ID: 917145426

View in Genome Browser
Species Human (GRCh38)
Location 1:171885562-171885584
Sequence TCTTAGGCCTAAAATTTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917145424_917145426 -2 Left 917145424 1:171885541-171885563 CCTATGTGATGCGGGCTGCTTTC 0: 1
1: 0
2: 1
3: 3
4: 75
Right 917145426 1:171885562-171885584 TCTTAGGCCTAAAATTTTAGAGG 0: 1
1: 0
2: 1
3: 9
4: 174
917145423_917145426 5 Left 917145423 1:171885534-171885556 CCTTAAACCTATGTGATGCGGGC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 917145426 1:171885562-171885584 TCTTAGGCCTAAAATTTTAGAGG 0: 1
1: 0
2: 1
3: 9
4: 174
917145420_917145426 21 Left 917145420 1:171885518-171885540 CCAGGAATAGAATCATCCTTAAA 0: 1
1: 0
2: 2
3: 23
4: 213
Right 917145426 1:171885562-171885584 TCTTAGGCCTAAAATTTTAGAGG 0: 1
1: 0
2: 1
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917145426 Original CRISPR TCTTAGGCCTAAAATTTTAG AGG Intronic
908496302 1:64698589-64698611 TCTTAGGCCTAGTACTTTTGGGG + Intergenic
909808050 1:79895808-79895830 TCTTAGGCCTGAATTATGAGTGG - Intergenic
910464221 1:87479579-87479601 TCTTTGCCCTAAAATCTTAATGG + Intergenic
911959777 1:104286372-104286394 GTTTAGGCCTATAGTTTTAGAGG + Intergenic
912200689 1:107454455-107454477 TCATAGGCCTAAGATGTTAACGG + Intronic
914359042 1:146914669-146914691 TCTCTGTCCTAAAATCTTAGTGG + Intergenic
914494703 1:148185207-148185229 TCTCTGTCCTAAAATCTTAGTGG - Intergenic
916875759 1:168966795-168966817 TTCTAGGCCTAAACTTTAAGAGG - Intergenic
916945297 1:169720183-169720205 TCTTAGCCTTAGAATTTTGGGGG + Intronic
917145426 1:171885562-171885584 TCTTAGGCCTAAAATTTTAGAGG + Intronic
917576493 1:176326910-176326932 TCTTAGGCTTAATTCTTTAGTGG + Intergenic
917630791 1:176889441-176889463 TCTTTGGTCTAAAATTTTCAAGG - Intronic
919595230 1:199553173-199553195 TCCTAGGTCTAAAGTTTTAATGG + Intergenic
920383677 1:205551489-205551511 TCTGATGCCTATATTTTTAGAGG - Intergenic
920717693 1:208356219-208356241 TCTTTGGTCTTACATTTTAGAGG - Intergenic
923345266 1:233045490-233045512 TATTAGGCCCCAAATTTCAGTGG - Intronic
923512399 1:234663901-234663923 TCTAAGGCCTAAACTCTCAGAGG + Intergenic
1063513566 10:6671433-6671455 TTCTAGGCCTAAAATTTAACTGG + Intergenic
1063774986 10:9252698-9252720 TTTTAAACCTAAAATTATAGTGG - Intergenic
1064804939 10:19120038-19120060 CCTCAGGCCCAAAATTTTTGTGG - Intronic
1070315455 10:75307024-75307046 TATTAGGCCTGAAATTTCACTGG + Intergenic
1072077502 10:91992000-91992022 TTTTAGGCCTCAACTTTTATAGG - Intronic
1077707816 11:4504959-4504981 TATTAGGCCTTAAATTTATGAGG + Intergenic
1080070301 11:28076061-28076083 TCTAAAGCCTGAAATTTCAGTGG - Intronic
1080137270 11:28870468-28870490 TCTTCAGCCTAAAACATTAGAGG + Intergenic
1080872951 11:36252691-36252713 TCTTGGGCACAAAATTTAAGGGG + Intergenic
1081052435 11:38361252-38361274 TCTTAGGACTATAATTTTCATGG + Intergenic
1085335684 11:75692577-75692599 TCTCAAACGTAAAATTTTAGAGG - Intergenic
1085947773 11:81292482-81292504 TCTCAGGCATAATATTTTAGTGG + Intergenic
1086027338 11:82309716-82309738 TCATAGGTCTTAAATTTTACTGG + Intergenic
1086141060 11:83500928-83500950 TCATAAGCCTAAAATTGTATAGG + Intronic
1086374609 11:86187591-86187613 TTTGAGGCATAAAAATTTAGTGG - Intergenic
1086602649 11:88653584-88653606 TCTTAGGCCCAAAATTTCCATGG - Intronic
1087318721 11:96634717-96634739 TCGTAGGGCTTATATTTTAGTGG - Intergenic
1091324438 11:134675748-134675770 TTTTAAGACTATAATTTTAGAGG + Intergenic
1092463322 12:8705786-8705808 TCTTGGGTCTGAAATTTTTGGGG + Intronic
1092485463 12:8898838-8898860 TCTTAGGCCAAAAACTTTGGAGG + Intergenic
1092711347 12:11340683-11340705 TGTTCTTCCTAAAATTTTAGTGG + Intergenic
1092758540 12:11788099-11788121 TCTTAGGCTTAATCTTTTAATGG - Intronic
1092766963 12:11861580-11861602 TCTTAAGCCAGAAGTTTTAGGGG + Intronic
1094794581 12:33956290-33956312 TTTTAGGCCTAAAAACTTATGGG - Intergenic
1095286711 12:40420833-40420855 TCTTAGTCCATAATTTTTAGAGG + Intronic
1095927994 12:47598175-47598197 TCTTATCCTAAAAATTTTAGTGG + Intergenic
1096643817 12:53016926-53016948 TTTTAGGTCTAAAATTCTATGGG + Intronic
1097433767 12:59536634-59536656 TATTATCCCTAACATTTTAGTGG + Intergenic
1098644932 12:72887070-72887092 TCTTATGTCTAGAATTTTACTGG - Intergenic
1098646265 12:72905311-72905333 TCCTAGGGCTCATATTTTAGAGG - Intergenic
1101372607 12:104142984-104143006 TCATAGGGCTTACATTTTAGTGG - Intergenic
1104548776 12:129736741-129736763 TCTTAGGCCTAAATATTCAGAGG + Intronic
1108182545 13:47855101-47855123 TCTTAGGTTTCTAATTTTAGAGG - Intergenic
1109648395 13:65291705-65291727 TCTTAAGCCTAATATTTTCATGG + Intergenic
1109703190 13:66053826-66053848 TCTTAGGCCTGAAAATTGAGTGG - Intergenic
1109966322 13:69701955-69701977 TTTTAGGCCTACAATTTTTATGG + Intronic
1112051669 13:95649360-95649382 TCTTAGGCCTCAAGATTTGGTGG - Intergenic
1114296221 14:21331578-21331600 CCTTAGGCATAAAATTTGAAGGG - Intronic
1115047865 14:29019846-29019868 GCTTAGACCTAAAGTTTGAGAGG + Intergenic
1115361240 14:32505395-32505417 TCTCAGGCACAAAATTTAAGAGG + Intronic
1116082262 14:40189688-40189710 TCTTTGGCCTAACATTTTCAGGG - Intergenic
1124110287 15:26779221-26779243 TCTTAGGACTAAACTTTTCCAGG - Intronic
1125528308 15:40393625-40393647 TCTTGGGCATAAAATCTCAGAGG + Exonic
1125799033 15:42428288-42428310 TCTTAGGCCTCATATTTCAAAGG - Intronic
1127048746 15:55057261-55057283 TCTTAGGGCTCAAAATATAGAGG - Intergenic
1129809000 15:78491228-78491250 TCATGAGCCTAAAATTTTATAGG + Intronic
1133141163 16:3745775-3745797 TCTTAAGTCTAAAATTGTTGAGG + Intronic
1135929063 16:26721303-26721325 TATCAGTCCTAAAATGTTAGAGG + Intergenic
1138274964 16:55727779-55727801 TCTTAGGGGTAAAATCTTTGTGG - Intergenic
1141427034 16:83951308-83951330 CCTCAGGCACAAAATTTTAGGGG + Exonic
1142736621 17:1904721-1904743 CCATTGGCCTAAAATTTTAGAGG + Intergenic
1148258874 17:46161668-46161690 ACTTAGGCCTAAAAGAATAGAGG - Intronic
1154050704 18:10954060-10954082 TGTAAGGCCTAAAATTTCACAGG - Intronic
1159494321 18:69181005-69181027 TGTTGGGCACAAAATTTTAGAGG - Intergenic
1163962031 19:20705667-20705689 TCTTATGGATAAAATTTAAGGGG - Intronic
1164003269 19:21126030-21126052 TTTTAGGCCTTACATTTAAGTGG + Intergenic
1166126619 19:40718569-40718591 CCTTAGTCCTACAATTTCAGGGG - Intronic
1167718494 19:51160448-51160470 TTTTATGCCTAAAAATTTGGGGG - Intergenic
1168321951 19:55516075-55516097 ACTCAGGCCCAAAATTTAAGGGG + Intronic
928344970 2:30483807-30483829 TCTCAAGCCTTAAATTTTATGGG + Intronic
928894906 2:36249844-36249866 TTTTAGGCCCTAAATTTTGGAGG - Intergenic
932469565 2:71945039-71945061 TCTTTGGAGTATAATTTTAGAGG - Intergenic
935188049 2:100751954-100751976 TCTTTGCCCTTGAATTTTAGTGG - Intergenic
938890506 2:135700068-135700090 TCTTTGTGATAAAATTTTAGAGG - Intronic
939204294 2:139080302-139080324 TCTTAGGCCTAAAAATGTTCAGG + Intergenic
939712508 2:145540605-145540627 TCCTAGGGCTAGAATTTCAGTGG + Intergenic
939885902 2:147681558-147681580 TCTTAGAGCTTATATTTTAGTGG - Intergenic
941140868 2:161779696-161779718 TCCTTGGCATAAGATTTTAGAGG - Intronic
942825196 2:180167302-180167324 TCTTAAACCTAATTTTTTAGGGG + Intergenic
942847602 2:180445063-180445085 ACTTTGCCCTAAAATTTCAGGGG + Intergenic
944671404 2:201997242-201997264 ACTTGGGCATAAATTTTTAGAGG + Intergenic
944780610 2:203013622-203013644 TCAGTGTCCTAAAATTTTAGTGG - Intronic
948346306 2:237301526-237301548 TCTTAGGCATAAAATTTAAGGGG + Intergenic
1170544683 20:17425627-17425649 TCTTGGCCCTGAAATATTAGTGG + Intronic
1171136436 20:22699077-22699099 TCTTTGGCATAAAATTTTTAAGG - Intergenic
1174941491 20:54933832-54933854 TTTTAGGTCTAACATTTAAGTGG - Intergenic
1176005197 20:62858468-62858490 ACTTTGGCATAAAATTTTATAGG + Intronic
1177623262 21:23624660-23624682 ACTTGGGCCAAAAATTTGAGGGG - Intergenic
1178112281 21:29380719-29380741 TCTTATTCCTATAATTTTAGAGG - Intronic
1179085071 21:38208850-38208872 ACTTATGCATATAATTTTAGAGG + Intronic
1179331255 21:40404337-40404359 TCTTAGATCAAAGATTTTAGAGG + Intronic
950658766 3:14453628-14453650 TCTTGGGACTGACATTTTAGTGG + Intronic
951975858 3:28507772-28507794 TATTAGGCCTATTATTTTTGTGG + Intronic
954061033 3:48067532-48067554 TCTTAGGTTTAAAAATATAGAGG + Intronic
955440011 3:58945488-58945510 TCTTACAACTAAAATTTTGGAGG + Intronic
955505154 3:59625329-59625351 TCTTGGGCACAAAATTTAAGGGG - Intergenic
957187410 3:76960144-76960166 TCTTAGGACAAAAACCTTAGAGG + Intronic
957326239 3:78698990-78699012 TCTTAGGACTATAATTTTGATGG + Intronic
958146798 3:89634962-89634984 TCTTAGGCCTAGATTTCTATTGG - Intergenic
959342809 3:105151909-105151931 TCTTATGCCTTAAATTTTAAGGG + Intergenic
960400933 3:117197866-117197888 GCCTAGGACTAAAATTTTAATGG + Intergenic
960556716 3:119038087-119038109 TTTTAGAAGTAAAATTTTAGAGG + Intronic
961432468 3:126892742-126892764 TTTTAGGCCTCAAATCTAAGAGG - Intronic
961674576 3:128556646-128556668 TCTTAGGACCCAATTTTTAGAGG + Intergenic
961950265 3:130742358-130742380 TCATAGGTTTAAAATTTCAGTGG - Intronic
962150159 3:132883956-132883978 TCCTAGGCCCCACATTTTAGAGG - Intergenic
964986149 3:162742047-162742069 TCCTAGGCACCAAATTTTAGGGG - Intergenic
966206330 3:177410277-177410299 CCTTAGGTGCAAAATTTTAGGGG - Intergenic
967674446 3:192279139-192279161 TCTTATGCATAAATTTTTAAAGG + Intronic
968718442 4:2179570-2179592 CCTTAGGTCTATAATTTGAGAGG - Intronic
970434068 4:16015894-16015916 TCCTAGGCCTCAGAATTTAGTGG - Intronic
972150253 4:36080610-36080632 TCTCAGGCTCAGAATTTTAGTGG - Intronic
972521933 4:39866812-39866834 TCTTAGTGCTGAAATTTTGGTGG - Intronic
975188569 4:71432660-71432682 ACTTAGGGCTAAGAATTTAGTGG - Intronic
976843719 4:89462422-89462444 TTATAGGCATAATATTTTAGAGG + Intergenic
979955196 4:126944379-126944401 TCTTAGTCCTAAAATTTATGAGG + Intergenic
980827782 4:138092642-138092664 TCTTAGACCTATAATATTTGAGG - Intergenic
981246592 4:142547850-142547872 TCTTAAGACTAAAATATTATGGG + Intronic
981581603 4:146254162-146254184 TCTTAGTATTAAAATTTTTGTGG - Intronic
981947015 4:150359641-150359663 TCTAAGGCTGAGAATTTTAGTGG + Intronic
982581490 4:157185189-157185211 ACTTATCCCTAAAATTTAAGAGG - Intergenic
984379472 4:178972016-178972038 ACTTATGCTTAAAATTTTACAGG - Intergenic
986928823 5:12794233-12794255 TCTCAGGCCCAAAATCCTAGGGG + Intergenic
987804324 5:22743371-22743393 TATTAAGCATAAAATCTTAGGGG + Intronic
990281257 5:54253278-54253300 TCTTGGGCCTGAAAATTTAAAGG + Intronic
990493991 5:56328629-56328651 TCTTAGAGCTAACAATTTAGTGG - Intergenic
990973855 5:61540116-61540138 TGTTAGGGTTAAATTTTTAGAGG + Intronic
993602545 5:89946527-89946549 TATTAGGTATAAAAGTTTAGAGG - Intergenic
993811962 5:92491191-92491213 TCATGGGCCTTATATTTTAGTGG + Intergenic
994014045 5:94944494-94944516 CCTTAGGCTTAAAATCTTGGGGG + Intronic
994715727 5:103319276-103319298 TCTTAGAACTAAAAATTTAGAGG + Intergenic
996563290 5:124853693-124853715 TCTCAGGCCCACAATTTCAGTGG - Intergenic
997170737 5:131717494-131717516 TTTTAGGTCTAAAATATGAGGGG - Intronic
998700452 5:144692888-144692910 TCTAATTCCTTAAATTTTAGAGG + Intergenic
998807001 5:145927765-145927787 TTTTAGGTCTAACATTTAAGAGG - Intergenic
998877987 5:146619569-146619591 TGTAAGGCCTAAATTTTTTGAGG + Intronic
999927351 5:156393240-156393262 TCTAAGACCTCAAATGTTAGGGG + Intronic
1000309986 5:160033104-160033126 TCTTAAGCAAAAAACTTTAGGGG - Intronic
1003389645 6:5702800-5702822 TCTTAGTCCTAAATGTTTGGGGG - Intronic
1003941580 6:11033421-11033443 TCTTAAGGGTAAATTTTTAGGGG + Intronic
1004034686 6:11912101-11912123 TCTGTGCCCAAAAATTTTAGGGG - Intergenic
1004771085 6:18782914-18782936 ACTTTGGTATAAAATTTTAGTGG - Intergenic
1004818785 6:19342541-19342563 TTTTAAGCCTATCATTTTAGTGG - Intergenic
1006198627 6:32265247-32265269 TTTTAGGTCTAACATTTAAGAGG + Intergenic
1006944604 6:37777221-37777243 CCTCAGGCATCAAATTTTAGGGG - Intergenic
1009358900 6:62789647-62789669 GATTAAGCCTCAAATTTTAGAGG - Intergenic
1013492078 6:110657743-110657765 ACTTAAGCATAAAGTTTTAGTGG - Intronic
1017835439 6:158173334-158173356 TCTTAGGCCCAAAATCTTTTTGG - Intronic
1020531381 7:9341495-9341517 TCCAAGGCCCAAAATTTTATTGG - Intergenic
1026039698 7:66857382-66857404 TTTTAGGCCTGAGATTTTTGTGG + Intergenic
1026617859 7:71923068-71923090 TCTTAGGCCTGGAAATTAAGAGG - Intronic
1027953619 7:84851729-84851751 TCTCAGGCAGGAAATTTTAGGGG + Intergenic
1028438707 7:90834089-90834111 TCTTAGGCTCAAAATATCAGTGG + Intronic
1030711880 7:112759152-112759174 TCTTAGGCATCAAATTCAAGGGG + Intergenic
1033022730 7:137742795-137742817 CATTATGCATAAAATTTTAGTGG - Intronic
1034404224 7:150891633-150891655 TTTAAGGCCTAAAATTTCATAGG + Intergenic
1036140100 8:6199707-6199729 TCTTAGACCAAAATTTTCAGAGG + Intergenic
1043408034 8:79959664-79959686 TTTTAGGACTAAAATTTCTGTGG - Intronic
1045057459 8:98382003-98382025 TCTTGGGCACAAAATTTAAGTGG - Intergenic
1045623194 8:104006881-104006903 TCTGAGGCTGAAAATTTTAAAGG + Intronic
1046072512 8:109274979-109275001 ACTTATCCCTAAAATTTTTGAGG - Intronic
1047872718 8:129103041-129103063 TCTTAACCCTAAAATTCTATGGG + Intergenic
1048103246 8:131378498-131378520 TTTTAGGCCTATAACTTCAGAGG + Intergenic
1048381855 8:133872208-133872230 TTTTTGGCCTACAATCTTAGAGG + Intergenic
1048704665 8:137139728-137139750 TCTTAAGCCTCAAATTCTAATGG + Intergenic
1048950537 8:139493044-139493066 TCATAGAACTTAAATTTTAGTGG - Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1051718102 9:20006732-20006754 TCTAAAGTCTGAAATTTTAGGGG + Intergenic
1051980428 9:23008038-23008060 TAGTAGGCCAAAAATTTTACAGG - Intergenic
1052190500 9:25656191-25656213 TCTTCGGCCTGAAATGTTAAGGG + Intergenic
1052572497 9:30244568-30244590 TCATAGACCTTAAATTCTAGTGG + Intergenic
1060169187 9:121447005-121447027 TTTTAGGGATAAGATTTTAGAGG + Intergenic
1061646861 9:132010193-132010215 TTTTAGGTCTAACATTTAAGTGG + Intronic
1187109526 X:16282495-16282517 TCTTGGGCCCAAAATGTCAGTGG + Intergenic
1198930027 X:141846325-141846347 TCTTAGGCCAGCAAGTTTAGAGG - Intronic
1199301546 X:146219811-146219833 ACTCAGGCACAAAATTTTAGGGG + Intergenic
1199510190 X:148613101-148613123 TCTATGGCCTAATATATTAGGGG - Intronic
1200747990 Y:6919186-6919208 TTATAGTCCTAAAATTTAAGAGG - Intronic