ID: 917141633

View in Genome Browser
Species Human (GRCh38)
Location 1:171841457-171841479
Sequence GCGCGCCTGCGCGGGCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 347}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917141633_917141644 18 Left 917141633 1:171841457-171841479 CCTGCCCGCCCGCGCAGGCGCGC 0: 1
1: 1
2: 3
3: 43
4: 347
Right 917141644 1:171841498-171841520 AGAGCCAAGCGGCGGGCTGGCGG 0: 1
1: 0
2: 0
3: 15
4: 210
917141633_917141642 11 Left 917141633 1:171841457-171841479 CCTGCCCGCCCGCGCAGGCGCGC 0: 1
1: 1
2: 3
3: 43
4: 347
Right 917141642 1:171841491-171841513 AGCTGTCAGAGCCAAGCGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 153
917141633_917141640 7 Left 917141633 1:171841457-171841479 CCTGCCCGCCCGCGCAGGCGCGC 0: 1
1: 1
2: 3
3: 43
4: 347
Right 917141640 1:171841487-171841509 CGTTAGCTGTCAGAGCCAAGCGG 0: 1
1: 0
2: 0
3: 5
4: 73
917141633_917141647 22 Left 917141633 1:171841457-171841479 CCTGCCCGCCCGCGCAGGCGCGC 0: 1
1: 1
2: 3
3: 43
4: 347
Right 917141647 1:171841502-171841524 CCAAGCGGCGGGCTGGCGGCGGG 0: 1
1: 0
2: 1
3: 18
4: 203
917141633_917141641 10 Left 917141633 1:171841457-171841479 CCTGCCCGCCCGCGCAGGCGCGC 0: 1
1: 1
2: 3
3: 43
4: 347
Right 917141641 1:171841490-171841512 TAGCTGTCAGAGCCAAGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 100
917141633_917141643 15 Left 917141633 1:171841457-171841479 CCTGCCCGCCCGCGCAGGCGCGC 0: 1
1: 1
2: 3
3: 43
4: 347
Right 917141643 1:171841495-171841517 GTCAGAGCCAAGCGGCGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 129
917141633_917141645 21 Left 917141633 1:171841457-171841479 CCTGCCCGCCCGCGCAGGCGCGC 0: 1
1: 1
2: 3
3: 43
4: 347
Right 917141645 1:171841501-171841523 GCCAAGCGGCGGGCTGGCGGCGG 0: 1
1: 0
2: 2
3: 12
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917141633 Original CRISPR GCGCGCCTGCGCGGGCGGGC AGG (reversed) Intergenic
900088678 1:909981-910003 GGGCGGCGGCGCGGCCGGGCTGG + Intergenic
900109283 1:998811-998833 GCGGGCCCGGGGGGGCGGGCTGG - Intergenic
900190086 1:1349526-1349548 GCGGGCCCGCGCGCGGGGGCGGG - Intergenic
900214135 1:1472104-1472126 GCGGGGCGGGGCGGGCGGGCGGG + Intronic
900221683 1:1512488-1512510 GCGGGGCGGCGCGGGCGGGCGGG + Intronic
900633899 1:3652522-3652544 GGGCGGGTGCGCGGGCGGGGAGG - Exonic
903044293 1:20553896-20553918 GCGGGGCTGCGCGGGCGGCGGGG - Exonic
903157819 1:21460124-21460146 GGCCGCCTGGGCTGGCGGGCAGG + Intronic
905066841 1:35192084-35192106 GCGCCGCTGCGGGGGCGGGGCGG - Intronic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
906507981 1:46394223-46394245 GCCCGCCTGCGCGGGAGGGGCGG - Intergenic
906521048 1:46467041-46467063 GCGCGCGTGCGCCCGTGGGCTGG - Intergenic
907012655 1:50978010-50978032 GCGCGGCCGCGCGGCCGGCCGGG + Intergenic
907357642 1:53889637-53889659 CCGCGGCGGCCCGGGCGGGCAGG + Intronic
907880654 1:58546583-58546605 GAGCGCCTGCGGGGGCGCCCGGG - Intronic
908501106 1:64744895-64744917 GCGCGCCTGTGCGCCGGGGCCGG + Intergenic
910193872 1:84621115-84621137 GGGCGGCCGAGCGGGCGGGCAGG + Intergenic
912401603 1:109397936-109397958 GCGCGCCGGCGGGGGTGGGCGGG - Exonic
913144496 1:115976448-115976470 GGGCGCCTGCGCGGGCGGCGGGG - Intergenic
913544397 1:119853261-119853283 GGCCGCCTGGGCTGGCGGGCGGG - Intergenic
913991782 1:143620044-143620066 GGCCGCCTGGGCTGGCGGGCAGG - Intergenic
915345436 1:155194786-155194808 GCGCGCCCGGGAGCGCGGGCCGG + Intergenic
915549680 1:156624910-156624932 TGGAGCCTGGGCGGGCGGGCGGG - Intronic
916655952 1:166875836-166875858 GGGCCCCAGCGCGGGCGTGCGGG - Intronic
916666947 1:166975402-166975424 CCCCGCCTGCGCGGCCGGCCCGG - Intronic
917141633 1:171841457-171841479 GCGCGCCTGCGCGGGCGGGCAGG - Intergenic
921138653 1:212285366-212285388 GCGCGCCAGGGCGCGCGGCCCGG - Intergenic
921934856 1:220786955-220786977 GCGCGCCAGCGCGGAGGAGCCGG - Exonic
922372964 1:224929759-224929781 GCTCGCCGGCGTGGGCGGGCCGG + Exonic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
923506591 1:234610241-234610263 GAGCGCGCGCGCGGGAGGGCGGG - Intergenic
923506617 1:234610317-234610339 GCGCTGCCCCGCGGGCGGGCGGG - Intergenic
923684132 1:236142383-236142405 GCGGGCCGGGGCGCGCGGGCCGG + Intergenic
924778403 1:247126823-247126845 GCGGGGCTGCGGGCGCGGGCCGG - Intronic
924783255 1:247171597-247171619 GCGGGGCTGCGGGCGCGGGCCGG + Intronic
1063950379 10:11216686-11216708 GCTGGCCTGCGCGGAAGGGCCGG + Intronic
1065189221 10:23195124-23195146 GCGCCCCGGCTCTGGCGGGCAGG - Intergenic
1065214697 10:23438876-23438898 GCGCGCGAGCGCGCGCGGGCGGG - Intergenic
1065712608 10:28532670-28532692 CCGCCCCTGCGCTGTCGGGCGGG - Intronic
1065712900 10:28533752-28533774 GAGCGGCCGCGCGGGCGGGCGGG + Intronic
1066080783 10:31928788-31928810 GCCAGCCTGCGGGGACGGGCCGG - Exonic
1066464396 10:35640319-35640341 GGGCGCGGGCGCGGGCGGCCCGG - Exonic
1067071737 10:43137820-43137842 GCGCGTCACCGCGGGCTGGCGGG - Intergenic
1067227404 10:44385007-44385029 GCGCGGGCGGGCGGGCGGGCGGG + Exonic
1067453767 10:46398358-46398380 GCGCGCGGGGGCGGGCGCGCGGG + Intergenic
1067583460 10:47461388-47461410 GCGCGCGGGGGCGGGCGCGCGGG - Intronic
1067633464 10:47986736-47986758 GCGCGCGGGGGCGGGCGCGCGGG - Intergenic
1069445774 10:68472012-68472034 ACGCGCCGGCGCGGGAGGGGCGG - Intronic
1070257770 10:74826039-74826061 GCGGGCGGGCGCGCGCGGGCGGG - Intronic
1071997553 10:91162972-91162994 CCGCGCCGGCGGGGGCGGGGCGG - Intergenic
1072454117 10:95561282-95561304 GCGGGCAAGCGCGGCCGGGCGGG + Intronic
1073059464 10:100724672-100724694 GCTCGGCTGCGCAGGCGAGCCGG - Intergenic
1074864179 10:117535386-117535408 CAGCGCCTGCGCGGGCGGGCGGG - Intergenic
1075263097 10:120979820-120979842 GCGGGGCGGGGCGGGCGGGCAGG - Intergenic
1076156603 10:128210353-128210375 GCGCGCCTTCCCGGGCGGGGCGG + Intergenic
1076327840 10:129642203-129642225 CCGCACCTGGGCGGGCGGGCGGG + Intronic
1077097567 11:805417-805439 GCGCTGCTGCGCGGGCGGCTCGG - Intronic
1077124337 11:925813-925835 GCGTGCGTGCGCGTGCGTGCTGG + Intronic
1077133783 11:988335-988357 GCTGGCCTGTGCGGGAGGGCCGG + Intronic
1077201508 11:1309691-1309713 GCGCGCGTGCGCGCGAGAGCCGG - Intergenic
1077214620 11:1390237-1390259 GGGCGCCCGGGCGCGCGGGCAGG - Intronic
1080551297 11:33376036-33376058 GCGGGGCTGCGCGCGCGCGCCGG + Intergenic
1081872986 11:46391669-46391691 GCGCGGCCCCGCGGGCCGGCGGG + Intergenic
1083340409 11:61955456-61955478 GAGCCCCTGCGCGGGAGGGGAGG + Intronic
1083743517 11:64723104-64723126 CCGCGGCGGGGCGGGCGGGCGGG - Exonic
1083753636 11:64777867-64777889 GCGCGCGTGCGCGCACGGGGAGG - Intronic
1083812249 11:65112443-65112465 GGGCGCCCGTGCGGGCCGGCGGG + Intronic
1084089542 11:66870887-66870909 CAGCTCCTGCGAGGGCGGGCAGG + Exonic
1084146261 11:67266836-67266858 GGGCGCCCGCGGGGTCGGGCCGG - Intronic
1084387743 11:68854789-68854811 CCGCGGCTGCGCGGGCGCCCTGG - Intergenic
1085011241 11:73142698-73142720 GCGCGCCGGGGCGAGCTGGCGGG - Intergenic
1085283517 11:75345647-75345669 GGGCGCCTGAGCGGGAGGCCTGG - Intronic
1085416575 11:76322296-76322318 GCTCGCCTGTGCTGGCGGGGTGG + Intergenic
1087014532 11:93542952-93542974 GCGAGCCCGCGGGGCCGGGCGGG - Intronic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1089729495 11:120511606-120511628 GCGCCCCTTCGGGGCCGGGCCGG - Intergenic
1090804534 11:130194579-130194601 GTCCGCCTGCTCGGCCGGGCAGG + Intronic
1091558669 12:1594415-1594437 GCGCGGCGGCGCGGGCGGAGCGG - Intronic
1092108889 12:5945233-5945255 GCGCGCGGCCGCGGGCCGGCGGG - Exonic
1093736413 12:22625314-22625336 GGGCGCCCTCGCGGGAGGGCTGG - Exonic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096255047 12:50057710-50057732 GCGAGCCAGCGCGCGCGGGCGGG + Exonic
1096435874 12:51591009-51591031 CCGCGGGGGCGCGGGCGGGCGGG + Intronic
1096495441 12:52037126-52037148 GCGCGCCTCCCCCGGCGGGCGGG - Intronic
1097185536 12:57194490-57194512 GCGCGACTGCCCAGGTGGGCGGG + Exonic
1100611517 12:96194851-96194873 GTGCGTCCGCGCGGGAGGGCCGG + Intronic
1101504172 12:105330956-105330978 GGGGGCCGGCGGGGGCGGGCGGG + Intronic
1102278354 12:111599390-111599412 GCGCGGCGGAGCGGGCGGGGCGG - Exonic
1104854312 12:131894911-131894933 GCGGGCCGGGGCGGGCGGGCCGG - Exonic
1105018150 12:132798655-132798677 GCGTGCCTGAGTGGGAGGGCGGG + Intronic
1105472193 13:20704085-20704107 GCGGGGCTGCGCGGACCGGCCGG + Exonic
1106157396 13:27171474-27171496 TAGCGCCGGGGCGGGCGGGCGGG - Intronic
1106516977 13:30464819-30464841 GCGCGGCGGCGGCGGCGGGCGGG + Intronic
1106602566 13:31200254-31200276 GCGCGCCGGCGGGGCAGGGCTGG - Intronic
1108541951 13:51453249-51453271 GTGCGCGCGAGCGGGCGGGCGGG + Intronic
1110860637 13:80341517-80341539 GGGCGCCCGCGGGGCCGGGCTGG + Intergenic
1112290753 13:98142928-98142950 GCGCACCTGCCCGGGCGGAGCGG + Intronic
1112752563 13:102597228-102597250 GCGCGGGGGCGCGGGCGGCCGGG + Intronic
1113656634 13:112072212-112072234 GCGAGCCTTCGGGGGGGGGCGGG - Intergenic
1116945277 14:50830709-50830731 GCGGGCCGGCGGGGGCGGGGAGG - Intronic
1117875931 14:60249727-60249749 GCGCGGCGGCGGCGGCGGGCAGG + Intronic
1119296562 14:73537828-73537850 GCGAGCCGGTGCGCGCGGGCCGG + Exonic
1119325785 14:73759067-73759089 GCGGGCGTGCGGGGGCGCGCGGG + Intronic
1120914811 14:89701696-89701718 GCGCGCCAGCGGGGCGGGGCGGG + Intergenic
1121127670 14:91418144-91418166 GCGCGCGTGCGCGTGCAGCCGGG + Intergenic
1121616989 14:95319923-95319945 GGGCGCGGGCGCGGGCGGGGCGG + Intergenic
1121623933 14:95371197-95371219 GCGGGCCTGGCCGGGCTGGCTGG + Intergenic
1122891116 14:104732710-104732732 CCCCGCCTGGGCGGGGGGGCAGG - Intronic
1122917393 14:104865385-104865407 GCTCGGCCGGGCGGGCGGGCGGG + Exonic
1124712961 15:32030445-32030467 GCGCGCGGGGGCGGGCGGGGCGG + Intergenic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1125599903 15:40909810-40909832 GCTGGCCTGCGAGGGCAGGCTGG - Intergenic
1125999390 15:44195058-44195080 TCGCTCCCGGGCGGGCGGGCGGG - Exonic
1126109415 15:45166950-45166972 GCGCGCCGGCGGAGGCGGGAAGG - Intergenic
1126767048 15:52019598-52019620 GCGTCCCCGCGCGGGCGGGCGGG + Intronic
1127072965 15:55303044-55303066 GCGCGGCTGGCCGGGCGGGGGGG - Intronic
1127415136 15:58749929-58749951 GCGCGCATGCGCGCGGGGGACGG + Exonic
1127588242 15:60397905-60397927 GCGGCCCATCGCGGGCGGGCAGG + Exonic
1128199436 15:65792164-65792186 GCAGGCCTGGGCGGGCGGGCGGG - Intronic
1128344132 15:66842828-66842850 CGGCGCCGGCGCGGGCGGGGAGG + Intergenic
1132560222 16:590122-590144 GCGCCCGGGCGCGGGCGGGGCGG + Intronic
1132600984 16:772863-772885 GGGCACCTGGGTGGGCGGGCAGG - Intronic
1133212806 16:4272586-4272608 GCGCGCCCGCCCGGGCGGGCTGG + Intronic
1133212807 16:4272590-4272612 GCCCGCCCGGGCGGGCTGGCCGG + Intronic
1133732590 16:8589810-8589832 GTGCACCTGGGCGGGCTGGCCGG - Exonic
1134134171 16:11668633-11668655 GCGCGGCGGCGGGGCCGGGCCGG + Intronic
1135404732 16:22190122-22190144 GCGCACCTGCGGGGACAGGCGGG - Exonic
1135479952 16:22814216-22814238 GCGCGGCTGTGCGGGCTGGCGGG - Exonic
1138501457 16:57447528-57447550 GTGCGCTTGGCCGGGCGGGCTGG + Exonic
1138595302 16:58026367-58026389 GCGCGCCCGGACGGCCGGGCTGG + Exonic
1138619142 16:58197885-58197907 CCGGGCCCGCGGGGGCGGGCGGG + Exonic
1138619143 16:58197889-58197911 GCCCGCGGGGGCGGGCGGGCTGG + Exonic
1139544748 16:67644992-67645014 GGGCGACGGGGCGGGCGGGCAGG + Exonic
1139548519 16:67660950-67660972 GCGGGGCGGCGCGGGCGGGCCGG + Exonic
1140504646 16:75463986-75464008 GAGCGCCTGCGCGGAGGGGCCGG + Intronic
1141989586 16:87602461-87602483 GCGGGGGCGCGCGGGCGGGCGGG + Intronic
1142120356 16:88383707-88383729 GCACGCCCGGGCGGGCGGCCCGG - Intergenic
1142209783 16:88803620-88803642 GCGCGCATGCGCCGACGTGCGGG - Exonic
1142255926 16:89013946-89013968 GAGCGCCTGGGCGGGTGAGCGGG + Intergenic
1142412399 16:89923355-89923377 GCGGACGGGCGCGGGCGGGCCGG - Intronic
1143155369 17:4833251-4833273 GCGCGCAGGCGCAGGCGAGCAGG - Intergenic
1143155370 17:4833254-4833276 GCTCGCCTGCGCCTGCGCGCAGG + Intergenic
1145047121 17:19627694-19627716 GGGCGGCTGGGCGGGCGGGGGGG + Intergenic
1145197641 17:20908662-20908684 GCGCGCCTGCGCGTGGGGGGGGG - Intergenic
1146062053 17:29612816-29612838 GTGCGTCTCCGCGGGCGCGCGGG + Intronic
1147994541 17:44353690-44353712 GCGGGCCCGCGCGGGAGGGGCGG + Exonic
1148146889 17:45371715-45371737 GACCCCCTGCGCGGGCGAGCCGG - Intergenic
1149994770 17:61400598-61400620 GCGCGGGCGGGCGGGCGGGCTGG + Intronic
1150150878 17:62808119-62808141 GAGGGGCTGGGCGGGCGGGCCGG + Exonic
1151767024 17:76137923-76137945 GGGCTCCTGCGCGGCCTGGCGGG + Exonic
1152175157 17:78782341-78782363 AGGCGCAGGCGCGGGCGGGCGGG - Intergenic
1152467812 17:80475803-80475825 GGGCGACTGCGGGGGCGGCCTGG + Intronic
1152654351 17:81513017-81513039 GCGACCCTGCGCGGGCCGGCGGG + Intronic
1152708932 17:81860584-81860606 GCGCGCGCGGGCGGGGGGGCAGG - Exonic
1153480492 18:5543113-5543135 GCGCGGGAGCACGGGCGGGCCGG - Intronic
1153688196 18:7567203-7567225 GCGCTCGGGCGCGGGCCGGCGGG + Exonic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1155570354 18:27185386-27185408 GCGGAGCTGCCCGGGCGGGCGGG - Intergenic
1157464094 18:47930210-47930232 GTGCGCCGGCCCGGGCGTGCGGG - Intronic
1157496777 18:48162007-48162029 CGGCGCCTGCCCGGGCGGGCGGG + Intronic
1157849040 18:51030455-51030477 GCGCCGCTGCCCGCGCGGGCCGG - Exonic
1159100111 18:63949236-63949258 GGGCGCCTGGGCAGGAGGGCGGG - Intergenic
1159770374 18:72541734-72541756 GGGGACCTGCGCGCGCGGGCTGG - Intronic
1160739652 19:680040-680062 CTGCGCCTGCGCTGGGGGGCGGG - Intronic
1160789741 19:917936-917958 GCGGGCGGGCCCGGGCGGGCCGG + Intronic
1160824892 19:1074885-1074907 GCGGGCGGGCGGGGGCGGGCGGG + Intronic
1160861813 19:1240354-1240376 GAGCGCGTGCGCGGGCGGCTCGG - Intergenic
1160896871 19:1407307-1407329 GCGTGCGTGCGCGCGCGTGCGGG - Intergenic
1161001402 19:1912866-1912888 CGGCGCCTGCGCGGACGGCCTGG - Exonic
1161220951 19:3117909-3117931 GCACGCCTGCGGCGGCCGGCAGG - Intronic
1161248996 19:3270589-3270611 GCGCGCCTGTGCGCCCGGGGCGG + Intronic
1161424972 19:4198348-4198370 GCGGGACCGGGCGGGCGGGCGGG + Intronic
1161643070 19:5436362-5436384 GCGCGCGCGCGCGTGCGGGGAGG + Intergenic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1161959460 19:7515968-7515990 GCGCGGCCGCGCGGTCGGGGTGG + Intronic
1162100446 19:8335577-8335599 GTGCGCCCGCGAGGCCGGGCCGG + Exonic
1162327249 19:10006559-10006581 GGGAGCCTGCGCGGGAGAGCAGG - Intronic
1162420967 19:10565860-10565882 GGGAGCCTGCGCGCGCCGGCCGG - Intronic
1162780152 19:13002554-13002576 GCCCGGCGGGGCGGGCGGGCAGG + Intronic
1162798113 19:13096848-13096870 GCGGGGCTGCCCGGGCGGGCAGG + Intronic
1163320615 19:16572420-16572442 GCGGGGCTGGGCGGGGGGGCAGG + Intronic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163807055 19:19405831-19405853 GGCCGGCGGCGCGGGCGGGCGGG + Intronic
1165080220 19:33302497-33302519 GTGCGCGGGCGCGGGCGAGCAGG - Exonic
1165242946 19:34481949-34481971 ACGCGCCAGGGCCGGCGGGCCGG + Exonic
1165510962 19:36266502-36266524 GCGCGCTTGCGGCGGCGGGTGGG - Intergenic
1165864802 19:38930443-38930465 GTGCGCCTGCGCCGGCCGGGGGG - Intronic
1166347766 19:42177012-42177034 GCGCGGGCGGGCGGGCGGGCAGG + Intronic
1166799991 19:45450901-45450923 CCGCGTCTGCGCGGGCGTGGGGG - Intronic
1167237186 19:48322089-48322111 GTGGGCCTCCCCGGGCGGGCGGG + Intronic
1167413014 19:49356056-49356078 GCGGGGCTGTGCGGGCGGGTAGG - Intronic
1168056512 19:53867834-53867856 GGGAGCCAGCGCGGGCGGGACGG - Intronic
1168076176 19:53981988-53982010 GCCCGCTGGCGCAGGCGGGCAGG + Intronic
1168332326 19:55577964-55577986 GCTCACCTGCGCGGGCTGGGGGG - Exonic
924985385 2:264864-264886 GCGGGACTGCGCAGGCGCGCGGG + Exonic
926077380 2:9951936-9951958 CCGAGGCCGCGCGGGCGGGCGGG + Intronic
927751452 2:25673707-25673729 GCGCGGCCGCGGGGGCGGGGTGG - Intergenic
929218181 2:39437350-39437372 TCGCGGCTGCGCAGTCGGGCGGG - Intergenic
929788674 2:45009126-45009148 GAGGGCGCGCGCGGGCGGGCGGG - Exonic
930202135 2:48556774-48556796 GCACGGCTGCCCGGGCGGGGGGG + Intronic
930202236 2:48557000-48557022 GCACGGCTGCCCGGGCGGGGGGG + Intronic
931355851 2:61537507-61537529 GGGCGGCGGCGCGGCCGGGCGGG - Intronic
937221507 2:120345309-120345331 GCCTGCCTGCGCGGCCCGGCCGG - Intergenic
938034867 2:128027626-128027648 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
938368794 2:130756147-130756169 GCGGGCCGGCGCTGGCGCGCAGG - Intronic
941111051 2:161418799-161418821 GCCCGGCTGCGCGCCCGGGCCGG - Intronic
941309752 2:163913644-163913666 CCGCGCTTGCGCGGGCCAGCTGG + Intergenic
941476104 2:165953644-165953666 GAGCGGGTGAGCGGGCGGGCGGG - Intronic
944221762 2:197310550-197310572 GGGCGGCGGCGCCGGCGGGCGGG - Intronic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
945699442 2:213151857-213151879 GCGCGCGCGCGCGGGCTGGCGGG + Intronic
946304300 2:218846964-218846986 GGGCGGCTGGCCGGGCGGGCGGG - Intergenic
947669025 2:231925327-231925349 GCGCGCCTCCGAAGGCCGGCTGG + Intronic
948479136 2:238239563-238239585 CTGCACCTGCGCGGGCGGGAAGG + Exonic
949079869 2:242088467-242088489 GCGCGGGGGCGCGGGGGGGCGGG - Intergenic
1168757103 20:325520-325542 GCGCGCCGGCGGGGCCGCGCGGG + Exonic
1171011938 20:21513729-21513751 GCTCCCCTGCCCCGGCGGGCGGG + Exonic
1172644601 20:36461752-36461774 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
1172764931 20:37346239-37346261 GCTCACCTGGGCCGGCGGGCGGG - Exonic
1173165957 20:40687698-40687720 GGGCGGGTGCGCGGGCGGGCAGG - Exonic
1173488481 20:43458576-43458598 TCGCGCCTGCCCGGGCTGGGAGG - Intronic
1173672918 20:44810426-44810448 GCGCGGCGGGGCCGGCGGGCGGG + Intergenic
1174374002 20:50113186-50113208 GCGCGCCTGCGCATCAGGGCCGG - Intronic
1175422218 20:58841604-58841626 GCGCACCTGCCCGCGCGCGCCGG + Intronic
1176194569 20:63831293-63831315 GCGCGCGCGCGCGGGCGGCGGGG - Intergenic
1176238017 20:64063257-64063279 GCCCGCCTCCGCAGCCGGGCAGG - Exonic
1176278214 20:64286480-64286502 GCGCGCCTGCGCCGGCGCGGTGG + Intronic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1178350915 21:31872881-31872903 GCGCGCCTCCGAGGCCGCGCAGG + Intergenic
1178707647 21:34888848-34888870 GCGCGGCGGCGGGGGCGCGCGGG - Intronic
1179563940 21:42234808-42234830 GCGCGCAGGTGCGGGCGGGGCGG + Intronic
1180014688 21:45074532-45074554 GCGGGCCGGCGGGGGCGGGGAGG + Intronic
1180950653 22:19719073-19719095 GGGCGCCTGGGCGCGCGGGCGGG + Intronic
1180960531 22:19760581-19760603 GCGAGCCGCGGCGGGCGGGCTGG + Intronic
1181695985 22:24593011-24593033 GCGCGGCTGGGCCGGCGGGCCGG - Exonic
1181831609 22:25564784-25564806 GCGCGCGTGCGCGGGGCGCCGGG + Intergenic
1182585734 22:31343471-31343493 GCCCGCCTGAGCAGGTGGGCAGG + Intronic
1182586282 22:31345951-31345973 GCGCGCCGGCGCCGCCTGGCGGG - Exonic
1183912900 22:41092268-41092290 CCGCGTCGGCGCGGGCGTGCGGG + Exonic
1184101573 22:42343934-42343956 GGGCGCGGGCGGGGGCGGGCGGG + Intergenic
1184101575 22:42343938-42343960 GCGGGCGGGGGCGGGCGGGCGGG + Intergenic
1184523865 22:45010073-45010095 GTGCGCAGGCGCGGGCGGGGCGG - Intergenic
1184673464 22:46027768-46027790 GCGCGTCTGGGCGGGCGGCCCGG + Intergenic
1185215907 22:49599922-49599944 GCGTGCCTGGGAGGGCCGGCAGG + Intronic
1185349399 22:50326777-50326799 GAGCGCGGGCGCGGGCGGGTGGG - Intronic
1185351740 22:50343237-50343259 GCGGGGCCGCGCGGGTGGGCGGG - Intergenic
1185374307 22:50475021-50475043 GCGCGCCCGGGCGGGCCGGCTGG - Exonic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
949987875 3:9553875-9553897 GCGCTCCCGAGCGGGCGTGCGGG + Intergenic
950012195 3:9731666-9731688 TCGAGCCTCAGCGGGCGGGCGGG + Intergenic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
951611170 3:24494529-24494551 GCGCGCGCGGGCGGGCAGGCGGG - Intronic
951611172 3:24494533-24494555 CCGAGCGCGCGCGGGCGGGCAGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954186243 3:48919061-48919083 GCGCGCCTCCCTGGCCGGGCCGG + Exonic
955368771 3:58333093-58333115 GCGCGGCCCAGCGGGCGGGCGGG + Intronic
960101335 3:113746253-113746275 GCGCGCCGGCGCGCGAGGGGCGG - Exonic
960896911 3:122514936-122514958 GTGCGCCTGCGTGCGGGGGCCGG + Intronic
962520743 3:136195847-136195869 GCGGGCCGCCGCCGGCGGGCGGG + Intronic
964358474 3:155870993-155871015 GCAGGGCTGCGCGGACGGGCTGG - Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
965757420 3:172040317-172040339 CCGCGCCGGCGGGGGCGGTCGGG + Intronic
966355188 3:179071960-179071982 GCGCCCCTGCGCTCGCGGCCAGG - Exonic
967171791 3:186827562-186827584 GTGCGCCTGCGCGAGCGCGGCGG + Intergenic
967859597 3:194141287-194141309 GCGCGCCCGCCGGGGCGGCCCGG + Intergenic
968498551 4:932391-932413 CCGCGCCTGCGCGCGCAGCCAGG - Exonic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
968514244 4:1009753-1009775 GCGTGCCGGCGCGGGAGGCCCGG + Intergenic
968660034 4:1795052-1795074 GCGCGGGGGCGCGGGCGGGGCGG - Intronic
969344802 4:6563847-6563869 GGCTCCCTGCGCGGGCGGGCGGG + Intergenic
970593188 4:17577179-17577201 GTGCGCCCGCGCATGCGGGCGGG - Exonic
973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG + Exonic
973894235 4:55396159-55396181 GCGCCCGTGCGCGGCCGGCCCGG + Exonic
975870651 4:78775993-78776015 GCGCGCCTGCGCGGGTCGCCCGG + Intergenic
976092423 4:81471974-81471996 CCGCGCCTGCCGGGGCGGGGCGG - Intronic
976246779 4:83012746-83012768 GGGCTCCTGGGCGGGCTGGCGGG - Intronic
976595583 4:86892255-86892277 GCGAGCCGGCGCCGGCGGCCTGG + Intronic
981061277 4:140427657-140427679 GTGCGCGTGCGGTGGCGGGCGGG + Exonic
981300806 4:143184711-143184733 CCGCACCTGCGCGGCGGGGCGGG + Intergenic
981504116 4:145481755-145481777 GAGCGTGTGAGCGGGCGGGCGGG + Intronic
981550882 4:145939103-145939125 GCGCGCGTGCGGGGGTGGGATGG + Intergenic
982702353 4:158671471-158671493 GCGCCCCAGAGCGTGCGGGCGGG - Intronic
983238760 4:165207901-165207923 GCGTGAGTGAGCGGGCGGGCGGG + Intronic
984249122 4:177310280-177310302 GCGCGCCTGCGCAGGAGAGGAGG + Intronic
985005863 4:185535223-185535245 GCGCGCGAGGGCGGGCGGACGGG - Intronic
985068389 4:186144822-186144844 CGGCGCCGGCGCGGGCGGGGCGG + Exonic
985068433 4:186144945-186144967 GGGCGCGGGCGCGGGCGGGTGGG + Exonic
985129101 4:186723887-186723909 GAGCGCCGGCGCCGGCGGGCGGG - Intronic
985549188 5:524567-524589 GTGGGCGTGCGCGGGCGGGGCGG - Intergenic
986449581 5:7851058-7851080 GGGCCCCTGGGCGGGCGGGACGG - Exonic
986733154 5:10649721-10649743 GCGGGGCAGCGCGGGCGGACCGG + Exonic
989102337 5:37834817-37834839 CGGCACCTGCGCGGGCAGGCGGG + Exonic
989577347 5:43000611-43000633 GGGAGGCTGCGGGGGCGGGCGGG - Intergenic
990042313 5:51389577-51389599 GCGCGCGACCGCGGGCGGGCCGG + Intronic
991245715 5:64506565-64506587 GCGCCCCGGCGCGGGCGGCCCGG - Exonic
992690390 5:79236027-79236049 AGGCGCCGGCGCGCGCGGGCGGG + Intronic
992837405 5:80654602-80654624 GTGCGCCGGGGCGGGGGGGCGGG - Exonic
993397851 5:87412907-87412929 GCGCGCCAGCGCCGGCTAGCCGG - Exonic
996948114 5:129094530-129094552 GAGCGCCTGCGCTCGCCGGCCGG - Intergenic
997454079 5:134004795-134004817 GCGCGCCGGGCCGGGCGCGCAGG - Intronic
997521385 5:134526340-134526362 GCGAGGGGGCGCGGGCGGGCGGG + Intronic
997584061 5:135034355-135034377 GCGCGGCGGCGCGGGCGGCTTGG - Intronic
997963277 5:138338394-138338416 GCCCGGCCGCGCGGGCGGTCGGG - Intronic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
999129446 5:149271797-149271819 GGGCGCGGGCGCGGGCGGGGCGG + Intergenic
999188293 5:149729159-149729181 GCGGGCCTGCGGAGGCTGGCAGG + Intergenic
999272030 5:150302381-150302403 GCGCGCCGGGACGCGCGGGCCGG - Exonic
1000296403 5:159916623-159916645 GCGCGCCTGGCCGGGCTCGCGGG - Intergenic
1002093517 5:176817939-176817961 GCGGGCGGCCGCGGGCGGGCTGG - Intronic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1003062840 6:2876112-2876134 GTGCGCGTGGGCGGGCGGCCGGG + Intergenic
1003645605 6:7910872-7910894 GCGCGCCGGCGCGGGCGGGCGGG - Intronic
1004587443 6:17016000-17016022 ACGGGCCGGCGCGGGCGGGCCGG + Intergenic
1006717585 6:36130413-36130435 GCGCACCTGGGCGAGCCGGCAGG + Exonic
1011281135 6:85678931-85678953 GTGCGCCTGCGGGCGCGCGCCGG - Intergenic
1014798212 6:125749298-125749320 GGGCGCCAACGCGGGCGCGCGGG - Intronic
1015750031 6:136550223-136550245 CCGCGGCCGCGCGGGCGGGGAGG + Intronic
1016982317 6:149864389-149864411 GCGGGGCCGCGCGGGGGGGCGGG - Intergenic
1018329953 6:162716747-162716769 GCGCGCGCGCGCAGGCGGGTAGG - Intronic
1019348561 7:542530-542552 GCGGCCCTGCCCGGGCTGGCTGG - Intergenic
1019693843 7:2433484-2433506 GCGCGCCGAGGCGGGCAGGCTGG - Exonic
1021510537 7:21428144-21428166 CCGAGCCACCGCGGGCGGGCGGG + Exonic
1021719251 7:23490442-23490464 GCGGGCGGGCGCGGGCGGGCGGG + Intergenic
1021719253 7:23490446-23490468 GCGGGCGCGGGCGGGCGGGCGGG + Intergenic
1023879403 7:44309676-44309698 GCGCTCCTGCCCGGGCGAGGAGG - Intronic
1024323236 7:48089572-48089594 GCGCGGCTGCGCGGGGAGGCGGG + Intronic
1025609840 7:63068357-63068379 GCGCGCCTGGCCAGGCAGGCTGG - Intergenic
1026822319 7:73557757-73557779 GCGCGCCTGCGCGCCCCGCCCGG + Exonic
1029285900 7:99465948-99465970 GCGCGCCTGGGCAGGCGGAGCGG + Intronic
1031010906 7:116525109-116525131 GGGCGCCGGCTCGGGCGTGCGGG + Intronic
1031052061 7:116954151-116954173 TCGGGCCTCCGCGGCCGGGCGGG - Intronic
1032174552 7:129612286-129612308 GCTCTCGTACGCGGGCGGGCGGG + Intronic
1034223065 7:149460381-149460403 GCGCGGCTGTGCGGGCGGCCCGG + Intronic
1034254024 7:149714786-149714808 CCGCGTCTGCGCCGGCCGGCCGG + Intronic
1034478785 7:151303922-151303944 GCGCGCCTGCGCGTACGGCACGG + Intergenic
1034649213 7:152676166-152676188 GCGCACGCGCGCGGGTGGGCGGG - Intergenic
1035221697 7:157410109-157410131 GCGGGCGTGGGCGGTCGGGCGGG + Intronic
1035404022 7:158587094-158587116 GCGCGCCTTGGCGAGCGGGTCGG - Intronic
1036811186 8:11868306-11868328 GGGGGCCTGAGCGCGCGGGCTGG + Intronic
1037481928 8:19313640-19313662 GCGGGGCGGCGCGGGCGGGACGG + Exonic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1039981029 8:42410207-42410229 CAGCGGCTGCACGGGCGGGCGGG + Intergenic
1040038844 8:42896776-42896798 GCGCGGCGGCGCGGGTCGGCCGG + Intronic
1041689907 8:60678738-60678760 GCGCGCAGGCGCTGGCGTGCTGG + Intergenic
1043388276 8:79768390-79768412 GCGCGCCGGCGGGGGCTGGGCGG + Intergenic
1044336035 8:90985405-90985427 GCGCGCTTTCCCGGGCGAGCTGG + Intergenic
1045305269 8:100952198-100952220 GCCCTCCAGCGCGGGCGGGCAGG - Intronic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1047961750 8:130016316-130016338 GGGCGCGCGCGCGGGCCGGCCGG + Intronic
1049109844 8:140635763-140635785 GCGGGGCTGGGCGCGCGGGCGGG + Intergenic
1049179131 8:141212139-141212161 GGGCGGGTGGGCGGGCGGGCGGG - Intronic
1049434222 8:142579114-142579136 GCAGGGCTGAGCGGGCGGGCAGG - Intergenic
1049583425 8:143422687-143422709 GGGTGCCTGGGGGGGCGGGCCGG + Intronic
1049724318 8:144138439-144138461 GGGCGCCCGCGCGGGCGGGGAGG + Intronic
1049844288 8:144792537-144792559 GTGCGCCTGCGCGGGGGCCCTGG - Exonic
1049957507 9:707204-707226 GCGGGGCAGCGCGGGCTGGCGGG + Intronic
1050151421 9:2622284-2622306 GCGCCCCTCCGCCGGCGGGCGGG + Intronic
1051418810 9:16870806-16870828 GCGCGCGCGGGCGGGCGGGGAGG - Intronic
1051418812 9:16870810-16870832 GAGGGCGCGCGCGGGCGGGCGGG - Intronic
1054333332 9:63781653-63781675 CCGCGCCTGCGCCGGCGCTCTGG - Intergenic
1055757747 9:79573148-79573170 GCGCGACTCCGCGCCCGGGCGGG + Intronic
1057146937 9:92764847-92764869 GTGCGGCGGCGCGGGCGGGCGGG - Intergenic
1057294652 9:93828064-93828086 GCGGCCCAGGGCGGGCGGGCGGG + Intergenic
1057432227 9:95004935-95004957 GGGCGGCGGCGCGGGCGGGCGGG - Intronic
1057596097 9:96417583-96417605 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
1058058519 9:100473125-100473147 GCGCCCCTCACCGGGCGGGCCGG + Exonic
1059102505 9:111483946-111483968 GCGAGCGAGCGAGGGCGGGCGGG - Intronic
1059145645 9:111897029-111897051 GCGCGCGGGCGGGGGCGCGCAGG + Exonic
1060757190 9:126222658-126222680 ATGCGTCTGCGCGTGCGGGCAGG + Intergenic
1061096132 9:128457454-128457476 AGGCGCCTGCGCCGGAGGGCAGG + Intronic
1061290400 9:129647482-129647504 GCCAGCCTGGGCGGGTGGGCGGG - Intergenic
1061293430 9:129665282-129665304 GTCGGCCAGCGCGGGCGGGCGGG + Intergenic
1061365873 9:130172309-130172331 GCGCGCGGGTGCGGGCGGGAGGG + Intergenic
1061453490 9:130681578-130681600 GGGCGCGTGCGCGTGCGGGGCGG - Exonic
1061859353 9:133460213-133460235 GAGCGCATGCGCGGCGGGGCCGG - Intronic
1062340995 9:136094024-136094046 GTGCGGCCGCGCTGGCGGGCGGG + Intronic
1062349852 9:136133309-136133331 GCGCGGCTGCGGGGCGGGGCGGG - Intergenic
1062364398 9:136202091-136202113 GCTGGCCGGAGCGGGCGGGCTGG - Intronic
1062584217 9:137241687-137241709 GCGGGCGGGCCCGGGCGGGCCGG - Intronic
1062620375 9:137417821-137417843 GGGCGCCTGCGGGGGAGGCCGGG + Intronic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1187163919 X:16787154-16787176 CCGCCACTGCGCGGGCGGGCAGG + Intronic
1188542656 X:31266957-31266979 AGGAGCCGGCGCGGGCGGGCCGG + Intronic
1189335580 X:40168919-40168941 GCCGGCCAGGGCGGGCGGGCGGG - Intronic
1191717697 X:64204847-64204869 GCCCGCCCCCGCGGTCGGGCAGG - Intronic
1192561734 X:72131844-72131866 GCGCGACCGGGCGGGCGGGCGGG + Intronic
1198177802 X:134172874-134172896 GCGCGCATGCGCGCGCCGGGTGG - Intergenic
1199967243 X:152830776-152830798 GCGGGGCTGCGCGCGCGGGGCGG - Exonic
1200084939 X:153599323-153599345 CTGCGCCTGCGCGCGCGGCCAGG - Intronic