ID: 917155164

View in Genome Browser
Species Human (GRCh38)
Location 1:171989776-171989798
Sequence CTGTTTAAAGTGATTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 573}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917155161_917155164 2 Left 917155161 1:171989751-171989773 CCTCAGTGCTGGCCTTGGTGTGT 0: 1
1: 0
2: 3
3: 33
4: 395
Right 917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG 0: 1
1: 0
2: 3
3: 32
4: 573
917155162_917155164 -10 Left 917155162 1:171989763-171989785 CCTTGGTGTGTGTCTGTTTAAAG 0: 1
1: 0
2: 0
3: 21
4: 298
Right 917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG 0: 1
1: 0
2: 3
3: 32
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917155164 Original CRISPR CTGTTTAAAGTGATTGTGGA AGG Intronic
903698741 1:25230473-25230495 ATATTTAGAGTGATTGTGTAAGG - Intronic
905768244 1:40621079-40621101 CTGGTTAAAGACATTCTGGAGGG + Exonic
907212609 1:52836512-52836534 CTGTTTAAAATCATTTTGCATGG + Intergenic
907811818 1:57878536-57878558 CTTTTTAAAATTATTTTGGATGG + Intronic
909518405 1:76538758-76538780 CTCTTTGTAGTGATTGTGAATGG - Intronic
910072741 1:83238649-83238671 CTGCTTCCACTGATTGTGGAAGG - Intergenic
910699550 1:90059038-90059060 CTCTTTGAAGTAATTGTGAATGG + Intergenic
911202885 1:95064031-95064053 CTTTTTGCAGTGATTGTGAATGG + Intronic
911338431 1:96608624-96608646 CTCTTTGAAGTAATTGTGAATGG - Intergenic
911561563 1:99412294-99412316 CTCTTTGCAGTGATTGTGAATGG + Intergenic
911850022 1:102806129-102806151 CTGTTTGAAGCAATTGTGAATGG + Intergenic
913285393 1:117221991-117222013 CTCTTTGAAGTAATTGTGAATGG - Intergenic
913295592 1:117316565-117316587 CTCTTTGAAGTAATTGTGAATGG + Intergenic
913608124 1:120485096-120485118 CTGTTTGAAGCAATTGTGAATGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914957734 1:152179570-152179592 GTGCTTGAAGTGGTTGTGGATGG + Intergenic
915759760 1:158298765-158298787 CTCTTTGAAGCGATTGTGAATGG + Intergenic
915761326 1:158316407-158316429 CTCTTTAAAGCAATTGTGAATGG + Intergenic
915856316 1:159390562-159390584 CTCTTTAAAGCAATTGTGAATGG + Intergenic
916583537 1:166129768-166129790 CTGAATAGAGTGATTGTGGTAGG - Intronic
916598385 1:166268683-166268705 CTCTTTGAAGTAATTGTGAATGG - Intergenic
917062778 1:171058231-171058253 CTCTTTGTAGTGATTGTGAATGG - Intronic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
917602263 1:176588161-176588183 CTCTTTGTAGTGATTGTGAATGG + Intronic
917723253 1:177806467-177806489 CTGTTTGAAGCAATTGTGAATGG - Intergenic
917911062 1:179646841-179646863 CTCTTTGAAGCAATTGTGGATGG - Intronic
919395830 1:197046405-197046427 CTCTTTGAAGTAATTGTGAATGG - Intronic
919445501 1:197699851-197699873 CTCTTTGTAGTGATTGTGAATGG - Intronic
919844077 1:201629904-201629926 CTGTTAAAAGTGGTCCTGGAAGG - Intronic
919932764 1:202232163-202232185 CTGGTTAAAGTGAGTGAAGAGGG + Intronic
920412731 1:205774916-205774938 CTGTTCAAAGTGCTGGTGGTGGG - Exonic
921008824 1:211120923-211120945 CAGTTTGCAGTGATTGTGAATGG - Intronic
921150202 1:212394827-212394849 CTCTTTAAAGCTATTGTGAATGG - Intronic
921275564 1:213515980-213516002 CTCTTTGAAGTAATTGTGAATGG + Intergenic
921831140 1:219729010-219729032 CTCTTTAAAGCAATTGAGGATGG + Intronic
922883335 1:228999119-228999141 CTGCTTCATGTGATTGAGGATGG - Intergenic
923819045 1:237415227-237415249 CTGTTTAATGTCATTGGTGAGGG + Intronic
924779768 1:247136386-247136408 CTCTTTGTAGTGATTGTGAATGG - Intronic
1062851698 10:748342-748364 CTGTTTGAAGTAATTGTGAATGG - Intergenic
1063934789 10:11066374-11066396 CTGTTTGAAGTTGTTGTGAAGGG - Intronic
1064170964 10:13032732-13032754 CTGTTTGAAGCAATTGTGAATGG - Intronic
1064849339 10:19693466-19693488 CTCTTTGAAGTAATTGTGAATGG - Intronic
1064935948 10:20679253-20679275 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1065074656 10:22065092-22065114 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1065077296 10:22093697-22093719 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1065259048 10:23905749-23905771 TGGTTTAAAGTCATTGGGGATGG - Intronic
1066035109 10:31473450-31473472 CTGTTTGAAGCAATTGTGAATGG - Intronic
1066595588 10:37046282-37046304 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1066806732 10:39263656-39263678 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1067212589 10:44272695-44272717 GTCTTTGAAGTGATTGTGAATGG - Intergenic
1067519475 10:46986024-46986046 TTGGTTCAAGTGATTGTGGAGGG + Intronic
1067642773 10:48065815-48065837 TTGGTTCAAGTGATTGTGGAGGG - Intergenic
1067786156 10:49249865-49249887 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1067874279 10:49989761-49989783 GTGCTTAAAGTAATTGTGAAAGG + Intronic
1067893572 10:50156070-50156092 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1067955276 10:50784204-50784226 CTCTTTGAAGTAATTGTGAATGG + Intronic
1068169437 10:53374479-53374501 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1068348713 10:55816361-55816383 ATGTTTAAACAAATTGTGGAAGG - Intergenic
1068718550 10:60216098-60216120 CTCTTTGTAGTGATTGTGAATGG + Intronic
1068932340 10:62604508-62604530 CTCTTTGAAGTAATTGTGAATGG + Intronic
1070852604 10:79579476-79579498 ATTTTTAAAGTGATTGTAAATGG - Intergenic
1073188377 10:101631501-101631523 ATGTTAAAAGTGATTGTGTCTGG + Intronic
1073746250 10:106471543-106471565 CTTTTTGTAGTGATTGTGAATGG - Intergenic
1073825400 10:107314968-107314990 CGTTGTAAAGTGATAGTGGATGG + Intergenic
1074651788 10:115532379-115532401 CTCTTTGAAGTAATTGTGAATGG + Intronic
1074878401 10:117632329-117632351 CTGGTTAATGTGGTTGAGGATGG - Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1076339535 10:129734310-129734332 CTCTTTGAAGTGATTGTGAATGG + Intronic
1078028214 11:7720328-7720350 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1078483048 11:11696252-11696274 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1078484911 11:11713042-11713064 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1078754002 11:14191450-14191472 CTGTTTTAAGTGTGTGGGGAAGG - Intronic
1079235530 11:18686555-18686577 CTGTTTAAGCAAATTGTGGAAGG + Intergenic
1079725521 11:23876053-23876075 AAGTTTAAAGTCATGGTGGAAGG - Intergenic
1079765628 11:24388643-24388665 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1079772932 11:24487012-24487034 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1080398177 11:31909216-31909238 CTCTTTAAAGCAATTGTGAATGG - Intronic
1081039795 11:38196120-38196142 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1081061987 11:38490490-38490512 CTCTTTGTAGTGATTGTGAATGG + Intergenic
1081100945 11:39001350-39001372 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1081103362 11:39032940-39032962 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1081945946 11:46994027-46994049 CTCTTTGAAGTAATTGTGAATGG + Intronic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082304969 11:50561080-50561102 CTCTTTGAGGTGATTGTGAATGG - Intergenic
1082605998 11:55234576-55234598 CTCTTTAAAGCTATTGTGAATGG + Intergenic
1083509690 11:63196996-63197018 CTCTTTGAAGTAATTGTGAATGG - Intronic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1085066815 11:73503392-73503414 CTCTTTGTAGTGATTGTGAATGG - Intronic
1085908385 11:80792078-80792100 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1085993807 11:81886034-81886056 CTGTTTAATAGGATTCTGGATGG + Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1086870480 11:92031134-92031156 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1087351760 11:97041911-97041933 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1087442419 11:98203286-98203308 CTCTTTTCAGTGATTGTGAATGG - Intergenic
1087736201 11:101837338-101837360 CTCTTTGAAGTAATTGTGAATGG - Intronic
1088171460 11:107002201-107002223 CTGTTGAAAGGTAGTGTGGAAGG - Intronic
1089179729 11:116574512-116574534 CTCTTTGAAGTGATTGTGAATGG - Intergenic
1089878665 11:121751915-121751937 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1089901866 11:121994778-121994800 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1090147754 11:124344491-124344513 CTGTTTATCGTTATTGTAGAGGG - Intergenic
1091424213 12:372349-372371 CTGTTTGAAGCAATTGTGAATGG + Intronic
1092281186 12:7098897-7098919 CTGTTTAAAGTGGTTAAGGCTGG + Intronic
1092479202 12:8844939-8844961 CTGTTTCAAGTGAGAGTGGACGG + Intronic
1092561146 12:9614695-9614717 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1092715147 12:11381543-11381565 CTGTTTGAAGCAATTGTGAATGG - Intronic
1093403786 12:18779872-18779894 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1093614866 12:21210810-21210832 CTCTTTAAAGCAATTGTGAATGG + Intronic
1094775945 12:33727849-33727871 CTCTTTGTAGTGATTGTGAATGG + Intergenic
1094862238 12:34480685-34480707 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1095072233 12:37867353-37867375 CTCTTTGAAGTGATTGTGAATGG - Intergenic
1095209016 12:39471403-39471425 GTCTTTGAAGTGATTGTGAATGG + Intergenic
1095306012 12:40639796-40639818 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1095534743 12:43231980-43232002 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1097104625 12:56614652-56614674 CTGTTTTAACTGACTGTGGCAGG - Intronic
1097555677 12:61134542-61134564 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1097570040 12:61321094-61321116 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1097621613 12:61945697-61945719 CTGTTTGAAGCAATTGTGAATGG - Intronic
1097634813 12:62109728-62109750 CTCTTTATAGTAATTGTGAATGG + Intronic
1098604453 12:72373140-72373162 CTGTTTGAAGCAATTGTGAATGG + Intronic
1099265027 12:80434969-80434991 CTGATTAAAGTGATTGTTTATGG + Intronic
1099549285 12:84023041-84023063 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG + Intronic
1104304327 12:127595601-127595623 CTCTTTGAAATGTTTGTGGATGG + Intergenic
1104677414 12:130721953-130721975 CTTTTTAAAGTTATTATTGAAGG + Intergenic
1105276546 13:18933649-18933671 CTTTTTAAAGAGACTGTGGGTGG + Intergenic
1106488921 13:30198748-30198770 CTTTTTAAAGTGTTTGTTTAAGG - Intergenic
1106613600 13:31306571-31306593 CTCTTTGAAGTAATTGTGAATGG - Intronic
1108882181 13:55133650-55133672 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1109816597 13:67592740-67592762 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1109920553 13:69052354-69052376 CTGTTTGAAGAAATTGTGAATGG - Intergenic
1109944314 13:69412591-69412613 CTGTGTAAAATGATTTTGGTAGG + Intergenic
1111247048 13:85553402-85553424 CTGTGATAAGTCATTGTGGAAGG - Intergenic
1111763570 13:92497842-92497864 CTCTTTGTAGTGATTGTGAATGG + Intronic
1112612164 13:100965946-100965968 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1112721086 13:102246457-102246479 CTGTTTTAAGTGCTTTTGCATGG - Intronic
1112946475 13:104933913-104933935 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1112961565 13:105133600-105133622 CTGTTTCAAGCAATTGTGAATGG - Intergenic
1113683991 13:112266654-112266676 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1114030151 14:18571633-18571655 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1114807380 14:25853694-25853716 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1114897312 14:27007748-27007770 CAGTATAAAGTAATTGTTGATGG + Intergenic
1115077869 14:29413639-29413661 CACTTTGAAGTAATTGTGGATGG + Intergenic
1115289755 14:31756450-31756472 CTGTTTGAAGCAATTGTGAATGG + Intronic
1115293832 14:31803184-31803206 CTATTTAAAGTAATGGTGCATGG - Intronic
1116091996 14:40320927-40320949 CTCTTTGCAGTAATTGTGGATGG - Intergenic
1116872128 14:50078229-50078251 CTCTTTAAAGTAATTGTGAATGG - Intergenic
1117194119 14:53322439-53322461 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1117597635 14:57339837-57339859 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1117636025 14:57744467-57744489 CTCTTTGAAGTTATTGTGAATGG - Intronic
1117644455 14:57836777-57836799 CTGCTTAAAGTAATTCAGGAAGG - Intronic
1117843966 14:59891810-59891832 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1118094829 14:62524752-62524774 CTGTTTGAAGCCATTGTGAATGG - Intergenic
1118541773 14:66835833-66835855 CTGTTTGAAGCAATTGTGAATGG - Intronic
1118958510 14:70505672-70505694 CTGTTTGAAGAAATTGTGAATGG - Intergenic
1121812204 14:96901075-96901097 CTGTTTAAAGTGAGGGTGGGTGG + Intronic
1125055402 15:35354030-35354052 CTGTTTGAAGCAATTGTGAATGG + Intronic
1125058199 15:35387592-35387614 CTGTTTGAAGCAATTGTGAATGG + Intronic
1125118070 15:36119004-36119026 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1125218345 15:37305024-37305046 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1127335210 15:57977947-57977969 CTCTTTATAGTCATTGTGAATGG + Intronic
1128830626 15:70764830-70764852 CTCTTTAAAGTGTCTGTGTATGG + Intergenic
1129576228 15:76749000-76749022 CTTTGTAAAGTGATTTAGGAAGG - Intronic
1129967177 15:79746840-79746862 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1130770273 15:86917110-86917132 GTGTTTAAAGTGCTGTTGGAAGG + Intronic
1131628465 15:94149712-94149734 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1131804553 15:96107768-96107790 CTACTTACAGTGTTTGTGGATGG - Intergenic
1131928679 15:97415057-97415079 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1133437928 16:5795801-5795823 CTGTTTACATTCATTGGGGAAGG + Intergenic
1134421324 16:14092431-14092453 CTCTTGAAAGTTATTGGGGAAGG + Intronic
1134895646 16:17884540-17884562 CTGTTAAAAGTAACGGTGGATGG - Intergenic
1135792736 16:25412424-25412446 CAGTTGAAAGAGGTTGTGGAGGG - Intergenic
1136731088 16:32413537-32413559 CTCTTTGAAGCAATTGTGGATGG + Intergenic
1136992624 16:35164402-35164424 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1137912321 16:52390601-52390623 ATGTTGAAGGTGATTGTTGAAGG + Intergenic
1138006943 16:53346168-53346190 CTCTTTGAAGCAATTGTGGATGG + Intergenic
1138824569 16:60303652-60303674 CTCTTTAAAATGTTTGTGGTAGG + Intergenic
1142352799 16:89587530-89587552 TTGTTAAATGTGTTTGTGGAAGG - Intronic
1202995305 16_KI270728v1_random:103733-103755 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1203021992 16_KI270728v1_random:416075-416097 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1144074606 17:11705321-11705343 CTGTTTAAAGTGAAACTGAAAGG + Intronic
1144422560 17:15111512-15111534 ATGTTTAACTTGATTTTGGAGGG - Intergenic
1145691080 17:26740083-26740105 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1146136170 17:30322871-30322893 CTGTTGAAAGTGACTTTGGTCGG + Intronic
1147038922 17:37702194-37702216 CTGTTTTAGGTGGATGTGGAAGG + Intronic
1148535812 17:48437834-48437856 CTGTTTAGAATGAGTGAGGAAGG - Intergenic
1148588023 17:48794679-48794701 CTGCTTAAAGGGGATGTGGAAGG - Intronic
1150196041 17:63300529-63300551 CTCTTTGTAGTGATTGTGAATGG + Intronic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1152177923 17:78800148-78800170 CTGGTTAAAGGGGTTTTGGAGGG - Intronic
1153494408 18:5683043-5683065 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1154460065 18:14574341-14574363 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1154526491 18:15295544-15295566 CTCTTTGAAGTAATTGTGAACGG + Intergenic
1155088842 18:22486159-22486181 GTGTATAAAGTGAATTTGGATGG - Intergenic
1156114578 18:33772548-33772570 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1156347214 18:36268617-36268639 GTGTTGAAAGAGAATGTGGAAGG + Exonic
1156679347 18:39569846-39569868 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1156919183 18:42499660-42499682 CTCTTTATAGTAATTGTGAATGG - Intergenic
1158101022 18:53830117-53830139 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1158343296 18:56489241-56489263 ATGTTTGAAGTGCTTGAGGATGG - Intergenic
1159464361 18:68761983-68762005 CTGTTTAAACTTATTTTAGATGG + Intronic
1159535270 18:69707076-69707098 CTGTTTGAAGCAATTGTGAATGG - Intronic
1163980460 19:20894707-20894729 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1164162723 19:22639279-22639301 CTCTTTGTAGTGATTGTGAAGGG + Intronic
1164420933 19:28092014-28092036 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1164430278 19:28181845-28181867 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1166433395 19:42745694-42745716 CTGTTTGAAGCAATTGTGAATGG + Intronic
1166436491 19:42770838-42770860 CTGTTTGAAGCAATTGTGAATGG + Intronic
1168051035 19:53830153-53830175 CTGATGAAAGTGACTGTGGCTGG - Intergenic
926724839 2:15989654-15989676 TTGATTAAAGTGGTTGTGGATGG + Intergenic
927106513 2:19832159-19832181 CTGTTTGAAGCAATTGTGAATGG + Intergenic
928368233 2:30719687-30719709 CTCTTTGAAGTAATTGTGAATGG + Intergenic
928472780 2:31590427-31590449 CTCTTTGAAGTAATTGTGAATGG + Intergenic
928679624 2:33687773-33687795 ATATTTAAAGTAATTGTGAAAGG + Intergenic
928758582 2:34555398-34555420 CTGTTTGAAGCAATTGTGAATGG + Intergenic
928804000 2:35128568-35128590 CTGTTTGTAGTGATTGTGAATGG - Intergenic
928881464 2:36101393-36101415 CTCTTTGAAGCAATTGTGGATGG - Intergenic
928882006 2:36107344-36107366 CTCTTTGAAGCAATTGTGGATGG - Intergenic
928892227 2:36217382-36217404 CTCTTTGAAGTAATTGTGAATGG - Intergenic
929174836 2:38966121-38966143 CTTTTTAAAGAGCTTGCGGAAGG - Exonic
929626979 2:43419322-43419344 ATGTTCAAAGTGAGTGAGGAAGG + Intronic
929940312 2:46328706-46328728 CTGTTCTAAGTGATTGCTGAAGG - Intronic
931502947 2:62890488-62890510 CTTTTTGTAGTGATTGTGAATGG + Intronic
932392917 2:71413227-71413249 CTGTTTGAAGCAATTGTGAATGG + Intronic
932517615 2:72369252-72369274 CTGTTTGAAGCAATTGTGAATGG - Intronic
932520618 2:72408106-72408128 CTCTTTAAAGCAATTGTGAATGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933801959 2:85968176-85968198 CTCTTTGAAGTGATTGTGAATGG - Intergenic
934836851 2:97597782-97597804 CTGTTTGAAGCAATTGTGAATGG + Intergenic
935450630 2:103204927-103204949 CTGTTTGAAGCAATTGTGAATGG - Intergenic
935630149 2:105207556-105207578 CTGTTTGAAGCAATTGTGAATGG + Intergenic
935836053 2:107055047-107055069 TTTTTTAAAGTGATTGTCGATGG + Intergenic
935843633 2:107141018-107141040 CTGTTTGAAGCAATTGTGAATGG + Intergenic
936603507 2:113924138-113924160 AGGGTCAAAGTGATTGTGGAGGG - Intronic
936848615 2:116869060-116869082 CTTTTTGTAGTGATTGTGAATGG + Intergenic
937572721 2:123383842-123383864 CTCTTTGAAGTAATTGTGAATGG - Intergenic
937576182 2:123424959-123424981 CTCTTTGAAGTAATTGTGAATGG - Intergenic
937634853 2:124144033-124144055 CTCTTTAAAGCAATTGTGAATGG - Intronic
937700516 2:124858444-124858466 CTCTTTGAAGCAATTGTGGATGG - Intronic
939744097 2:145947932-145947954 CTCTTTGAAGTGATTGTGAATGG + Intergenic
939890577 2:147731257-147731279 CTCTTTGAAGCGATTGTGAATGG - Intergenic
939969795 2:148645599-148645621 CTCTTTGAAATGACTGTGGAAGG + Intronic
940272929 2:151911053-151911075 CTCTTTGCAGTGATTGTGAATGG + Intronic
940474859 2:154149677-154149699 CTGTTTGAAGCAATTGTGAATGG + Intronic
940522527 2:154768936-154768958 CTTTTTGAAGTAATTGTGAATGG + Intronic
940729470 2:157372793-157372815 CTGTTTGAAGCAATTGTGAATGG - Intergenic
940838453 2:158551913-158551935 CTCTCTAAACTGATTGTGGGAGG + Intronic
941259833 2:163283903-163283925 CTGTTTGAAGCAATTGTGAATGG - Intergenic
941318699 2:164027674-164027696 ATTTTTAAAGTGAATGTGAAAGG + Intergenic
941665141 2:168237195-168237217 CTCTTTGAAGCAATTGTGGATGG + Intronic
942514591 2:176738448-176738470 CTGTTTAAAGGGACTGAGCAAGG + Intergenic
942872106 2:180747541-180747563 ATGTTTAAAGTGATAGGGTAAGG - Intergenic
942878608 2:180832415-180832437 CTCTTTGAAGTAATTGTGAATGG - Intergenic
943811870 2:192196484-192196506 CTCTTTTAAGTGATTGGGAATGG - Intergenic
943834771 2:192505604-192505626 CTTTTTAAAATAATTGTGTAAGG - Intergenic
943998809 2:194806144-194806166 CTCTTTGAAGTAATTGTGAATGG + Intergenic
944043483 2:195382290-195382312 CTGTTTCAGATGGTTGTGGAGGG - Intergenic
944908679 2:204287840-204287862 CTCTTTGAAGTAATTGTGAATGG + Intergenic
945151042 2:206792289-206792311 CTGTTGAAAATGAGTGAGGATGG + Exonic
945159384 2:206873692-206873714 CTGTTTAAAGAGAAAGAGGATGG + Intergenic
945520396 2:210820410-210820432 CTGTTTATAGCAATTGTGAATGG - Intergenic
946029491 2:216693420-216693442 CTGGTTTAAGAGATTGGGGAGGG + Intronic
946945026 2:224812236-224812258 CTCTTTGAAGTAATTGTGAATGG + Intronic
947275531 2:228387464-228387486 CTGTTTGAAGCAATTGTGAATGG + Intergenic
947301527 2:228693024-228693046 CTCTTTGAAGTAATTGTGAATGG + Intergenic
947315552 2:228854156-228854178 CTGTTTGAAGCAATTGTGAATGG - Intronic
947323324 2:228947225-228947247 CTGTTTGAAGCAATTGTGAATGG - Intronic
947449350 2:230192525-230192547 CTCTTTGTAGTGATTGTGAATGG - Intronic
948333221 2:237187669-237187691 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1170529522 20:17276959-17276981 CTGTTTGAAGCAATTGTGAATGG - Intronic
1170687144 20:18579775-18579797 CTATTTAAAATGATTGCGGCTGG + Intronic
1172269067 20:33642962-33642984 CTTTTGAAAGTGATTTTGCAGGG - Intronic
1174694935 20:52547638-52547660 CTCTTTGAAGTGATTGTGAATGG - Intergenic
1175108983 20:56632553-56632575 CTGCTTAAATGGATTGAGGATGG + Intronic
1176612752 21:9000460-9000482 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1176712372 21:10162994-10163016 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1177590331 21:23155963-23155985 CTGTTTAAAATGGTTTTGCAGGG + Intergenic
1177878532 21:26665309-26665331 CTCTTTGAAGAGATTGTGAATGG + Intergenic
1180394338 22:12316026-12316048 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1180405407 22:12548722-12548744 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1180454266 22:15498683-15498705 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1180575547 22:16770351-16770373 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1182149921 22:28020705-28020727 CTCTTTAAGCTGAGTGTGGATGG - Intronic
1182165409 22:28168062-28168084 CTCTTTGAAGTAATTGTGAATGG - Intronic
1183939492 22:41285349-41285371 GTTTATAAAGTGAGTGTGGAGGG - Intronic
949421122 3:3867110-3867132 CTGTTTGAAGCAATTGTGAATGG - Intronic
949424022 3:3896683-3896705 CTCTTTGAAGCAATTGTGGATGG + Intronic
949467984 3:4363473-4363495 CTCTTTGAAGTAATTGTGAATGG + Intronic
949599864 3:5586048-5586070 CTGTTTGAAGCAATTGTGAATGG - Intergenic
950603347 3:14056203-14056225 CTCTTTGAAGTGATTGTGAATGG - Intronic
951082089 3:18464587-18464609 CTGTTAGAAGAGAGTGTGGAAGG - Intergenic
952665764 3:35902118-35902140 CTCTTTGAAGCAATTGTGGATGG + Intergenic
953112636 3:39957920-39957942 CTCTTTGAAGTAATTGTGAATGG - Intronic
953146021 3:40275733-40275755 CTCTTTGAAGTAATTGTGAATGG - Intergenic
953153430 3:40345930-40345952 CTGTTTGAAGCAATTGTGAATGG + Intergenic
953543966 3:43847931-43847953 CTCTTTAAAGCGATTGTGAATGG - Intergenic
954828331 3:53395522-53395544 CTCTTTGAAGCGATTGTGAATGG - Intergenic
955536349 3:59927901-59927923 GTGTTCAAAGAGATGGTGGAAGG - Intronic
956150366 3:66235782-66235804 ATGTTTAAAGTAACTTTGGAAGG + Intronic
957280078 3:78139397-78139419 CTCTTTAAAGTGAGTGATGAAGG - Intergenic
957442581 3:80269135-80269157 CTGTTTAAAGTGTGTGTAGGTGG - Intergenic
958508487 3:95013950-95013972 CTCTTTGAAGTAATTGTGAATGG + Intergenic
958874966 3:99605544-99605566 CTCTTTGAAGTAATTGTGAATGG + Intergenic
958971790 3:100618967-100618989 CTTTTTAAAGCAATTGTGAATGG + Intronic
959111456 3:102127819-102127841 CTCTTTGAAGCGATTGTGCATGG - Intronic
959152385 3:102622791-102622813 CTCTTTGAAGTAATTGTGAATGG - Intergenic
959648622 3:108730161-108730183 CAATTGAAATTGATTGTGGAGGG + Intergenic
959880816 3:111442893-111442915 CTTTTTATAGTAATTGTGAATGG + Intronic
960069602 3:113414109-113414131 CTCTTTGTAGTGATTGTGAATGG + Intronic
960945788 3:122965649-122965671 CTGTTTAAAGTTATTGTAGATGG + Intronic
961857933 3:129891903-129891925 CAGTTTAAAGTAATGGTGGTTGG + Intronic
962914271 3:139884816-139884838 CTCTTTGTAGTGATTGTGAATGG - Intergenic
963770996 3:149386049-149386071 CTGATCAGACTGATTGTGGACGG - Intergenic
964185407 3:153936869-153936891 CTGTATAAAGTGATTGCAGTAGG - Intergenic
964264716 3:154881212-154881234 ATGTTCAAAATGATTGTTGATGG - Intergenic
964542982 3:157800273-157800295 CTCTTTGTAGTGATTGTGAATGG + Intergenic
965088712 3:164135293-164135315 CTGTTTGAAGCAATTGTGAATGG - Intergenic
965133512 3:164732168-164732190 CTGTTTCAAATAATTGTGGAGGG + Intergenic
966297552 3:178441428-178441450 CTGTTTATAGAGATTTTGGCAGG - Intronic
966534731 3:181019119-181019141 CTGTTCAAACTGGTTGTTGATGG - Intergenic
966536648 3:181042501-181042523 CTCTTTAAAGCAATTGTGAATGG + Intergenic
966650624 3:182296725-182296747 CTGCTTACAGTGATTGTGCTAGG - Intergenic
969106933 4:4813956-4813978 CTATTTGTAGTGATTGTGAATGG - Intergenic
969847417 4:9930235-9930257 CTGATGAAAGTGATGGTGAAGGG - Intronic
970288300 4:14543282-14543304 CTCTTTGTAGTGATTGTGAATGG - Intergenic
970815001 4:20144773-20144795 CTGTTTATAGCCATTGTGAATGG - Intergenic
970952346 4:21771677-21771699 CTCTTTGTAGTGATTGTGAATGG + Intronic
971570816 4:28208518-28208540 CTGATTAAAGTGATGTTGAAAGG - Intergenic
971582780 4:28364173-28364195 CTGTATAGAGTAATTGTGAAAGG + Intronic
972355690 4:38277948-38277970 CTGTTTTATATGATTGTGGTAGG + Intergenic
973067730 4:45818496-45818518 CTGTTTGAAGCAATTGTGAATGG - Intergenic
973184077 4:47303341-47303363 ATGTTTAAGGTGAATGTTGAAGG + Intronic
973187102 4:47343087-47343109 CTGTTTAATATGCTTGTGCACGG + Intronic
974253843 4:59424026-59424048 CTCTTTAAAGCAATTGTGAATGG - Intergenic
974288182 4:59896355-59896377 CTCTTTAAAGCAATTGTGAATGG - Intergenic
974299720 4:60047801-60047823 CTCTTTAAAGCAATTGTGAATGG + Intergenic
974518184 4:62943648-62943670 CTTTTTGTAGTGATTGTGAATGG + Intergenic
974760761 4:66270622-66270644 CTCTTTGTAGTGATTGTGAATGG - Intergenic
975007101 4:69303749-69303771 CTCTTTGAAGTGATTGTGAATGG - Intronic
975007812 4:69312345-69312367 CTCTTTGAAGCGATTGTGAATGG + Intronic
975036938 4:69695849-69695871 CTCTTTAAAGCAATTGTGAATGG + Intergenic
975480577 4:74875428-74875450 CTGTCTAAGGTCAATGTGGAGGG - Intergenic
975703306 4:77087485-77087507 CTCTTTAAAGCAATTGTGAATGG - Intergenic
976299923 4:83507733-83507755 CTGTTTAAGGGTAATGTGGACGG + Intronic
976537788 4:86238596-86238618 CTCTTTGTAGTGATTGTGAATGG + Intronic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
977428457 4:96900887-96900909 CTCTTTGAAGCGATTGTGAATGG + Intergenic
977477770 4:97535375-97535397 TTCTTTATAATGATTGTGGATGG - Intronic
977502963 4:97864331-97864353 CTCTTTGAAGTAATTGTGAATGG - Intronic
977567306 4:98594189-98594211 CTCTTTGAAGTAATTGTGAATGG + Intronic
977736090 4:100417852-100417874 CTGTTTAATGTGATTGCATAAGG + Intronic
977893378 4:102338149-102338171 CTGTGAAAAGTGACTATGGAAGG - Intronic
977896678 4:102373286-102373308 CTCTTTGTAGTGATTGTGAATGG + Intronic
978336634 4:107676425-107676447 CTGTTTGAAGCCATTGTGAATGG - Intronic
979198897 4:117953035-117953057 CTGTTTGAAGCAATTGTGAATGG - Intergenic
979551533 4:121996655-121996677 CTATCTAAAGTGATTATGAAAGG - Intergenic
979576384 4:122296308-122296330 CTCTTTGAAGTGATTGTGAATGG - Intronic
979583447 4:122387288-122387310 CTCTTTGTAGTGATTGTGAATGG + Intronic
980037433 4:127901297-127901319 CTCTTTATAGTAATTGTGAATGG + Intergenic
980507875 4:133746381-133746403 CTCTTTGTAGTGATTGTGAATGG - Intergenic
981188886 4:141838013-141838035 CTCTTTGAAGTAATTGTGAATGG - Intergenic
981301215 4:143187427-143187449 AAGTTTAAAGTTATTTTGGAGGG + Intronic
981497497 4:145410577-145410599 CTGGTTTACATGATTGTGGAGGG + Intergenic
981590440 4:146354279-146354301 CTGTTTGAAGCAATTGTGAATGG - Intronic
981625692 4:146752308-146752330 CTGTTTGAAGCAATTGTGAATGG - Intronic
981757411 4:148155504-148155526 CTCTTTGAAGTAATTGTGAATGG - Intronic
982196689 4:152923249-152923271 CTCTTTGAAGTAATTGTGAATGG - Intergenic
982406213 4:155022903-155022925 CTCTTTGAAGTAATTGTGAATGG - Intergenic
982479821 4:155895635-155895657 CTGTTTGAAGCAATTGTGAATGG - Intronic
982638180 4:157923395-157923417 CTCTTTAAAGCAATTGTGAAGGG + Intergenic
982860054 4:160437241-160437263 CTCTTTGAAGTAATTGTGAATGG - Intergenic
982888939 4:160822453-160822475 CTGTTTGAAGCAATTGTGAATGG - Intergenic
983103577 4:163657300-163657322 CTGTTTATAGCAATTGTGAATGG - Intronic
983331494 4:166334204-166334226 CTCTTTAAAGTTACTGTGAAGGG - Intergenic
983341628 4:166467568-166467590 CTGTTTGAAGCAATTGTGAAGGG - Intergenic
983622888 4:169778314-169778336 CTCTTTGAAGCGATTGTGAATGG + Intergenic
984403900 4:179302344-179302366 CTGTTTATAGCAATTGTGAATGG - Intergenic
984696038 4:182780806-182780828 CTGTTTGAAGCAATTGTGAATGG + Intronic
984751334 4:183278728-183278750 CTGTTTGAAGCAATTGTGAATGG + Intronic
985134143 4:186768319-186768341 CTCTTTGAAGCGATTGTGAATGG - Intergenic
985242932 4:187949994-187950016 CTCTTTATAGCGATTGTGAATGG + Intergenic
985243377 4:187954941-187954963 CTCTTTATAGCGATTGTGAATGG - Intergenic
985357950 4:189141330-189141352 CTCTTTGAAGCGATTGTGAATGG - Intergenic
988044892 5:25938109-25938131 CTCTTTGAAGCGATTGTGAATGG + Intergenic
988059888 5:26152901-26152923 CTCTTTGTAGTGATTGTGAATGG - Intergenic
988116420 5:26898064-26898086 CTCTTTGTAGTGATTGTGAATGG - Intronic
988216099 5:28274988-28275010 CTCTTTGTAGTGATTGTGAATGG + Intergenic
988667875 5:33349915-33349937 CTCTTTAAAGCAATTGTGAATGG + Intergenic
989098127 5:37799852-37799874 CTGGTTATAGTGATAGGGGAGGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989971715 5:50533226-50533248 CTGTTTGAAGCAATTGTGAATGG - Intergenic
989976894 5:50597860-50597882 CTGTTTGAAGCAATTGTGAATGG + Intergenic
990733388 5:58833593-58833615 CAGATTAAAATCATTGTGGAGGG + Intronic
990750846 5:59014534-59014556 CTCTTTGAAGTAATTGTGAATGG - Intronic
990888290 5:60619530-60619552 CTGTTTGAAGCAATTGTGAATGG - Intronic
990904302 5:60787037-60787059 CCATTAAAAGTGATTTTGGAAGG - Intronic
990926673 5:61033153-61033175 CTGTTTATAGCAATTGTGAATGG + Intronic
992645666 5:78808793-78808815 CTGTTTGCAGTGATGCTGGAGGG + Intronic
993154640 5:84207287-84207309 CTCTTTGAAGTAATTGTGAATGG - Intronic
993621830 5:90177726-90177748 CTCTTTATAGTGATTGTGAATGG - Intergenic
993808297 5:92440200-92440222 CTCTTTGTAGTGATTGTGAATGG - Intergenic
993821211 5:92619216-92619238 CTCTTTGTAGTGATTGTGAATGG + Intergenic
994270261 5:97768370-97768392 CTGTTTGAAGCAATTGTGAATGG + Intergenic
994334739 5:98550928-98550950 CTCTTTGAAGCGATTGTGAATGG - Intergenic
994973430 5:106772733-106772755 CTTTTTGAAGCGATTGTGAATGG + Intergenic
995071903 5:107932733-107932755 ATGTTTAAAGAGATACTGGAAGG + Intronic
995295208 5:110512442-110512464 CTGTGTGAAGTCATTGTGGTAGG - Intronic
995316162 5:110776954-110776976 CTGTTTGAAGCAATTGTGAATGG - Intergenic
995584128 5:113629251-113629273 ATGAATAAAGTGATTCTGGAAGG - Intergenic
995666553 5:114548834-114548856 CTCTTTGTAGTGATTGTGAATGG - Intergenic
995865298 5:116683942-116683964 CTGTCTAAAGTGTTAGGGGAGGG - Intergenic
995959742 5:117825473-117825495 CTCTTTGTAGTGATTGTGAATGG + Intergenic
996158127 5:120128619-120128641 CTGTTTGAAGCAATTGTGAATGG + Intergenic
996180202 5:120409448-120409470 CTGTTTGAAGTGTCTGTGCATGG - Intergenic
996966444 5:129311878-129311900 CTGTTTAAAGCAATTGTGAATGG - Intergenic
997496640 5:134333044-134333066 CTGTTTGTAGTAATTGTGAATGG + Intronic
998201074 5:140121867-140121889 CTGTTTAATGTGTTTGTGGATGG + Exonic
1000217384 5:159174197-159174219 GTGTTTAAAGTGTTTATTGATGG - Intronic
1000411954 5:160942832-160942854 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1002556139 5:180042423-180042445 CCGTTTAATTTGATTGAGGAAGG - Intronic
1002647401 5:180666882-180666904 CTTGTTAAAGTGGTTTTGGAAGG + Intergenic
1004181896 6:13388004-13388026 CTCTTCATAGTGATTGTGAATGG - Intronic
1004413289 6:15401124-15401146 CTGATTAAATCCATTGTGGATGG + Intronic
1005263572 6:24087231-24087253 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1008566403 6:52772980-52773002 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1009307367 6:62107334-62107356 CTCTTTGAAGTAATTGTGAATGG - Intronic
1009314369 6:62199475-62199497 CTCTTTGAAGTAATTGTGAATGG - Intronic
1009686031 6:66958905-66958927 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1009795641 6:68463301-68463323 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1009921282 6:70064848-70064870 CTGTTTGAAGCAATTGTGAATGG - Intronic
1010289656 6:74120626-74120648 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1010476541 6:76295290-76295312 CTTTTTGAAGTAATTGTGAATGG + Intergenic
1011184803 6:84662392-84662414 CTATTTAAACTGAGTGTGGTAGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012184149 6:96192443-96192465 CTGTTTGAAGCAATTGTGAATGG - Intronic
1012655105 6:101807353-101807375 CTGTTTAATGTAATACTGGAAGG - Intronic
1013379492 6:109553451-109553473 CTCTTTGTAGTGATTGTGAATGG + Intronic
1013735368 6:113221126-113221148 TTTTTTAAAGTGACTATGGATGG - Intergenic
1013868037 6:114722475-114722497 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1013873979 6:114801660-114801682 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1013882041 6:114916385-114916407 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1014134699 6:117874970-117874992 CTTTTTGAAGTGATTGTGAATGG + Intergenic
1014144702 6:117984024-117984046 CTGTTTAAACTGTTGTTGGAGGG - Intronic
1015109311 6:129573357-129573379 CTGTTTATAGCAATTGTGAATGG - Intergenic
1015930815 6:138357704-138357726 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1016270391 6:142281882-142281904 CTGTTTGTAGTAATTGTGAATGG - Intergenic
1016591675 6:145752562-145752584 CTTTTTAAAGACATTTTGGAGGG + Intergenic
1018110414 6:160531876-160531898 CTGTTTAGGGTGACAGTGGAGGG - Exonic
1020341479 7:7115898-7115920 CTGTTTAAAGCAATTGGTGAGGG - Intergenic
1020353069 7:7245027-7245049 CTGTTTAAAGAGTTTCTGAAAGG + Exonic
1020432789 7:8130654-8130676 CTGTATAAAGCGACTGTAGAAGG - Intronic
1020622195 7:10532040-10532062 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1020922577 7:14283254-14283276 CTCTTTAAAGCAATTGTGAATGG - Intronic
1020976137 7:15009194-15009216 GTCTTTAAATTGATTGTGAAAGG + Intergenic
1021099109 7:16568575-16568597 ATGTTTAAAGTGATAATGGCTGG + Intronic
1021374128 7:19885713-19885735 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1021375528 7:19902301-19902323 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1021835872 7:24674166-24674188 AGGTTTAAGGTCATTGTGGAGGG - Intronic
1023073300 7:36458963-36458985 CTGTGTAAAGTGGGAGTGGAGGG + Intergenic
1023287572 7:38634789-38634811 ATGTTTAAAGTCATTGTAGTTGG - Intergenic
1023363162 7:39436373-39436395 CTCTTTGTAGTGATTGTGAATGG + Intronic
1023419423 7:39963374-39963396 CTCTTTAAAGCAATTGTGAATGG + Intronic
1023977952 7:45045878-45045900 ATTTTTTAAGTGATTGTGAATGG - Intronic
1024105982 7:46087100-46087122 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1024110572 7:46142203-46142225 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1024260024 7:47567377-47567399 CGTCTTAAAGTGATTGTGAATGG - Intronic
1024521644 7:50309527-50309549 CTGTGTAAAGTGTTTTTGAATGG + Intronic
1024782474 7:52867005-52867027 CTGTTTAAGGAGATTGAAGATGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026958985 7:74396823-74396845 CTTTTTAAAGTTGTTGTGGGGGG - Intronic
1027290469 7:76703803-76703825 CTGCTTCCACTGATTGTGGAAGG - Intergenic
1027388516 7:77682047-77682069 CTTTTTAAAGCCATTGTGGTGGG - Intergenic
1028620626 7:92823645-92823667 CTTTTTAAAGTGATTCTACATGG + Intronic
1028837137 7:95387372-95387394 CTCTTTATAGTAATTGTGAATGG - Intronic
1029673044 7:102047223-102047245 CTCTGTTAAGTGATGGTGGATGG + Intronic
1029922546 7:104280917-104280939 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1031103944 7:117515901-117515923 CTCTTTGTAGTGATTGTGAATGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1033993276 7:147314013-147314035 CTGTTTGAAGCAATTGTGAATGG + Intronic
1034289439 7:149917372-149917394 CTGTTTAAAATGTTTGGGGCAGG - Intergenic
1034661628 7:152775458-152775480 CTGTTTAAAATGTTTGGGGCAGG + Intronic
1036072985 8:5462595-5462617 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1036498575 8:9293306-9293328 CTATCTAAAGGGATTGTTGAGGG + Intergenic
1037469278 8:19191486-19191508 CTGCTTTCTGTGATTGTGGAAGG - Intergenic
1038097177 8:24327281-24327303 CTGTTTGTAGTAATTGTGAATGG - Intronic
1038844168 8:31213490-31213512 CTGGTAAAAGTGTTTCTGGAGGG + Intergenic
1039281121 8:35986047-35986069 CTCTTTGAAGTCATTGTGAATGG + Intergenic
1039293450 8:36123667-36123689 CTCTTTGTAGTGATTGTGAATGG + Intergenic
1040010930 8:42660487-42660509 CTTTTAAATGTGTTTGTGGAAGG - Intergenic
1040772042 8:50989438-50989460 CTGTTTTCATTGATTTTGGAAGG + Intergenic
1041387820 8:57322699-57322721 CTGTTTAAAGAAATTGTGAATGG + Intergenic
1041427813 8:57742590-57742612 ATGTTAAAAGTGATTGATGAGGG - Intergenic
1041459279 8:58093998-58094020 CTCTTTATAGCGATTGTGAATGG + Intronic
1041842656 8:62289992-62290014 CTCTTTGAAGTGATTGTGAATGG + Intronic
1042458796 8:69037891-69037913 CTCTTTGAAGCAATTGTGGATGG + Intergenic
1042613952 8:70628410-70628432 CTCTTTGTAGTGATTGTGAACGG + Intronic
1042713279 8:71743260-71743282 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1042760118 8:72262692-72262714 CTGATTAAATTGATTGTAAAGGG - Intergenic
1043272763 8:78354889-78354911 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1043462452 8:80474079-80474101 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1043498320 8:80827312-80827334 CTCTTTGAAGTAATTGTGAATGG - Intronic
1044156639 8:88856381-88856403 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1044808667 8:96034867-96034889 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1044882653 8:96740212-96740234 CTTTTTAAAGCAATTGTGAATGG + Intronic
1044909407 8:97041234-97041256 CTCTTTAAAGCAATTGTGAATGG + Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045587203 8:103551842-103551864 CTCTTTGAAGCAATTGTGGATGG - Intronic
1045705067 8:104912947-104912969 CTCTTTGTAGTGATTGTGAATGG + Intronic
1045829504 8:106441666-106441688 CTCTTTGCAGTGATTGTGAATGG + Intronic
1046370714 8:113303152-113303174 CTCTTTGAAGCAATTGTGGATGG - Intronic
1046378906 8:113427377-113427399 CTTTTTGAAGTAATTGTGTAAGG - Intronic
1046663383 8:116973429-116973451 CTCTTTGAAGTAATTGTGAATGG - Intronic
1046895531 8:119467892-119467914 ATTTTTGAAGTGATTGTGAATGG - Intergenic
1047077694 8:121422269-121422291 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1047921950 8:129644448-129644470 CTGAATGAAGTGATTGTGGCTGG - Intergenic
1048647630 8:136439826-136439848 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1048819745 8:138369769-138369791 ATGTTTAATGTGATTATGAAGGG - Intronic
1048827760 8:138446045-138446067 CTCTTTGAAGCGATTGTGAATGG - Intronic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1050618728 9:7430179-7430201 CAGAGTACAGTGATTGTGGAAGG - Intergenic
1050908065 9:11029616-11029638 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1050969479 9:11851068-11851090 TTATTTAAAGTAATTGTGGAAGG - Intergenic
1052070259 9:24073281-24073303 CGGTTTAATGTGATTGTCAAAGG + Intergenic
1052239470 9:26254022-26254044 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1052384995 9:27812120-27812142 CTCTTTATAGCAATTGTGGATGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053726221 9:41004047-41004069 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1055237427 9:74141110-74141132 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1055374141 9:75630891-75630913 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1055629052 9:78204276-78204298 GTGTTTAAAGTGTTCTTGGATGG - Intergenic
1055836710 9:80452498-80452520 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1058085595 9:100744906-100744928 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1058257867 9:102792000-102792022 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1058319145 9:103608028-103608050 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1058821341 9:108732957-108732979 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1061135732 9:128732214-128732236 ATGTTCAAAGTGACTGTGGTAGG + Intronic
1202797120 9_KI270719v1_random:131984-132006 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1203444058 Un_GL000219v1:38362-38384 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1203514866 Un_KI270741v1:157271-157293 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1186312552 X:8336333-8336355 GTGTTTAAAGTGGGGGTGGAGGG + Intergenic
1187197955 X:17106223-17106245 CTCTTTGTAGTGATTGTGAATGG - Intronic
1187269110 X:17763716-17763738 CCGTTTATAGTGGGTGTGGAGGG + Intergenic
1187645627 X:21343953-21343975 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1188682073 X:33021955-33021977 CTTTTTAAAATTATTTTGGAAGG - Intronic
1189525238 X:41812982-41813004 CTCTTTGAAGTAATTGTGAATGG - Intronic
1190400866 X:50033409-50033431 CTCTTTGAAGTAATTGTGAATGG - Intronic
1190686615 X:52880044-52880066 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1190687052 X:52884322-52884344 CTCTTTGAAGCAATTGTGGATGG + Intergenic
1190698930 X:52971470-52971492 CTCTTTGAAGCAATTGTGGATGG - Intronic
1191001999 X:55670080-55670102 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1191063851 X:56326710-56326732 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1191076291 X:56456951-56456973 CTCTTTAAAGAAATTGTGAATGG + Intergenic
1191124105 X:56935914-56935936 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1191125598 X:56950486-56950508 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1191127351 X:56971891-56971913 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1191168828 X:57420470-57420492 CTCTTTGAAGTAATTGTGAATGG + Intronic
1191230855 X:58092807-58092829 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1191614161 X:63150389-63150411 CTCTTTGAAGCGATTGTGAATGG - Intergenic
1191622135 X:63228538-63228560 CTCTTTGAAGCGATTGTGAATGG + Intergenic
1191624524 X:63256090-63256112 CTCTTTGAAGTGATTGTGAATGG - Intergenic
1191635472 X:63371428-63371450 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1191907002 X:66104046-66104068 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1192302911 X:69924902-69924924 CTCTTTGTAGTGATTGTGAATGG + Intronic
1192345193 X:70297374-70297396 CTGTTTAATTTGATTGTTGGAGG + Intronic
1192953924 X:76048549-76048571 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1193065969 X:77260488-77260510 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1193068967 X:77287223-77287245 CTTTTTATAGTAATTGTGAATGG - Intergenic
1193387586 X:80889360-80889382 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1193495590 X:82207397-82207419 CTCTTTTTAGTGATTGTGAATGG - Intergenic
1194404298 X:93475858-93475880 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1195017514 X:100793894-100793916 CTGTTTCAGGGGATTGTGCAGGG - Intergenic
1195685880 X:107585192-107585214 CTCTTTGTAGTGATTGTGAATGG + Intronic
1195827159 X:109014753-109014775 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1195854590 X:109316621-109316643 CTGTTTGTAGTAATTGTGAATGG + Intergenic
1195970585 X:110468847-110468869 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1195987053 X:110641767-110641789 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1196004229 X:110818506-110818528 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1196171619 X:112594512-112594534 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1196172609 X:112606615-112606637 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1196180637 X:112686015-112686037 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1196183694 X:112722866-112722888 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1196606878 X:117667274-117667296 CTCTTTGTAGTGATTGTGAATGG + Intergenic
1196756766 X:119164409-119164431 CTCTTTAAAGCAATTGTGAATGG - Intergenic
1197447058 X:126563423-126563445 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1198166059 X:134058391-134058413 CTCTTTAAAGCAATTGTGAATGG + Intergenic
1198404879 X:136302333-136302355 CTCTGTGAAGTGATTGTGAATGG + Intronic
1198519452 X:137437998-137438020 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1198565620 X:137902204-137902226 CTGTTTATAGTAATGGTTGAGGG + Intergenic
1199186908 X:144925903-144925925 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1199564007 X:149195294-149195316 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1199578535 X:149338254-149338276 CTCTTTGAAGCAATTGTGGATGG - Intergenic
1200331329 X:155301328-155301350 CTCTTTGAAGTAATTGTGAATGG + Intronic
1201302373 Y:12520153-12520175 CTCTTTGAAGTAATTGTGAATGG + Intergenic
1201333100 Y:12849206-12849228 TTGTTTGAAGTGATTGTGAATGG + Intronic
1201392769 Y:13516180-13516202 CTCTTTGAAGTGATTGTGAATGG + Intergenic
1201466444 Y:14286525-14286547 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1201521830 Y:14883972-14883994 CTATTTGAAGTAATTGTGAATGG + Intergenic
1201929457 Y:19326451-19326473 CTCTTTGTAGTGATTGTGAATGG - Intergenic
1202331732 Y:23760651-23760673 CTCTTTGAAGTAATTGTGAATGG - Intergenic
1202333027 Y:23774753-23774775 CTGTTTGAAGCAATTGTGAATGG + Intergenic
1202537742 Y:25895310-25895332 CTGTTTGAAGCAATTGTGAATGG - Intergenic
1202539038 Y:25909409-25909431 CTCTTTGAAGTAATTGTGAATGG + Intergenic