ID: 917144166

View in Genome Browser
Species Human (GRCh38)
Location 1:171870044-171870066
Sequence GTCCATTGAAGAACTAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917144166 Original CRISPR GTCCATTGAAGAACTAGCCA TGG Intronic
900394099 1:2446114-2446136 GTCCACTGCAGTCCTAGCCAGGG + Intronic
902774979 1:18668908-18668930 GTCCAAACAAGAACCAGCCAGGG - Intronic
904338659 1:29815958-29815980 GTCCAATCAAGAAGTAGACATGG - Intergenic
904588010 1:31590765-31590787 GTCCACTGCAGAACTGGCCCAGG - Intergenic
911583222 1:99659373-99659395 GTCCATTGAACAAAAAGTCAAGG + Intronic
916064853 1:161128125-161128147 GTACATTGATGATCTAGCCTGGG - Intronic
916507487 1:165441249-165441271 GGCCATTGAGGAATAAGCCATGG - Intronic
917144166 1:171870044-171870066 GTCCATTGAAGAACTAGCCATGG + Intronic
919147240 1:193651279-193651301 GTACCTTGCAGTACTAGCCACGG - Intergenic
919794494 1:201313156-201313178 TTCCATTGTAGATCTGGCCAGGG - Exonic
921513300 1:216058953-216058975 GTCTATTGAAGAAATAGCATGGG + Intronic
924013318 1:239691284-239691306 GTGCAGTGAAGAACTTGCAATGG + Intronic
924523376 1:244824698-244824720 GTTCCTTGAAGAAATGGCCAGGG + Intergenic
924804862 1:247354120-247354142 GACCAATGAAGAACTAGCGGAGG + Intergenic
1066393084 10:34994574-34994596 GTCCATTGAATAGCTTGCCAAGG - Intergenic
1067932560 10:50577304-50577326 GTCCATTAAAGACATAGACAAGG - Intronic
1068475499 10:57518649-57518671 GTCCATTAAAAAACTAGCATAGG - Intergenic
1071906155 10:90176077-90176099 GTGCATTTCAGAACTAGTCATGG - Intergenic
1076415677 10:130286580-130286602 GTCCTTTGAAGATATGGCCATGG - Intergenic
1077765349 11:5153427-5153449 GTCAAATGTAGAACTAGACAGGG + Intronic
1081434677 11:43014093-43014115 GTCCATTGATGGCCTATCCAAGG - Intergenic
1090587233 11:128226372-128226394 TTCCATAGAAGTACTAGCAAAGG - Intergenic
1092255346 12:6924075-6924097 TTCCATTCGAGAACCAGCCAGGG - Intergenic
1096792913 12:54056159-54056181 GTCCTTAGAAGAACAAGCAAGGG + Intergenic
1100029642 12:90170289-90170311 GTTCTTGGTAGAACTAGCCAGGG + Intergenic
1107604345 13:42042847-42042869 GTCCATCGAAGAACTAATGAAGG + Intronic
1108136827 13:47373218-47373240 GTTCATTGAAGAGTTTGCCAAGG - Intergenic
1109037921 13:57289622-57289644 GTCCATTTAATGACTAGCAAAGG + Intergenic
1116680625 14:47965470-47965492 ATCTATAGAAGAATTAGCCAAGG - Intergenic
1120064556 14:80025553-80025575 CTCCATTGAAGTACTCACCATGG + Intergenic
1122472485 14:101980108-101980130 GTCCAGTGCAGGACTAGCCTTGG + Intronic
1127222129 15:56890975-56890997 GTCCATTACAGACATAGCCATGG - Intronic
1130131018 15:81142778-81142800 AACCAGTGAAGAACTAGCAAAGG + Intronic
1131735066 15:95323383-95323405 CTCCATGGAAGAAATAGGCAAGG - Intergenic
1132279852 15:100602965-100602987 CTCCATTGAAGAAATACCCCAGG - Exonic
1134298216 16:12965874-12965896 TTTCATTGAAGAAATAGCAAAGG + Intronic
1137925393 16:52535692-52535714 GGCCATTGAAGAAATGGTCAAGG - Intronic
1138750834 16:59418654-59418676 CTCAATTGAAGAATTAACCAAGG - Intergenic
1139360848 16:66399008-66399030 CTCAGTTCAAGAACTAGCCAAGG + Intronic
1139724000 16:68881209-68881231 GTCTATTGAAGAAGTTGACATGG + Intronic
1140572245 16:76121076-76121098 GTCCTTTGAAGAACTATGGAAGG - Intergenic
1141314722 16:82951069-82951091 GGCCATTGAAGATTGAGCCAAGG - Intronic
1141338196 16:83177300-83177322 TACCTTTGAAGAACTAGCGAGGG - Intronic
1143981379 17:10873144-10873166 GTCCAGGAAAGAACCAGCCATGG - Intergenic
1148337804 17:46852807-46852829 CTGCTTTGAAGAAGTAGCCAGGG + Intronic
1149300705 17:55302672-55302694 GTCAGTTTAATAACTAGCCATGG + Intronic
926341395 2:11907538-11907560 GTCCTTTAATGAACTAGCCCAGG - Intergenic
930784919 2:55262334-55262356 GACTATTGAGGAACTGGCCAGGG - Exonic
943817514 2:192275272-192275294 TTCCACTGAATAACTAGCCAGGG - Intergenic
1173288872 20:41696911-41696933 GGCCCTTGAAGACCTAGCCCAGG - Intergenic
1175467897 20:59204939-59204961 GTCCTTTGAAGACATTGCCAAGG + Intronic
1176664645 21:9674257-9674279 ATGCATTGAAAAACTACCCAGGG - Intergenic
1177742767 21:25173844-25173866 GTACAGTGAAGAACTTGCCCAGG - Intergenic
1180302733 22:11050451-11050473 GTACAATGAAGAACTGGCCCAGG + Intergenic
951561612 3:23972664-23972686 GTGCAATGAAGAACCAGCTAAGG + Intronic
951633786 3:24750619-24750641 CACCATTGAAGACATAGCCATGG - Intergenic
954082961 3:48223347-48223369 GTCCTGTGAAGCAATAGCCAGGG + Exonic
954168741 3:48782339-48782361 ATTCCTTGAAGAATTAGCCATGG - Intronic
955112841 3:55966220-55966242 GTCCATTGAGGAAATAGGCTTGG - Intronic
959560520 3:107774427-107774449 TTCCATTCAAAAACCAGCCAAGG - Intronic
959877324 3:111399883-111399905 GTGCATTGAAGAAATAGAGATGG - Intronic
963300572 3:143592860-143592882 ATCTTTTGAAGATCTAGCCATGG - Intronic
964892040 3:161548738-161548760 TTTCATTGAAGTACTGGCCATGG - Intergenic
968208335 3:196824688-196824710 GCCCATGGAACAACTAGGCACGG + Intronic
970449232 4:16150549-16150571 TTCCATATAAGAAATAGCCATGG - Intergenic
985410118 4:189674916-189674938 ATGCATTGAAAAACTAGCCAGGG - Intergenic
986124805 5:4875065-4875087 CTCCATGGGAGAACTGGCCAAGG + Intergenic
994345445 5:98680170-98680192 ACCTATTGGAGAACTAGCCATGG + Intergenic
994945880 5:106390944-106390966 AACTATTGAAGAATTAGCCAAGG + Intergenic
998866010 5:146503518-146503540 GTACATTGAAAAAATAGCCAAGG + Exonic
1003416265 6:5911146-5911168 TTCCAGGGAAGAACTAGCCAGGG + Intergenic
1005727859 6:28667378-28667400 GACCTTTGAAGAACTAGCTGTGG + Intergenic
1011167538 6:84465976-84465998 ATACATTGAAGAGCTAGCCAGGG - Intergenic
1012649037 6:101729428-101729450 CTCCATGGAACAATTAGCCAAGG - Intronic
1016294915 6:142563971-142563993 CTCCATTCAAAAACTGGCCAAGG + Intergenic
1016899905 6:149091124-149091146 GTCTATATAAGAAATAGCCACGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033946736 7:146727883-146727905 GTCCATTGAAGTACTACTCATGG + Intronic
1037534344 8:19810888-19810910 GTCCATGGAAAGAATAGCCATGG + Intergenic
1045346352 8:101297367-101297389 TTCCATTGAATGACTAGCCCTGG + Intergenic
1054976450 9:71152010-71152032 ATCGATTGAAAAACAAGCCAGGG - Intronic
1059063039 9:111053458-111053480 TTCCATTGAACTACAAGCCATGG + Intergenic
1059719665 9:116947072-116947094 GTCCCTTGAAGAAATATCAAGGG - Intronic
1060778938 9:126397793-126397815 TTCCATTGAAGACCTAGGAAAGG + Intronic
1061834054 9:133317620-133317642 CTCCATTGCAGAACTGGCCGTGG + Intergenic
1062096089 9:134704461-134704483 TTCCCTGGAAGAACAAGCCAGGG - Intronic
1203661454 Un_KI270753v1:47491-47513 ATGCATTGAAAAACTACCCAGGG + Intergenic
1203672639 Un_KI270755v1:30564-30586 ATGCATTGAAAAACTAGCCAGGG + Intergenic
1189419254 X:40841939-40841961 CTCAATTGAAGAAGTAGCAATGG - Intergenic
1190745458 X:53319797-53319819 GGACTTTGAGGAACTAGCCAAGG + Intronic
1196238622 X:113312828-113312850 GTCCATGGGAAAACTAGACACGG + Intergenic
1198661628 X:138975113-138975135 TTCCATTGAAAAATCAGCCAAGG - Intronic