGATGGTAGAAATGTAAAAAGG + Intergenic
1010187621 6:73161699-73161721 TTGAAGGTATTTATGGAAGAAGG - Intronic
1011818973 6:91228088-91228110 GTGAGGGTATATTTGGAAGACGG - Intergenic
1012175737 6:96080657-96080679 CTGTGGATTGAAATGGAAGAAGG - Intronic
1012616036 6:101281333-101281355 TTGAGTGTATAAGTGGGAGAAGG + Intergenic
1013020837 6:106216140-106216162 CTGATGGTAGAAATGTAAAATGG + Intronic
1013783285 6:113752120-113752142 CTGATGAAAGAAATGGAAGAAGG + Intergenic
1013855703 6:114569518-114569540 CTGTGGGTAGAAATGTAAAATGG - Intergenic
1014477483 6:121891176-121891198 CTGAGGATATAAATGAAAAGAGG - Intergenic
1014713643 6:124839162-124839184 CTGAGGGAGGAAATGGAATAGGG - Intergenic
1015440004 6:133237054-133237076 CTGAGTGTAAGCATGGAAGAAGG + Intergenic
1016202805 6:141432858-141432880 CTCAGTGTATACATGGATGAAGG + Intergenic
1016892041 6:149016475-149016497 GTGAGTGAATAAATGGCAGAAGG - Intronic
1017837193 6:158189242-158189264 CTGGGGGTTTCTATGGAAGAGGG - Intronic
1018646300 6:165951822-165951844 TTGAATGAATAAATGGAAGAAGG - Intronic
1020724257 7:11789388-11789410 CAGAGGGCAAGAATGGAAGAAGG + Intronic
1020729277 7:11861248-11861270 GTGAGGGTTAAAATGGACGATGG - Intergenic
1021260396 7:18449459-18449481 TTGAGGGTATTAATGAGAGAGGG + Intronic
1022134285 7:27432534-27432556 CTGAGGAAATAAATGGAAGGAGG - Intergenic
1027173138 7:75886918-75886940 CTTAGGGTTTAAGAGGAAGATGG + Intronic
1028687684 7:93610815-93610837 CTGAGGCTATAAATTCAAAAAGG + Intronic
1028827995 7:95296424-95296446 TTGAAGGTGAAAATGGAAGAGGG - Intergenic
1029847264 7:103425113-103425135 CTGAGAGTATAAACACAAGAGGG + Intronic
1030891143 7:115001045-115001067 CTGAAGGGAAAAATGGAAGATGG + Intronic
1031574107 7:123394830-123394852 CTGTGGATAACAATGGAAGATGG + Intergenic
1033262565 7:139856415-139856437 ATGAGTGTGTCAATGGAAGAGGG + Intronic
1034378707 7:150669457-150669479 GTGATGGTAAAAATAGAAGAGGG + Intergenic
1036034939 8:5008388-5008410 CTAATGGTAGAAATGGAAGATGG - Intergenic
1036627966 8:10487559-10487581 CTGAGGTTCAAATTGGAAGAAGG + Intergenic
1037098358 8:15013523-15013545 CTGAAGGAATAAAGGGAAGGAGG - Intronic
1038941566 8:32311406-32311428 CTGAGAGTTCAAATGCAAGAAGG + Intronic
1039360389 8:36870423-36870445 CTGAGAGTAAAAAGGGAGGAAGG - Intronic
1040905055 8:52460192-52460214 CTGAGAGTATGAGTAGAAGAAGG + Intronic
1043916011 8:85922805-85922827 CTGAGGGAATCAGGGGAAGAAGG - Intergenic
1044268779 8:90215155-90215177 CTGAGGTTGAAACTGGAAGAAGG + Intergenic
1046194548 8:110842717-110842739 CTGAGGATAAAAATGGGAGAAGG + Intergenic
1046393903 8:113613544-113613566 CTGATGGCCTAAATTGAAGAAGG - Intronic
1047251327 8:123183580-123183602 CTGGGGATCAAAATGGAAGAGGG - Intronic
1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG + Intergenic
1048028783 8:130611442-130611464 CTGAGGTTGTAAATGGGGGAGGG + Intergenic
1048715062 8:137259306-137259328 ATGAGGCTATAAATTGAGGATGG + Intergenic
1048732973 8:137464270-137464292 CTGAGAGTAAAGATGGTAGAAGG + Intergenic
1053176706 9:35930847-35930869 ATAAGGTTATAAATGGAAGAAGG + Intergenic
1056665250 9:88576577-88576599 CTGAGGGGAGAAGGGGAAGAGGG + Intronic
1057504257 9:95619708-95619730 CTGAGGGAGTGAATGAAAGAAGG + Intergenic
1057795213 9:98151079-98151101 GGGAGGGTATAAATGGCAAAGGG - Intronic
1057980880 9:99661996-99662018 CAGATGGTAGAAATGGAGGAAGG + Intergenic
1059794515 9:117677810-117677832 CTGAGTGTATTATTGGAACATGG - Intergenic
1060127984 9:121068459-121068481 CTGATGGAAGAAATTGAAGAGGG + Intergenic
1060284778 9:122240012-122240034 CTGTGTGAATAAATGTAAGACGG - Exonic
1061260618 9:129478889-129478911 CTGAGGGGATAAATTAAGGAAGG - Intergenic
1061911824 9:133729067-133729089 ATGAAGGAATAAATGGGAGAAGG + Intronic
1062719876 9:138034420-138034442 CTGCTGGTATAAGTGGAAGTAGG + Intronic
1185671132 X:1811020-1811042 CTAAGGATAAAAATGGAAAATGG + Intergenic
1185848515 X:3463696-3463718 TTGAGGGTCTAAAAGGAAGGTGG - Intergenic
1186710977 X:12196047-12196069 CTGTGGGTATAATTTGTAGATGG + Intronic
1187779914 X:22808902-22808924 TTGAAGAAATAAATGGAAGAGGG + Intergenic
1187832541 X:23397577-23397599 CTGAGGGAGTAAAAGGCAGAAGG - Exonic
1188143279 X:26578718-26578740 ATGAGGGAATAAAAGAAAGATGG - Intergenic
1188528257 X:31109059-31109081 ATGAGCATATAAATGGAAGGAGG + Intronic
1188940170 X:36228348-36228370 CTTATGGTACAAATGCAAGATGG + Intergenic
1189446539 X:41085834-41085856 CTGAGGGGAGAAGGGGAAGAGGG + Exonic
1190857968 X:54315983-54316005 TTGAGGGTCTAAAGGGTAGACGG - Intronic
1191959455 X:66684087-66684109 CTTAGGGTAGAAATGGGAAAAGG + Intergenic
1193093299 X:77518486-77518508 CTGATGAAAGAAATGGAAGAGGG + Intronic
1194927870 X:99848296-99848318 CTGAGGGTGGAAAAGGAAAAAGG + Intergenic
1195619583 X:106939607-106939629 ATGAGGCTTTAAAGGGAAGAAGG - Intronic
1198045501 X:132897750-132897772 CTAAGATTGTAAATGGAAGAGGG - Intronic
1198245502 X:134827430-134827452 GTGAGGGTCTAAATGAAAAAGGG - Intronic
1198516790 X:137416758-137416780 GTGAGAGTAAAAATGGAAGAGGG + Intergenic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200422566 Y:2987145-2987167 CTGAAGTTACAAATGAAAGAAGG - Intergenic
1201226231 Y:11821342-11821364 CTGAAGGAAGAAATGGAAGCTGG + Intergenic
1201859385 Y:18579106-18579128 CTGAGGAAATTAATGGAACACGG - Intronic
1201873936 Y:18741275-18741297 CTGAGGAAATTAATGGAACACGG + Intronic
1202580926 Y:26379723-26379745 CTGCTGGTAAAAATGTAAGATGG - Intergenic