ID: 917156903

View in Genome Browser
Species Human (GRCh38)
Location 1:172012290-172012312
Sequence GCAGCATGCAGGAGCACATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917156898_917156903 29 Left 917156898 1:172012238-172012260 CCTTAGGGACGTAGGGAGTTATT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 917156903 1:172012290-172012312 GCAGCATGCAGGAGCACATGTGG 0: 1
1: 0
2: 3
3: 24
4: 249
917156897_917156903 30 Left 917156897 1:172012237-172012259 CCCTTAGGGACGTAGGGAGTTAT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 917156903 1:172012290-172012312 GCAGCATGCAGGAGCACATGTGG 0: 1
1: 0
2: 3
3: 24
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917156903 Original CRISPR GCAGCATGCAGGAGCACATG TGG Intronic
901401675 1:9019131-9019153 GCTGGAAGCAGGAGCAGATGAGG - Intronic
902286976 1:15413251-15413273 GCAGGAGGCAGGAGACCATGAGG + Intronic
902551124 1:17220153-17220175 GCAGCCTGCAGGGGCTCCTGGGG + Intronic
902746174 1:18476060-18476082 GCACCAGGCAGGACCACGTGGGG - Intergenic
903968949 1:27106720-27106742 GCAGCAGGCCGGGGCACACGTGG - Intronic
904436653 1:30503005-30503027 GCAGGAAGCAGGAGCCCAGGTGG - Intergenic
906371163 1:45255079-45255101 GCAGCAGGCAAGAGCCCATCAGG - Intronic
906560930 1:46756279-46756301 CCAACATGCAGGAGAACAAGAGG - Intergenic
906682278 1:47736894-47736916 GCTGCATGAAGGAGCATATAAGG - Intergenic
907359458 1:53903051-53903073 GAAGCAGGAAGGAGCACCTGGGG - Intronic
907450423 1:54542490-54542512 GCAGCGTGCTGGAGCACAGGAGG - Intronic
907489023 1:54797018-54797040 GCACCAGGCAGGGGCACATAAGG - Intronic
910623423 1:89281114-89281136 GCAGCATGCAGTAGGAAGTGAGG - Intergenic
912776388 1:112508767-112508789 GCAGCGTGCGGGAGCAGGTGGGG + Exonic
916707087 1:167362436-167362458 ACACCATGCAGGGTCACATGGGG + Intronic
917156903 1:172012290-172012312 GCAGCATGCAGGAGCACATGTGG + Intronic
917652926 1:177096689-177096711 GCAGCAGGCAAGAGGGCATGTGG - Intronic
917665484 1:177221698-177221720 TCAGCAGCCTGGAGCACATGTGG - Intronic
918311440 1:183288240-183288262 TGAGAATGCAGGAGCCCATGGGG - Intronic
919126552 1:193401374-193401396 GCAGCAAGCAGGAGAGCAAGAGG - Intergenic
920032911 1:203048243-203048265 GCAACATTGAGGAGCACCTGCGG + Intronic
921160329 1:212467959-212467981 GCTGGCTGGAGGAGCACATGGGG - Intergenic
921316713 1:213898440-213898462 GCAGCTTGCAGGAGCACCTGGGG + Intergenic
1064222862 10:13456275-13456297 GGAGCATGCAGGAGCAGCTGAGG + Intronic
1065921780 10:30399344-30399366 GCAGCATGCAGCAACAAACGTGG + Intergenic
1067226961 10:44382849-44382871 GCTGGAGGAAGGAGCACATGAGG - Intronic
1068143868 10:53040662-53040684 ACATCATGCAGGACCACATGGGG + Intergenic
1068956266 10:62820637-62820659 TCAGCATGCAGGGGCACTTTAGG - Intronic
1069342300 10:67425884-67425906 GCAGCATGGAGGAGTATATGAGG - Intronic
1070702057 10:78611109-78611131 GCAGCAGGGAGGAAGACATGGGG + Intergenic
1071409299 10:85373164-85373186 GAAGCATGCACTGGCACATGAGG - Intergenic
1073337171 10:102718504-102718526 GCAGCCTGCAGGAGGCCAGGTGG + Intronic
1074182390 10:111076551-111076573 CCAGCCTCCAGGAGCACCTGCGG + Intergenic
1076109726 10:127851308-127851330 GCTGAAAGCAGGAGCACATCGGG + Intergenic
1076139946 10:128070824-128070846 GGATCATGAAGGAGAACATGAGG + Exonic
1076241153 10:128908931-128908953 ACAGCATGCAGGAGCACTCCAGG - Intergenic
1080873817 11:36259265-36259287 CCAGCATGCAGGAGCAGCTGGGG + Intergenic
1082772978 11:57222934-57222956 GATGCAGGCAGGAGCACATGTGG - Intergenic
1084315633 11:68343770-68343792 CCAGGATGCAGGAGCTCCTGGGG - Intronic
1084480403 11:69416489-69416511 GCAGCAGGCAGGTACAGATGGGG + Intergenic
1085524662 11:77157299-77157321 CCAGCATGCAGTAGAACACGTGG - Exonic
1085751221 11:79162795-79162817 GCAGTGTGCAGGAGCCCATTGGG + Intronic
1090059440 11:123451294-123451316 ACAGGATGCAGGAACAAATGAGG - Intergenic
1092226489 12:6751672-6751694 CCAGCCTACAGGAACACATGAGG + Exonic
1092479532 12:8847575-8847597 GCAGCTTCCAGGAGCAGAAGTGG + Exonic
1093078153 12:14778346-14778368 GCAGCATGCACGAAGACATGGGG + Intergenic
1093227559 12:16503934-16503956 GCAGCATACAGCAGCACCGGAGG - Intronic
1096186144 12:49582140-49582162 GCAACATGCAGGAACAGACGTGG - Intronic
1098042692 12:66368367-66368389 GCTGTATGCAGGAGAACAAGTGG - Intronic
1101066498 12:101027366-101027388 GCAGCAGGCAGCAGCAGCTGTGG - Intronic
1102980012 12:117234006-117234028 GCTTCATCCAGGAGCACAGGTGG - Intronic
1104825877 12:131709426-131709448 GCAGCATGCAGAAGCAGAAGAGG + Intergenic
1105069482 12:133226100-133226122 TCAGGCTGCAGGAGCACGTGTGG + Intronic
1106308251 13:28532368-28532390 GCAGCAGGCGGGTGGACATGGGG - Intergenic
1106566536 13:30889481-30889503 GCAGCACTCAGAAGCACAAGAGG - Intergenic
1109098035 13:58142758-58142780 GCAGCAGGCAAGAGAGCATGTGG - Intergenic
1110307105 13:74001082-74001104 GCAGAATGCAGTACTACATGTGG - Intronic
1110626648 13:77661472-77661494 GCAACATGCATAAGAACATGAGG - Intergenic
1112421891 13:99259925-99259947 GAGGCATCCAGGAGCACCTGAGG + Intronic
1116439465 14:44935732-44935754 GCAGCAAGGAGGGGCACAGGGGG + Intronic
1116637156 14:47411663-47411685 GGCGCATGAAGGAGCACATAAGG + Intronic
1120457278 14:84748121-84748143 ACAGCATGCATGATCACAGGAGG - Intergenic
1121898774 14:97673159-97673181 GAAGCCTTCAGAAGCACATGAGG + Intergenic
1122540827 14:102496867-102496889 GCAGCATGCAGCAGCCAGTGTGG - Intronic
1122808316 14:104273119-104273141 GCAGCATGCAAGAGAGAATGAGG - Intergenic
1124011771 15:25844835-25844857 GCAGCCTGCACCGGCACATGAGG + Intronic
1124662617 15:31562540-31562562 ACAGCATGCAGGGCCACACGGGG - Intronic
1126176743 15:45743041-45743063 GCAGTTTGCAGGAGCTCCTGGGG + Intergenic
1127967407 15:63932731-63932753 GCAGGATGCAAGAGGACAGGAGG - Intronic
1128090517 15:64915848-64915870 GCAGGATGCAGGAGCTGATTGGG + Exonic
1129034775 15:72642373-72642395 GCAGCTGGGAGGAGCACTTGGGG + Intergenic
1129215107 15:74094843-74094865 GCAGCTGGGAGGAGCACTTGGGG - Intergenic
1129675100 15:77628601-77628623 GGGGTGTGCAGGAGCACATGGGG + Intronic
1132300102 15:100769860-100769882 GCAGAATGGAGCGGCACATGGGG - Intergenic
1132347803 15:101118933-101118955 GCAGCCTGCAGGGGGACCTGCGG + Intergenic
1132736191 16:1387307-1387329 GCTGCTTGCTGGAGAACATGAGG - Intronic
1132902446 16:2264909-2264931 GACGCCTCCAGGAGCACATGGGG - Intronic
1133256913 16:4522716-4522738 GAAGCAAGCAGGAGCTCACGTGG + Intronic
1133405174 16:5518476-5518498 TCAGCATGCTTGAGCACATATGG - Intergenic
1133841972 16:9418204-9418226 GGAGCAGGGAGGAGAACATGAGG - Intergenic
1135685033 16:24491990-24492012 GCAGTATCCATGGGCACATGTGG + Intergenic
1137394857 16:48109747-48109769 ACAGCATCCAGGAGCACAAAAGG + Intronic
1138213750 16:55184885-55184907 GCACCCTGCTGGAGCACCTGGGG - Intergenic
1138443535 16:57049199-57049221 GCTGCATGCAGCAGGCCATGTGG + Intronic
1138829298 16:60358551-60358573 GCAACATGCATAAGAACATGAGG - Exonic
1139637822 16:68269143-68269165 ACAGCATGCAGAAACAAATGTGG - Intronic
1141761431 16:86031179-86031201 GCAGGATGCAGGAGATCTTGGGG + Intergenic
1142116005 16:88356391-88356413 GCTCCATGCAGGAGCCCCTGGGG + Intergenic
1142864348 17:2781261-2781283 GCAGCAGGCATGGGCACTTGGGG + Intronic
1143097416 17:4485880-4485902 CCAGGATGCAGCAGCACAAGCGG - Intronic
1143419990 17:6781241-6781263 GCAGCATGCAGGAGACCCTGTGG + Intronic
1144328653 17:14205495-14205517 GGTGCAGGCAGGAGCACGTGTGG + Intronic
1146569650 17:33941453-33941475 GCAGCATCCTGGAGCCCAGGTGG + Intronic
1147190036 17:38733196-38733218 GCAGGCTGCAGGAGCTCAGGGGG - Intronic
1148214843 17:45828913-45828935 CCTGCATGCACAAGCACATGTGG - Intronic
1150463468 17:65372025-65372047 GCACCATGCAGAAGGACTTGTGG - Intergenic
1151904356 17:77038031-77038053 GGGCCATGCAGGACCACATGAGG + Intergenic
1152521670 17:80860108-80860130 GCAGCAGGCAGGAGCCCCGGGGG - Intronic
1152577510 17:81149361-81149383 GCAGGAGGCAGGACCGCATGGGG - Intronic
1152927320 17:83093252-83093274 GCAGAAACCAGGAGCACAGGAGG - Intronic
1155120864 18:22817022-22817044 GCAGCAGGGAGGAGCAGCTGGGG - Intronic
1155981369 18:32183814-32183836 ACAGCATGCAAGAGGACATGGGG - Intronic
1156931615 18:42651309-42651331 GCAGCAAGCAGGAAGAAATGTGG + Intergenic
1157434502 18:47657014-47657036 GAAGCATGCAGGAGCCCCTTGGG + Intergenic
1160316072 18:77849020-77849042 GCAGCCTCTAGGTGCACATGAGG - Intergenic
1160418815 18:78730324-78730346 ACAGCAGACAGGAGCCCATGTGG - Intergenic
1164161552 19:22628511-22628533 GCACTCTGCAGGGGCACATGAGG - Intergenic
1164607450 19:29610405-29610427 GCAGCCTTCAGGAGCACAGCGGG + Exonic
1166517805 19:43460561-43460583 GCAGCATGGAGGGGCGAATGGGG - Intergenic
1166626438 19:44360562-44360584 GCAGGATAAAGGAGCAAATGTGG - Intronic
1167646755 19:50710181-50710203 GCAGGAGACAGGAGCACGTGGGG + Intronic
1167675294 19:50880234-50880256 ACACCATGCAGGATGACATGGGG + Exonic
925488005 2:4357781-4357803 GCAGAATGATGGGGCACATGGGG - Intergenic
925822973 2:7818583-7818605 GCAGCAGGTATGAGCACACGGGG + Intergenic
926045668 2:9708016-9708038 GCAGCATGGAGGTGGAGATGAGG - Intergenic
926146129 2:10398097-10398119 ACAGTATGCAGGAGCAGGTGGGG - Intronic
927163262 2:20290712-20290734 GCAGCAAGCAGAATCACTTGCGG - Exonic
927240206 2:20914338-20914360 ACACCATGCAGGGCCACATGGGG - Intergenic
930381949 2:50641310-50641332 CCAACATGCAGCAGCAAATGAGG - Intronic
931288021 2:60848982-60849004 GCATCGAGCAGGGGCACATGTGG - Intergenic
934737019 2:96694689-96694711 GTAGCATGCATGATCACTTGTGG + Intergenic
935480345 2:103580306-103580328 GCAGCATGCAGCAGCAACAGAGG - Intergenic
936509608 2:113134539-113134561 GTGGCAGGCAGGAGCACCTGGGG + Intergenic
936966282 2:118130341-118130363 GAAACATGCAGGAGCTCTTGAGG - Intergenic
936968460 2:118150647-118150669 GCAGTATGCAGGCAGACATGTGG + Intergenic
938547048 2:132343809-132343831 GCAGGATAAAGGAGCAAATGTGG + Intergenic
939581641 2:143956695-143956717 TCATCATGGAGGAGGACATGAGG - Intronic
940489383 2:154338549-154338571 ACACCATGCAGGGCCACATGAGG + Intronic
940659663 2:156531297-156531319 CCAGCAGTAAGGAGCACATGTGG - Intronic
943633221 2:190277880-190277902 GCAGCATGCAGAACCAGAAGAGG - Intronic
943656518 2:190514487-190514509 GCAGACTCCAGGAGGACATGAGG + Exonic
944090885 2:195910149-195910171 GCACCTTGGAGGAGCACCTGAGG - Exonic
944218356 2:197277793-197277815 CCAGCATTCAGGAGGACAAGAGG + Intronic
945976581 2:216275868-216275890 GATGAATGCAGGAGCACAAGGGG - Intronic
946000783 2:216480530-216480552 GCATCCTGGAGGAGGACATGTGG + Intronic
947236322 2:227945110-227945132 GCAGCAGGCAAGAACACATCAGG - Intergenic
948619997 2:239228241-239228263 GCAGCCTGCTGGAGGCCATGTGG + Intronic
948794043 2:240393066-240393088 GCCCCATGCAGCAACACATGGGG - Intergenic
948841404 2:240651422-240651444 GCAGAATCCAGGAGAACAAGAGG - Intergenic
1169126072 20:3127638-3127660 CCATCACGCAGGAGCGCATGTGG - Intronic
1169404794 20:5314525-5314547 GCAACATGCAGGAGAACATCTGG + Intergenic
1170053228 20:12170289-12170311 AGAGCATGAAGGAACACATGTGG + Intergenic
1170413179 20:16112439-16112461 GCAGCAGCCATGAGCATATGTGG - Intergenic
1170476144 20:16716527-16716549 GCAGCAAGCAGCAGAACAAGAGG - Intergenic
1171845931 20:30274747-30274769 GCCTCTTGCAGGTGCACATGAGG - Intergenic
1171875911 20:30576546-30576568 GCAGGATAAAGGAGCAAATGTGG + Intergenic
1172015933 20:31872864-31872886 GGAGCATGCAGGAGCACATATGG + Intronic
1172222215 20:33281763-33281785 GCAGGAAGCAGGAGCTGATGCGG + Intronic
1175340728 20:58227711-58227733 CCAGCATGGAGGAGGACTTGGGG + Intronic
1175496878 20:59420725-59420747 GCGGCAGGCAGGAGGAAATGAGG - Intergenic
1175816579 20:61886184-61886206 GCAGCATCCAGGAGAACTTCAGG + Intronic
1179042586 21:37816921-37816943 ACAGCTTGTAGGAGCAAATGTGG - Intronic
1179438988 21:41380260-41380282 GCCCCATGTGGGAGCACATGGGG - Intronic
1179499602 21:41799533-41799555 GCAGCATGCAGGAGGGTCTGTGG - Intronic
1181308235 22:21929046-21929068 GCAGCTTCCAGGAGTACGTGGGG - Intronic
1181624480 22:24113967-24113989 GCAGCATCCCTGAGCACATGTGG - Intronic
1184032805 22:41904857-41904879 GCTTCATGCAGGAACACCTGGGG - Exonic
1184878432 22:47289876-47289898 CCCGCATGCATGAGCACATCTGG + Intergenic
949286410 3:2411180-2411202 GCAGGATGAGGGAGCACATCAGG + Intronic
950231197 3:11277354-11277376 GCAGCAAGGAGAGGCACATGGGG - Intronic
952172155 3:30818997-30819019 GAAGCCTGCAGGAACACAGGGGG + Intronic
952714130 3:36461634-36461656 GCAGGTTGCAGTATCACATGAGG + Intronic
952787966 3:37175480-37175502 GCAGCATGCAGGAGGACCTAAGG - Intronic
953444956 3:42955391-42955413 GCAGCAGGCAAGAGAAAATGAGG + Intronic
954803515 3:53201473-53201495 GCAGCATGCAGCAGCAGCAGAGG - Intergenic
955073330 3:55589851-55589873 GCTGCACTGAGGAGCACATGGGG + Intronic
955094692 3:55785649-55785671 GCAGCATGAATGAGAAGATGTGG - Intronic
955476912 3:59346638-59346660 GCAGCATGCAGGAGACCCAGTGG - Intergenic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
961465830 3:127081058-127081080 CCAGCATGCAGGTGCAGCTGTGG + Intergenic
962993052 3:140597183-140597205 ACAGCATTAAGGAGCTCATGGGG + Intergenic
963264848 3:143229651-143229673 GCAGCTCCCAGGAGCCCATGTGG + Intergenic
964376116 3:156050770-156050792 GTAGCATGTAGGTGTACATGGGG - Intronic
967948047 3:194819595-194819617 TCAGCATGCAGGTGTACATGTGG + Intergenic
968180428 3:196591275-196591297 AGAGAATGCAGGAACACATGTGG + Intergenic
968481707 4:835920-835942 GCAGCAAGAACGAGCACACGGGG + Intergenic
968817291 4:2828682-2828704 GTAGCATGCAGGAGCACTGGTGG - Intronic
969462838 4:7337871-7337893 GCAGCATGTGGGAGCATGTGTGG - Intronic
969707181 4:8818430-8818452 GCAGCCTGCAGCACCACACGGGG + Intergenic
970349320 4:15185497-15185519 CGAGCATGGAGGAACACATGTGG - Intergenic
970360739 4:15306396-15306418 GCAGCATCCAGTAGCTCATTAGG + Intergenic
970439141 4:16065093-16065115 GCAACATGAAGGAGGCCATGGGG - Intronic
970781928 4:19747939-19747961 GGAAAAAGCAGGAGCACATGAGG + Intergenic
971224075 4:24735235-24735257 GCACCATGCAGGGCCACACGGGG - Intergenic
974263001 4:59548704-59548726 GAAGCAGGGAGGAGCACATGTGG - Intergenic
976272961 4:83248772-83248794 GCAGCAGGCTGGACCACCTGGGG - Intergenic
978109323 4:104943599-104943621 ACACCATGCAGGACCACAGGGGG - Intergenic
978244340 4:106554227-106554249 GCTGCAGTCAGGACCACATGAGG - Intergenic
981848160 4:149194233-149194255 GCAGGATGCAGGGCCCCATGGGG - Intergenic
982099727 4:151956037-151956059 GCTGTATGGAGGAGCCCATGTGG + Intergenic
982653290 4:158114498-158114520 GCAGCATGGAAAAGCACAGGAGG + Intergenic
983287732 4:165760679-165760701 GCAGCAGGCAGTGGCACATGTGG - Intergenic
985636719 5:1039301-1039323 GCAGCCTGCAGGGGTCCATGTGG + Intergenic
986554282 5:8995482-8995504 GCAGCAGGCAAGAGAGCATGTGG - Intergenic
990230409 5:53706899-53706921 GCAGGAGGAGGGAGCACATGAGG - Intergenic
990348404 5:54891404-54891426 CTAGAAAGCAGGAGCACATGAGG + Intergenic
997699610 5:135887773-135887795 GCTGCCTGCAAGAGCACAGGTGG - Intronic
997699613 5:135887800-135887822 GCTGCCTGCAAGAGCACAGGGGG - Intronic
999728417 5:154456426-154456448 GCAGCATGCAAGTCCAGATGTGG - Exonic
1000161363 5:158600802-158600824 GCAGCCTCTAGGAGCAGATGAGG + Intergenic
1001207510 5:169778099-169778121 CCACCATCCAGGAGCACTTGTGG - Intronic
1001298187 5:170514051-170514073 GCTGCAGGCAGGAGCCCAGGTGG - Intronic
1003237533 6:4309772-4309794 GGGGCATGCATGTGCACATGGGG - Intergenic
1004184136 6:13407449-13407471 GCAGCATACAGAAGAAAATGGGG - Intronic
1005118131 6:22360963-22360985 GCAGCACACAGGAGCCCTTGTGG - Intergenic
1006252458 6:32799360-32799382 GCAGCATCCAGGACCAGAAGAGG + Intergenic
1006656351 6:35596887-35596909 GCAGGAGGCAGGAAAACATGGGG - Intronic
1006897286 6:37479293-37479315 GCATCCTGCAGGAGTACTTGAGG - Intronic
1007393998 6:41566917-41566939 GGGCCATGGAGGAGCACATGAGG - Intronic
1007622468 6:43223415-43223437 GCAGAATGCAGGAGCAGAAGGGG - Intronic
1007931907 6:45699225-45699247 GAAGCATTCAGGAGGACATGAGG - Intergenic
1008778134 6:55065997-55066019 GCAGCAGTCAGGAGGACAGGTGG + Intergenic
1008837972 6:55860816-55860838 GCAAAATGCAGAAGTACATGAGG - Intronic
1009735944 6:67675666-67675688 GCAGCGTGGATGAGGACATGAGG - Intergenic
1010015768 6:71103870-71103892 GCAGCAGGCTGAGGCACATGGGG + Intergenic
1013190014 6:107794383-107794405 GCAGCCTGGAGGGGCACATTCGG + Intronic
1013911783 6:115284224-115284246 GCAGCAAGCAGGAAAACAAGAGG + Intergenic
1015195499 6:130521043-130521065 ACACCATGCAGGGTCACATGGGG - Intergenic
1017031239 6:150224645-150224667 ACAGCATGCAAGAACAGATGGGG - Intronic
1017600192 6:156071895-156071917 GTAGCGTGCATGTGCACATGGGG - Intergenic
1018024888 6:159797308-159797330 GCATCATGTAGAAGCACTTGTGG + Exonic
1018215092 6:161518703-161518725 GCAGCAGGCAGGAGGATGTGTGG - Intronic
1019235474 6:170608882-170608904 GCAGCAGGCAGGAGAACTCGGGG + Intergenic
1020430596 7:8113009-8113031 GCAGCAGGAAGGACAACATGGGG - Intergenic
1020579278 7:9974011-9974033 GCAGCATGCCGGAGCAACAGAGG + Intergenic
1021175119 7:17441047-17441069 GCAGCAGGCAAGAACGCATGTGG + Intergenic
1021736659 7:23645929-23645951 GAGGCATCCAGGAGCACATTAGG - Intergenic
1024087837 7:45911415-45911437 GCAGAATCCTGGAGCACCTGGGG - Intergenic
1027139585 7:75647773-75647795 GCACCATGCACTTGCACATGTGG + Intronic
1027381399 7:77613620-77613642 GAAGCAGGCAGGATCACCTGAGG + Intronic
1029105446 7:98171563-98171585 GCAGCGAGCAGGAGCACATGCGG + Exonic
1029732317 7:102446623-102446645 GCAGGATGCAGGTGCTGATGAGG - Exonic
1030335732 7:108324006-108324028 GCAGCAAGCAGGAGAACAGTGGG + Intronic
1032582764 7:133118408-133118430 GCCGCATGGAGAAGCCCATGTGG + Intergenic
1032783331 7:135182062-135182084 CCAGCATCCAGCAGGACATGTGG - Intergenic
1033633410 7:143184173-143184195 CCAGCATGGAGGCTCACATGGGG + Exonic
1033652329 7:143352506-143352528 GCAGACTGCAGGAGCAGACGTGG - Intergenic
1033712859 7:143966814-143966836 ACAGGATGCAGGTGCAAATGGGG - Intergenic
1034281128 7:149855189-149855211 CAAGCATGCTGGAACACATGGGG + Intronic
1034863348 7:154619037-154619059 GCAGCAGGCAGGAGAATGTGTGG - Intronic
1035528722 8:334945-334967 GCAGGCAGGAGGAGCACATGGGG + Intergenic
1035723942 8:1813287-1813309 GTAGGATGCGGGACCACATGAGG - Intergenic
1036625867 8:10470986-10471008 GGAGCATGCAGAACCACATGGGG - Intergenic
1037045894 8:14302996-14303018 GCAGCATGCTAGAGCAAAGGAGG - Intronic
1037068031 8:14607562-14607584 GCAGCATTCAAGAGTGCATGTGG - Intronic
1038560878 8:28578690-28578712 GCATCATGGAGGCACACATGTGG + Intergenic
1039630992 8:39110876-39110898 GCTGGAAGCAGGAGGACATGAGG - Intronic
1040829914 8:51664893-51664915 GCTCTATGCAGGTGCACATGTGG + Intronic
1041940842 8:63385872-63385894 GCAGGAGGCAAGAGCACAAGAGG + Intergenic
1042510132 8:69602633-69602655 GTATGATGCAGCAGCACATGTGG - Intronic
1045351962 8:101349609-101349631 GCAGCCTGTAGCATCACATGGGG + Intergenic
1045623221 8:104007551-104007573 ACAGCATGCATGAACAGATGGGG - Intronic
1048015439 8:130492406-130492428 GCAGCAAGTTGGGGCACATGAGG - Intergenic
1048353413 8:133634294-133634316 GCAGCCTGCAGTGGCAAATGGGG + Intergenic
1049080482 8:140439152-140439174 GCCGCATGCGGAAGCACGTGGGG - Exonic
1049524093 8:143112096-143112118 GCAGAATGGAAGAGCACGTGTGG - Intergenic
1049698412 8:143994829-143994851 TCAGCATGCTGGAGCACAGGCGG - Intronic
1056020153 9:82431985-82432007 GCAACATGCATAAGAACATGAGG - Intergenic
1056313718 9:85368667-85368689 CCAGGGTGCAGGGGCACATGGGG - Intergenic
1057076176 9:92139300-92139322 GAAGCAGGCAGGAGCTCATGTGG - Intergenic
1057619770 9:96624600-96624622 GCAGCATTCAGTAGCACCGGTGG - Intergenic
1058169360 9:101661172-101661194 GCAGACAGCAGCAGCACATGTGG + Intronic
1059899879 9:118911908-118911930 GAAGCATGCAGAAGCACAGGAGG + Intergenic
1060011481 9:120046614-120046636 GCAGGAAGCAGCAGCAGATGAGG + Intergenic
1060755353 9:126208473-126208495 GCTGCCTGCAGGAGCTCTTGGGG - Intergenic
1062406119 9:136397522-136397544 GGAGCATGGAGGAGAGCATGTGG + Intronic
1062447470 9:136601727-136601749 GCAGGATGCAGGCACACATGCGG - Intergenic
1186262789 X:7798089-7798111 GCAGCAGGCAAGAGAGCATGTGG - Intergenic
1189549421 X:42077665-42077687 ACAGAATGCAGGAGTAAATGAGG - Intergenic
1190063626 X:47226039-47226061 GCAGGAAGCAGGGGCACAAGGGG + Intronic
1190913639 X:54794044-54794066 GCAGCTTCCAGGAGCACTGGGGG + Intronic
1192113950 X:68393103-68393125 GGAGCATGCAGGTGAACAGGTGG - Intronic
1195026743 X:100885195-100885217 GCAGCAGGCAGGAGGTCATTAGG + Intergenic
1199266543 X:145834603-145834625 ACAGCCTGCAGGAACACTTGTGG - Intergenic
1199659818 X:150037819-150037841 ACAACATGCAGGGCCACATGGGG - Intergenic
1201226383 Y:11822854-11822876 CCAGCATGTAAGAGCCCATGTGG + Intergenic
1201713147 Y:17014126-17014148 GCAAAAGGCAGAAGCACATGAGG + Intergenic