ID: 917146503

View in Genome Browser
Species Human (GRCh38)
Location 1:171897451-171897473
Sequence AGGTCTATCCTTGACATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917146503_917146505 1 Left 917146503 1:171897451-171897473 CCACAAATGTCAAGGATAGACCT 0: 1
1: 0
2: 2
3: 7
4: 185
Right 917146505 1:171897475-171897497 TAATGAGTAGAACAGATGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 205
917146503_917146506 2 Left 917146503 1:171897451-171897473 CCACAAATGTCAAGGATAGACCT 0: 1
1: 0
2: 2
3: 7
4: 185
Right 917146506 1:171897476-171897498 AATGAGTAGAACAGATGTCAGGG 0: 1
1: 0
2: 4
3: 44
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917146503 Original CRISPR AGGTCTATCCTTGACATTTG TGG (reversed) Intronic
902057334 1:13612509-13612531 ACTTCTATCAGTGACATTTGGGG + Intronic
902953596 1:19908078-19908100 GGATCTTTCCTTAACATTTGGGG + Exonic
906588249 1:47000064-47000086 AGGTCCCTCCTTGACACATGGGG - Intergenic
909794874 1:79720434-79720456 TGGTCTTTCCTTGACACGTGAGG + Intergenic
917146503 1:171897451-171897473 AGGTCTATCCTTGACATTTGTGG - Intronic
917267513 1:173236962-173236984 GGCTCTACCCTTGACATGTGGGG - Intergenic
917310319 1:173671431-173671453 AGTTCTATGCATGACACTTGAGG - Intergenic
921635174 1:217483590-217483612 AGGTCTATGTTTAACATTTTAGG + Intronic
921713746 1:218397995-218398017 TTGTCTGTCCTTGACAATTGTGG + Intronic
923105531 1:230850902-230850924 AGGTCTATCTGTGACTTTCGGGG - Intronic
924581561 1:245328466-245328488 AGCTCTATGCTTGACATATCTGG - Intronic
1063789368 10:9424360-9424382 AGGCCTATCCCTAGCATTTGAGG - Intergenic
1064628021 10:17281607-17281629 TGGTCCATCCTTGACACATGGGG - Intergenic
1064821403 10:19338554-19338576 AGGTCCCTCCCTGACATGTGGGG + Intronic
1065136267 10:22673400-22673422 AGGTCTACCTTTGACTGTTGTGG - Intronic
1066514312 10:36139752-36139774 CTCTCTATCCTTGACCTTTGGGG + Intergenic
1070597861 10:77845272-77845294 TGGTCTAGCCTGGGCATTTGAGG - Intronic
1071704629 10:87983712-87983734 ATGTCTATTTTTGATATTTGGGG - Intergenic
1073926227 10:108519531-108519553 TGGTCTTCCCTTGACATGTGGGG - Intergenic
1074221321 10:111441081-111441103 ATGCCTGTCCTTGAAATTTGCGG + Intergenic
1074895970 10:117778051-117778073 AGATCTGTCTTTGACAATTGTGG + Intergenic
1078908138 11:15706425-15706447 AGGCCCATCCCTAACATTTGTGG + Intergenic
1079325350 11:19486438-19486460 GGGTCCCTCCATGACATTTGGGG - Intronic
1079635407 11:22732822-22732844 ATTGCTATCCTTCACATTTGTGG + Intronic
1080815311 11:35750264-35750286 TGGTCTCTCCTCCACATTTGAGG + Intronic
1082636286 11:55598244-55598266 TGGTCTATCCTAGCCAGTTGCGG + Intergenic
1082860930 11:57856019-57856041 AAGTCAATCCTTGGCCTTTGAGG + Intergenic
1083010012 11:59388132-59388154 AAGTCTATCCTTGTGATGTGGGG + Intergenic
1086024603 11:82275075-82275097 TTGTCTATGTTTGACATTTGAGG + Intergenic
1086741972 11:90379791-90379813 AGCTCTGTCCTTAACATGTGTGG + Intergenic
1086755403 11:90555742-90555764 ATGTCTATCTCTGACATTTTGGG + Intergenic
1091812378 12:3410137-3410159 AATTCTCTCCTTGAAATTTGAGG + Intronic
1092984366 12:13831368-13831390 AGCTCTGTCATTGTCATTTGGGG - Intronic
1093308543 12:17548542-17548564 AATTCTATCCTTAACTTTTGTGG + Intergenic
1095687987 12:45057265-45057287 AGGTCTTGCCTTGACATTGATGG + Intergenic
1098500926 12:71190739-71190761 ATGTCTATCATTGTCATGTGTGG - Intronic
1098965423 12:76783019-76783041 ACGTCAACCCTTGCCATTTGGGG - Intronic
1099500913 12:83413384-83413406 AGGCCTGTCCTTGACACATGAGG + Intergenic
1099604253 12:84782194-84782216 TGGATTATCCTTGACCTTTGGGG - Intergenic
1100335242 12:93623108-93623130 AGGCCCTTCCCTGACATTTGGGG - Intergenic
1100809405 12:98323886-98323908 GGTCCTGTCCTTGACATTTGGGG - Intergenic
1101635701 12:106539677-106539699 AGGTTCCTCCTTGACATGTGGGG + Intronic
1102573067 12:113839296-113839318 AGGCCTATTCTGAACATTTGAGG + Intronic
1102921813 12:116797144-116797166 AGTTCAATCCATAACATTTGGGG - Intronic
1103857739 12:123985369-123985391 AGGTCTATTCATGACATTTGAGG + Intronic
1104309782 12:127644046-127644068 AGATCTGTCTTTGATATTTGGGG - Intergenic
1104435196 12:128750312-128750334 AGGTTTTCCTTTGACATTTGGGG - Intergenic
1104862774 12:131933091-131933113 AGGTCTTCCCTAGACACTTGGGG + Intronic
1108748560 13:53421422-53421444 AGGTCTGTCCTTCTCATTAGTGG + Intergenic
1109022187 13:57111925-57111947 AGCTCTTTCCTTGACAATTCTGG + Intergenic
1109446429 13:62447092-62447114 AGGTCCCTCCCTGACATGTGAGG - Intergenic
1109771307 13:66977204-66977226 ATCTATATGCTTGACATTTGGGG + Intronic
1109880226 13:68463675-68463697 TGGTCCATCCTTGACACATGGGG - Intergenic
1112943678 13:104897668-104897690 AGATCCCTCCTTGACATGTGGGG - Intergenic
1114951603 14:27761496-27761518 AGGTCTTTTCTTGTCACTTGGGG + Intergenic
1114956522 14:27826889-27826911 AGGCCTGTCCCTAACATTTGTGG - Intergenic
1115875362 14:37855026-37855048 AAGTCAGTCCTTGACATTTTTGG + Intronic
1117956530 14:61127746-61127768 AGGTCTGTCCCTCATATTTGTGG + Intergenic
1125917907 15:43505856-43505878 AGGCTTATCCTTGGCTTTTGGGG - Intronic
1126973630 15:54148975-54148997 AGGTCCCTCCTTGACACATGGGG - Intronic
1127091880 15:55475269-55475291 AGTTTTATCCTTAATATTTGTGG - Intronic
1129717154 15:77859273-77859295 TGGTCTCTCCTTGACAGGTGGGG + Intergenic
1129891520 15:79074856-79074878 AGGTCCATCCTTGATCTCTGTGG - Intronic
1132138463 15:99367880-99367902 AGCCCCATCCTTGACCTTTGGGG - Intronic
1138327397 16:56186912-56186934 TGGGCCATCCTTGACCTTTGGGG + Intergenic
1138331139 16:56216380-56216402 GGGTGTATCCTTGACTTTTAAGG - Intronic
1140096597 16:71881333-71881355 AGGCCTGTCTTTGCCATTTGCGG - Intronic
1142751880 17:1993902-1993924 TGGTGAATCCTTGACCTTTGAGG - Intronic
1143995718 17:11004847-11004869 AGGAAAATCCTTGCCATTTGAGG + Intergenic
1149088898 17:52753302-52753324 AGCCCCATCCCTGACATTTGGGG - Intergenic
1151533685 17:74724955-74724977 AGCTCCATCCCTAACATTTGGGG + Intronic
1153319046 18:3753509-3753531 AGGTCTTTCTTTGAAATTTTGGG - Intronic
1154253382 18:12762944-12762966 AGATCTGTCCTAGATATTTGGGG + Intergenic
1155170528 18:23263835-23263857 AAGTCTTTCTGTGACATTTGGGG - Intronic
1157723004 18:49939811-49939833 AGATATAGCCTTGACTTTTGAGG + Intronic
1161203090 19:3026873-3026895 AGGTCTATCTCTGACCCTTGAGG + Intronic
1165111452 19:33504840-33504862 AAAGCTATCCTTGGCATTTGAGG - Intronic
925519725 2:4730163-4730185 TGGTCTCTCCTTGACACATGAGG + Intergenic
926064341 2:9824933-9824955 AGGTCTATTGTTAACATTTCAGG + Intergenic
928925628 2:36576246-36576268 AGGTCTTTCCCTGGCATTTTAGG + Intronic
930459441 2:51653597-51653619 AGTTCTATTTTTAACATTTGGGG - Intergenic
933466159 2:82654894-82654916 AGGTCGATCATTGACCTTTCCGG + Intergenic
934480758 2:94641110-94641132 AGGCCTGTCCCTAACATTTGTGG + Intergenic
935135679 2:100298975-100298997 AAGTCTGTCCTGGACATTTCTGG - Intronic
937859461 2:126696557-126696579 ATGTCAGTCCTTGACATTTGGGG + Exonic
943781481 2:191829089-191829111 AGCTCTATCCTGGACATTTATGG + Intergenic
944452145 2:199853862-199853884 ATTTCTATCCTTGACATTGTTGG - Intergenic
948511629 2:238470002-238470024 AGTTGTATCCTGGACATTTTGGG + Intergenic
1169059360 20:2650148-2650170 ACGTCTATCTTGGCCATTTGTGG + Intergenic
1169319095 20:4616594-4616616 AGGTCTCTCCATGATATATGGGG + Intergenic
1170105064 20:12746319-12746341 AAGTCTTTCCTTGCCTTTTGTGG - Intergenic
1170185371 20:13583615-13583637 AGGTCTATGCTTTACAGATGAGG - Intronic
1172071722 20:32262252-32262274 AGGTCTACCATTGACAGCTGTGG - Intergenic
1177083631 21:16674471-16674493 AGGTCTATGCTTATCATGTGTGG - Intergenic
949925054 3:9034323-9034345 AGGTCTTTGCTTGTCATGTGTGG - Intronic
953180869 3:40593981-40594003 AAGTCTATTCTTGTTATTTGGGG + Intergenic
955417442 3:58705661-58705683 TGGTCTATCCTGGAGATTTTAGG + Intergenic
956395072 3:68816929-68816951 AGGTCTTGCCTTGATATTGGTGG + Intronic
957174906 3:76795185-76795207 AGGTCTTTCCTTGATATTGATGG + Intronic
958663329 3:97101601-97101623 AGGTGTATCCCTGACATTGGAGG - Intronic
959619458 3:108384463-108384485 AGCTCTCTCCTTTACCTTTGTGG - Intronic
962327558 3:134448325-134448347 AGGCCTTTCCCTAACATTTGTGG + Intergenic
963347832 3:144116852-144116874 AGCTCTAGGCTTGACATTTAGGG - Intergenic
963390172 3:144651870-144651892 AAGTTTATCTTTGACATTTATGG + Intergenic
965742019 3:171885400-171885422 AGGTCTAAACTAGACAGTTGCGG - Intronic
967229842 3:187327133-187327155 AGGTGTATCCCTGACAGTGGAGG + Intergenic
969201555 4:5610572-5610594 ATGTCTATGGTTTACATTTGGGG - Intronic
969976789 4:11110974-11110996 AGCCCCATCCTTGACATGTGGGG - Intergenic
972372339 4:38437336-38437358 GGATTTATCTTTGACATTTGAGG + Intergenic
972861114 4:43169845-43169867 TTGTCTACCCTTGATATTTGAGG - Intergenic
977718961 4:100216394-100216416 AGGGTTTTCCTTGACATTTTTGG + Intergenic
978701017 4:111646233-111646255 AGGTTTGGCCTTGACAGTTGCGG + Intergenic
981417186 4:144506885-144506907 ATTTCTAGCCTTGAGATTTGTGG + Intergenic
982097746 4:151938161-151938183 AGGTGTGCCTTTGACATTTGTGG + Intergenic
985483729 5:137108-137130 AGGTCTATCCATGCCACATGTGG - Intergenic
986947426 5:13040680-13040702 TGGTCTATCCTTGAGAATGGTGG - Intergenic
987352466 5:17033621-17033643 AGGTCCCTCCCTGACATGTGAGG - Intergenic
987573063 5:19689760-19689782 AGGTTTATTATTGATATTTGAGG - Intronic
988138525 5:27205233-27205255 GGCTCCATCCTTGACATATGTGG + Intergenic
990292037 5:54362043-54362065 AGATCTAGGTTTGACATTTGAGG - Intergenic
990415730 5:55584848-55584870 GGCTCTATCCCTAACATTTGTGG + Intergenic
990527242 5:56640105-56640127 AGATCCTTCCTTGACATATGAGG - Intergenic
992954042 5:81889805-81889827 AGGTCCTTCCTCGACATATGGGG - Intergenic
994542402 5:101116620-101116642 GGCCCTATCCTTGACATGTGGGG - Intergenic
995057770 5:107779698-107779720 AGGCCTATCCTTAACACTGGCGG + Intergenic
995748359 5:115427744-115427766 AGGTCTGTCCCTGACACGTGGGG - Intergenic
996493791 5:124129761-124129783 ATGTCTATCCTAGGCATTCGGGG - Intergenic
997060038 5:130489750-130489772 TTGTCTATCCTTCACCTTTGGGG - Intergenic
1000025279 5:157353505-157353527 CTGTCTGTTCTTGACATTTGGGG - Intronic
1000418360 5:161008312-161008334 AGGTTTATCATTGCCTTTTGGGG + Intergenic
1000679542 5:164166063-164166085 GGTTCTTTCCTTGACATGTGGGG + Intergenic
1001551190 5:172603207-172603229 AGGTTTATCCTAAACATCTGCGG - Intergenic
1003706177 6:8533234-8533256 GGGTCTTGCCTTGACATTCGTGG - Intergenic
1004851597 6:19705057-19705079 AGGTCTCTCCTTGAGAGATGGGG + Intergenic
1005592049 6:27338651-27338673 AGGAGTATGCCTGACATTTGAGG - Intergenic
1005636251 6:27756362-27756384 AGATCTATCCCTGTCATTTCGGG + Intergenic
1005789980 6:29289861-29289883 ATGTGAATCCTTGAAATTTGAGG - Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007694246 6:43721975-43721997 AGGTCTATCCTGGGCATTGTAGG + Intergenic
1008151818 6:47962450-47962472 TGGTCTCTCCTTGACACTTGGGG - Intronic
1008360076 6:50606709-50606731 AAGCCTTTTCTTGACATTTGGGG - Intergenic
1008495859 6:52133514-52133536 GGGTCTCTCCTTGACAACTGGGG + Intergenic
1013227173 6:108128408-108128430 AGGTCCATCCCTGACTGTTGTGG + Intronic
1014976379 6:127890099-127890121 AGGTTTATCATTAATATTTGTGG - Intronic
1015532063 6:134230611-134230633 TGGTCTCTCCTTGCCATGTGGGG + Intronic
1017348025 6:153407024-153407046 AGTCCCATCCTTGACATGTGGGG - Intergenic
1018218174 6:161551258-161551280 AGGTCCTTCCTTGGCATTTGGGG - Intronic
1019815836 7:3199890-3199912 TGCTCTATCCTGGACATTTTAGG + Intergenic
1020840495 7:13211606-13211628 TGGTCTTTCCTTGACATGTGGGG + Intergenic
1021729109 7:23579154-23579176 AGGCCCACCCTTAACATTTGTGG - Intergenic
1024912280 7:54458970-54458992 AGGTCTGCCCTTGACATGTGGGG - Intergenic
1027613471 7:80391702-80391724 AGCCCCACCCTTGACATTTGGGG + Intronic
1029914151 7:104189422-104189444 AGGTCCCTCCATGACATGTGGGG + Intronic
1031194732 7:118599160-118599182 AGGTCTCTCCCTGACAAGTGGGG - Intergenic
1031633826 7:124077811-124077833 AGGTCCCTCCTCGACATGTGAGG - Intergenic
1031648797 7:124260142-124260164 AGGCCTATCCCTAATATTTGTGG - Intergenic
1039018541 8:33180423-33180445 AGGTCCCTCCTTGACACATGGGG - Intergenic
1041430532 8:57776692-57776714 TGGTCCATCCTTGACACGTGGGG - Intergenic
1042870934 8:73398692-73398714 AGGTCTATACATTCCATTTGGGG - Intergenic
1043078523 8:75734430-75734452 GGTCCTATCCTTGACATGTGGGG - Intergenic
1043184397 8:77127387-77127409 AGGTCCCTCCTTGACACATGGGG + Intergenic
1043860835 8:85314947-85314969 AGTTCTAACCTCCACATTTGAGG + Intergenic
1048867228 8:138770024-138770046 ATGTCCATACTTGACATTTAGGG - Intronic
1051358415 9:16261080-16261102 AAGTCTATCCTGGACACTTATGG + Intronic
1053677078 9:40442856-40442878 AGGCCTGTCCCTAACATTTGTGG - Intergenic
1053926843 9:43068956-43068978 AGGCCTGTCCCTAACATTTGTGG - Intergenic
1054286638 9:63182049-63182071 AGGCCTGTCCCTAACATTTGTGG + Intergenic
1054290150 9:63278385-63278407 AGGCCTGTCCCTAACATTTGTGG - Intergenic
1054388179 9:64582925-64582947 AGGCCTGTCCCTAACATTTGTGG - Intergenic
1054507545 9:65933443-65933465 AGGCCTGTCCCTAACATTTGTGG + Intergenic
1056285689 9:85085423-85085445 ATGTCAGTCCTTGAGATTTGAGG - Intergenic
1057210650 9:93199297-93199319 AGGACTATCCTTGACATTGGGGG - Intronic
1058141023 9:101357003-101357025 AAGCCTATCCCTCACATTTGTGG + Intergenic
1058929900 9:109708954-109708976 AGGTCTACCCTTAGCAGTTGTGG - Intronic
1059067497 9:111100852-111100874 AGGTCAATCACTGACTTTTGTGG + Intergenic
1059719532 9:116946139-116946161 AGGTCCCTCCCTGACACTTGGGG + Intronic
1061666856 9:132165041-132165063 AGGTCCAGACTGGACATTTGGGG + Intronic
1185876020 X:3703024-3703046 GGGTCTAACCTTGACAGTTCTGG + Intronic
1188190523 X:27166659-27166681 AGGTCTTTTCCTGAGATTTGTGG - Intergenic
1188191342 X:27174728-27174750 AGGTCTTTTCTTGAGATTTCTGG - Intergenic
1188234851 X:27715398-27715420 AGATCTATTCTTGAAATCTGTGG + Intronic
1188996654 X:36894758-36894780 GGTTCTGTCCTTGACATGTGGGG - Intergenic
1193008978 X:76653888-76653910 AGGTCTATTATGGACATGTGGGG + Intergenic
1196949673 X:120864715-120864737 TGGTCTCCCCTTGACATGTGGGG - Intergenic
1197027881 X:121777188-121777210 ATGTCTATCCTGGAGTTTTGGGG + Intergenic
1197287605 X:124614236-124614258 AGGGCCATCCTTAACGTTTGTGG - Intronic
1198978727 X:142368289-142368311 AGGTCTGTCTTTGATAATTGTGG - Intergenic
1199301874 X:146222255-146222277 GGTTCTACCCTTGACATGTGGGG + Intergenic
1199790369 X:151149063-151149085 TGGTCCCTCCTTGACATGTGTGG + Intergenic
1200789559 Y:7287400-7287422 GGGTCTAACCTTGACAGTTCTGG - Intergenic
1200954337 Y:8929363-8929385 TGGTCTTTCCTTGGCATCTGGGG - Intergenic
1202195565 Y:22296105-22296127 TGGTCTTTCCTTGACGTCTGGGG + Intergenic
1202232457 Y:22670749-22670771 TGGTCTTTCCTTGGCATCTGGGG - Intergenic
1202310699 Y:23525409-23525431 TGGTCTTTCCTTGGCATCTGGGG + Intergenic
1202560103 Y:26145185-26145207 TGGTCTTTCCTTGGCATCTGGGG - Intergenic