ID: 917157883

View in Genome Browser
Species Human (GRCh38)
Location 1:172024716-172024738
Sequence CCTAGCAAAGAGAAGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 7, 3: 143, 4: 528}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917157872_917157883 16 Left 917157872 1:172024677-172024699 CCTCACCTGGGAAGCGCATGGGG 0: 2
1: 669
2: 1396
3: 2275
4: 2519
Right 917157883 1:172024716-172024738 CCTAGCAAAGAGAAGCTGGGAGG 0: 1
1: 0
2: 7
3: 143
4: 528
917157875_917157883 11 Left 917157875 1:172024682-172024704 CCTGGGAAGCGCATGGGGTTGGG 0: 2
1: 23
2: 291
3: 1310
4: 2089
Right 917157883 1:172024716-172024738 CCTAGCAAAGAGAAGCTGGGAGG 0: 1
1: 0
2: 7
3: 143
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917157883 Original CRISPR CCTAGCAAAGAGAAGCTGGG AGG Intronic
900426520 1:2582663-2582685 CCAAGCAAAACGGAGCTGGGAGG - Intergenic
900735261 1:4295647-4295669 CCTCGAAAAGAGCAGCTGGGTGG + Intergenic
901004792 1:6166465-6166487 CCCAGCAAAGAGCACCGGGGCGG + Intronic
901080189 1:6579831-6579853 CCTAGCAACGTCAATCTGGGCGG - Intergenic
901662544 1:10807628-10807650 CATAGCAAAGAGAACATGGAAGG - Intergenic
902867098 1:19286828-19286850 CCTAGCAAAGAGCAGGTTTGAGG + Intronic
902936687 1:19769692-19769714 CCTGGCAGAGAGGAGCTGGTGGG + Intronic
903713334 1:25343270-25343292 AATAGCTGAGAGAAGCTGGGAGG - Intronic
904003618 1:27351804-27351826 CCTTCCATAGAGAACCTGGGAGG + Intronic
904534185 1:31188323-31188345 ACTACCAAAGGGATGCTGGGGGG + Intronic
906843158 1:49161278-49161300 CCTAACCAAGGGAAGCTGTGAGG - Intronic
907015117 1:51005151-51005173 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
907565566 1:55430475-55430497 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
907592141 1:55685536-55685558 ACTAGCTAAGAGACACTGGGAGG - Intergenic
908258041 1:62318707-62318729 CCTAGCTCGGAAAAGCTGGGCGG + Intronic
908395148 1:63718614-63718636 GGTGGCAGAGAGAAGCTGGGGGG + Intergenic
909536483 1:76741869-76741891 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
911530644 1:99039468-99039490 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
912032442 1:105265608-105265630 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
912137207 1:106676135-106676157 CCTCACAAAGTAAAGCTGGGTGG - Intergenic
912186548 1:107283313-107283335 CCTAGGAAAGAAGAGCTGGTAGG - Intronic
912675731 1:111679304-111679326 CCTAGCCAAGGGAAGCCGTGAGG + Intronic
912966173 1:114239477-114239499 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
913958797 1:143323887-143323909 CCTGGCACAGAGCAGCTGGGCGG + Intergenic
914053114 1:144149267-144149289 CCTGGCACAGAGCAGCTGGGCGG + Intergenic
914126083 1:144817274-144817296 CCTGGCACAGAGCAGCTGGGCGG - Intergenic
915654549 1:157348498-157348520 CCTAGCCAAGGGAGGCTGTGAGG - Intergenic
915876461 1:159616288-159616310 CCTAGCCGAGGGAAGCTGTGAGG + Intergenic
915992333 1:160530190-160530212 CCTAGCCAAGGGAAGCTGGGAGG - Intergenic
916257585 1:162805572-162805594 CCCAGAGAAGCGAAGCTGGGGGG - Intronic
916612867 1:166410133-166410155 ACTAGCCAAGGGAAGCTGTGGGG - Intergenic
916625666 1:166552645-166552667 CCTAACCAAGGAAAGCTGGGAGG - Intergenic
916916035 1:169407844-169407866 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
916938489 1:169656176-169656198 CCTAGCCAAGGGAAGCAGTGAGG + Intergenic
916941083 1:169679225-169679247 TTTAGTAAAGAGAAGGTGGGTGG - Intronic
917023435 1:170614754-170614776 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
917157883 1:172024716-172024738 CCTAGCAAAGAGAAGCTGGGAGG + Intronic
917686821 1:177424784-177424806 CCTAGGAAAGAGGATCTGGAAGG - Intergenic
917915149 1:179694267-179694289 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
918167300 1:181962126-181962148 CCTAGCCAAAAGAAGCTGTGAGG - Intergenic
918353744 1:183684814-183684836 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
918501559 1:185201477-185201499 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
919535016 1:198776648-198776670 CCCAGCTAAGACAGGCTGGGTGG - Intergenic
919601832 1:199632759-199632781 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
919613181 1:199772254-199772276 CCTGGTAAAGGGAATCTGGGTGG + Intergenic
920725574 1:208431774-208431796 CGGAGAAGAGAGAAGCTGGGAGG - Intergenic
921086522 1:211798932-211798954 CCTAGAAAAGAGAGGGAGGGAGG + Intronic
921461613 1:215433380-215433402 CCTACCCAAGGGAAGCTGTGAGG - Intergenic
922396734 1:225209914-225209936 CCTAGCCAAGAGAAGTTGTGAGG + Intronic
922575476 1:226658414-226658436 CCTGCCAAAAAGGAGCTGGGAGG + Intronic
922715946 1:227872103-227872125 TCTAGCCAAGGGAAGCTGTGAGG + Intergenic
923408450 1:233685859-233685881 GAAAGCAAAGAGAGGCTGGGAGG + Intergenic
923421663 1:233822185-233822207 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
924184607 1:241475068-241475090 CCTAACAAAGAAAAGCAGAGAGG - Intergenic
924295951 1:242586854-242586876 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
924894005 1:248316579-248316601 CCTGGCACAGAGCACCTGGGGGG - Intergenic
1063202489 10:3797304-3797326 TCTAGAAAACAGAAGGTGGGTGG - Intergenic
1063764232 10:9119536-9119558 CGTAGGAAACAGAAGTTGGGAGG + Intergenic
1064757790 10:18587704-18587726 CCCAGCCAAGAGAAGCTGTGAGG + Intronic
1065427350 10:25619398-25619420 CCTAGCCAAGAGCAGCTGTGAGG + Intergenic
1065628401 10:27653970-27653992 TCAAGCAAAGAGAGGCTCGGGGG + Intergenic
1066057200 10:31693325-31693347 AGGAGCAAAGAGAAGCTTGGTGG - Intergenic
1066159596 10:32714315-32714337 CCTAGCCAAGGGAAGCCGTGAGG + Intronic
1066724034 10:38371253-38371275 CCCAGAGAAGCGAAGCTGGGGGG - Intergenic
1066758890 10:38736732-38736754 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1066962746 10:42236036-42236058 CCTGGCACGGAGCAGCTGGGCGG + Intergenic
1067251949 10:44594053-44594075 CCTAGCCAAGGGAAGCGGTGAGG + Intergenic
1068797693 10:61102198-61102220 CCCAGAAAAGAGAACCAGGGAGG + Intergenic
1068951505 10:62782219-62782241 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1071002088 10:80841978-80842000 CCTAGCCAAGGGAAGCTCTGAGG - Intergenic
1072392112 10:94997863-94997885 CCAAGGAAAGAGAAGCTGCAGGG - Intergenic
1072838003 10:98737488-98737510 CCTAGCCAAGAGAAGCCATGAGG - Intronic
1072876110 10:99175028-99175050 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
1073559026 10:104481395-104481417 CAGAGCAAACAGAAACTGGGAGG - Intergenic
1073884128 10:108019102-108019124 TCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1074553145 10:114463853-114463875 CCTTCCAAAGTGAAGCTGGAGGG - Intronic
1074823977 10:117201670-117201692 CCTGGCACATAGAAACTGGGAGG + Intronic
1074985238 10:118652505-118652527 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1076807559 10:132866633-132866655 CTTAGCGAGGAGAGGCTGGGGGG - Intronic
1077297922 11:1834714-1834736 CCCAGGAGAGAGAAGCAGGGAGG + Intronic
1078392967 11:10952486-10952508 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1078860386 11:15241082-15241104 CCTAGCAAAAAGAAGTTGGGTGG - Intronic
1079262596 11:18897761-18897783 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1079799842 11:24854856-24854878 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1080117662 11:28638878-28638900 CCTACCCAAGGGAAGCTGTGAGG + Intergenic
1080134228 11:28835492-28835514 CTTAGCAAAAAGAATCTGGGTGG + Intergenic
1080530719 11:33173195-33173217 CCTCCCAGACAGAAGCTGGGAGG + Intergenic
1081118217 11:39231986-39232008 CCTATCCAAGGGAAGCTGTGAGG + Intergenic
1081317790 11:41651310-41651332 TCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1081957268 11:47104355-47104377 GCTAACAAAGAGAAGCTGAAGGG - Intronic
1082842212 11:57698956-57698978 CCCAGCAACGGGAAGCTGAGAGG + Exonic
1083385592 11:62306887-62306909 TCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1084688821 11:70712958-70712980 TCGAGCAAAGAGGAGCAGGGCGG - Intronic
1085060211 11:73438956-73438978 CCTATCAAAGAAAAGAAGGGGGG - Intronic
1085406909 11:76268830-76268852 CCTGGCACAGAGGAGATGGGTGG - Intergenic
1086129133 11:83382905-83382927 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1086335474 11:85796640-85796662 ACTAGAACAGAGGAGCTGGGAGG - Intronic
1086611821 11:88766433-88766455 CCTAGCAAAAAGAAGCAATGGGG + Intronic
1087285260 11:96258474-96258496 CCTGGCACAGAGGAGCTGGGAGG + Intronic
1087427714 11:98012297-98012319 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1088066400 11:105725808-105725830 CCTAGCCAAGAGAAGCCATGAGG + Intronic
1088294548 11:108277607-108277629 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
1088702482 11:112425985-112426007 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1089500510 11:118929075-118929097 CCAAGCGGAGAGAAGCAGGGCGG + Intronic
1090688807 11:129155989-129156011 CCTAGCCAAGGGAAGATGTGAGG + Intronic
1091712298 12:2750564-2750586 CCTAGCCAAGGGAAGCCGTGGGG - Intergenic
1092567759 12:9686074-9686096 CCTAGCCAAGGGAAGTTGTGAGG - Intronic
1092638824 12:10481587-10481609 CTTAGCCAAGGGAAGCTGTGAGG + Intergenic
1092690842 12:11108582-11108604 CCTAGCCAAGGGAAGCTGTAAGG + Intronic
1093213645 12:16337102-16337124 GTTAGAAAAGAGAGGCTGGGAGG + Intergenic
1093545120 12:20336856-20336878 TCTAGCCAAGGGAAGCCGGGAGG - Intergenic
1093835671 12:23825300-23825322 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
1095230561 12:39734134-39734156 CCTAGTCAAGGGAAGCTGTGAGG - Intronic
1095832402 12:46601808-46601830 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1096469831 12:51869152-51869174 TCCAGCAAAGAGATGCTGGTGGG + Intergenic
1097119372 12:56719741-56719763 CCTAGCAAAGAAAAGCCTTGGGG - Exonic
1097752919 12:63377997-63378019 CCTACCCAAGGGAAGCTGTGAGG + Intergenic
1097898865 12:64853717-64853739 CCTAGCAAAGGGAAGCCTTGAGG - Intronic
1098684663 12:73403508-73403530 CCTAGCAAAGTGAAAGTGTGGGG - Intergenic
1099551103 12:84044007-84044029 CATAGCCAAGGGAAGCTGTGAGG - Intergenic
1100739979 12:97581304-97581326 CCTAGCCAAGGGAAGCTCTGAGG + Intergenic
1100942639 12:99740813-99740835 CCTAGCCAAGAGAAGCCGTGAGG + Intronic
1101058787 12:100948999-100949021 CCTAGCAAAGAAAGGTGGGGTGG + Intronic
1101069932 12:101063111-101063133 CCTAGCCAAGAGAAGCCCTGAGG - Intronic
1101534188 12:105602326-105602348 CCCAGGAAAGAGAAGCTTGCTGG - Intergenic
1101821837 12:108190505-108190527 CCTAGCCAATAGAACCTGGAAGG + Intronic
1103255721 12:119539909-119539931 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1103659841 12:122505084-122505106 TCCAGCACAGATAAGCTGGGTGG - Exonic
1104347423 12:128013825-128013847 CCTAGCAAAGTGAGGGTGGGAGG + Intergenic
1106362994 13:29049772-29049794 CCTACCACAGAGCAGCAGGGAGG + Intronic
1106650802 13:31688143-31688165 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1106983928 13:35322324-35322346 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
1107473520 13:40713079-40713101 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1108048866 13:46409318-46409340 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1108135332 13:47351184-47351206 CCCAGGAAAGAGAGGCTGGTTGG - Intergenic
1108171622 13:47747958-47747980 CCTGACAAGGAGAAGCTGGCAGG - Intergenic
1108850179 13:54718637-54718659 GCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1109195860 13:59377036-59377058 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1109257299 13:60098478-60098500 CCTGGTAAAAAGGAGCTGGGAGG + Intronic
1109541397 13:63782664-63782686 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1109661667 13:65467647-65467669 CCTAGCCAAGGGAATCTGTGAGG - Intergenic
1110247752 13:73346070-73346092 CCTATCCAAGGGAAGCTGTGAGG - Intergenic
1110337208 13:74346497-74346519 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1111627888 13:90813114-90813136 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1114335963 14:21690175-21690197 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1114449540 14:22815966-22815988 CCATGCAAAGAGAGACTGGGGGG + Intronic
1114695546 14:24623941-24623963 CCCAGCCAAGAGAAGCTGTGAGG - Intergenic
1114844835 14:26308827-26308849 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1115842814 14:37490676-37490698 CCTACCCAAGGGAAGCTGTGAGG - Intronic
1115912226 14:38269186-38269208 CCTGGCCAAGGGAAGCTGTGAGG - Intergenic
1116009335 14:39332647-39332669 CCTAGCCAAGAGAAGCCATGAGG - Intronic
1116572511 14:46535326-46535348 CCTAGCCAAGAGAAGCCATGAGG - Intergenic
1116767721 14:49092464-49092486 CCCAGTAAAGAGAATCTAGGGGG + Intergenic
1117599931 14:57364821-57364843 CCTAGCCAAGAGAAGCTGTGAGG + Intergenic
1117624156 14:57618452-57618474 CCTACCCAAGGGAAGCCGGGAGG + Intronic
1119187293 14:72651866-72651888 CCCAGCAAAGGCAATCTGGGTGG - Intronic
1119923731 14:78471883-78471905 CACCACAAAGAGAAGCTGGGTGG + Intronic
1120032645 14:79660125-79660147 TCTAGAAAAGAGAAGATGTGAGG - Intronic
1120137213 14:80884572-80884594 CCTAGCCAAGGGAAGCCGTGAGG + Intronic
1120450106 14:84655809-84655831 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1120602086 14:86523468-86523490 CCTTGAAAAGGGAAGCTGGATGG - Intergenic
1120843225 14:89105052-89105074 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1121470659 14:94151766-94151788 CCTAGCCAAGGGAAGCTCTGAGG - Intronic
1121920135 14:97872852-97872874 GCAAGCCCAGAGAAGCTGGGAGG - Intergenic
1202929611 14_KI270725v1_random:26303-26325 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1123393139 15:19898831-19898853 CCCAGCAATGACAAGCTGTGCGG + Intergenic
1123422686 15:20144920-20144942 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1123442320 15:20301429-20301451 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1123531912 15:21151460-21151482 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1123804934 15:23860975-23860997 CCCAGCGAAGAGAAGGTGGTGGG - Intergenic
1123907281 15:24933415-24933437 CCTAGAGGAGAGAGGCTGGGAGG + Intronic
1124037234 15:26065839-26065861 CTGAGCAAAGAGAAGCAGAGAGG - Intergenic
1124474739 15:30023112-30023134 CCCAGCCAAGGGAAGCTGTGAGG - Intergenic
1124952679 15:34337960-34337982 CCTTGCGAAGAGAAGCCCGGGGG + Intronic
1125330065 15:38573796-38573818 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1126554013 15:49966034-49966056 CCTAGCAAAGGGAAGCCTTGAGG + Intronic
1127157979 15:56149617-56149639 CCTACCCAAGGGAAGCTGTGAGG + Intronic
1127317947 15:57815323-57815345 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1128692819 15:69738146-69738168 TTTGGCAAAGAGAAGGTGGGTGG - Intergenic
1129210442 15:74065001-74065023 CCTGGAAAAGAGAGGCTGGAAGG - Intergenic
1129508026 15:76099302-76099324 CCTACCCAAGGGAAGCTGTGAGG - Intronic
1130441855 15:83962931-83962953 CCTAGCCAAGGGAAGCCGTGAGG + Intronic
1130628569 15:85541549-85541571 CCTAGCAAAAAGAAACAGGGTGG + Intronic
1130913845 15:88289781-88289803 CTTGGCAAAGAGAAGGGGGGGGG - Intergenic
1132114362 15:99124892-99124914 CCTAGAAAGGGGAAGCTGTGGGG + Intronic
1132417824 15:101636590-101636612 CCTAGCAAAATGAATCCGGGAGG - Intronic
1132748457 16:1446654-1446676 CCTGGGAAAGAGAGGCTTGGAGG - Exonic
1135428356 16:22359630-22359652 CGGAGCAAAGAGAATCTGAGGGG + Intronic
1135646067 16:24163082-24163104 CCTGGGAAAGAGAATCTGGTTGG + Intronic
1136718897 16:32304121-32304143 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136723918 16:32342477-32342499 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136773019 16:32857837-32857859 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1136837270 16:33510385-33510407 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136842246 16:33548521-33548543 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136862060 16:33710421-33710443 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1136897596 16:34003682-34003704 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1137497766 16:48983906-48983928 CCTCACAAAGAGAATTTGGGGGG + Intergenic
1137540103 16:49356158-49356180 CCCAGCAAAGAGAGACTTGGAGG + Intergenic
1138151481 16:54661576-54661598 CCTAGCAAAGGGAAGCCATGAGG + Intergenic
1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG + Intronic
1140165173 16:72543420-72543442 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1203002513 16_KI270728v1_random:175288-175310 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203007534 16_KI270728v1_random:213650-213672 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203075444 16_KI270728v1_random:1119947-1119969 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203123554 16_KI270728v1_random:1558604-1558626 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203134118 16_KI270728v1_random:1711694-1711716 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203147446 16_KI270728v1_random:1810664-1810686 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1203152411 16_KI270728v1_random:1848818-1848840 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1143890092 17:10096365-10096387 CCTGGCAAACAGAAGAGGGGAGG - Intronic
1144371715 17:14597696-14597718 CCTAGCCAAGGGATGCTGTGAGG + Intergenic
1146480345 17:33200147-33200169 GCTAGCGAAGAGAAGCTCGGGGG - Intronic
1146835004 17:36103674-36103696 CCTGGGGAAGAGAAGCTGAGAGG + Exonic
1146849617 17:36210909-36210931 CCTGGGGAAGAGAAGCTGAGAGG + Intronic
1147955085 17:44128642-44128664 CCAGGCAAAGAGAAGAAGGGAGG - Intergenic
1149066146 17:52481661-52481683 CCTGGTAAAGAGAGTCTGGGTGG + Intergenic
1149426265 17:56557680-56557702 CCTACCAAAATGACGCTGGGTGG + Intergenic
1150656908 17:67045217-67045239 CCCTGCAAAGAAAAGCTAGGTGG + Intronic
1151246088 17:72796079-72796101 CCTAGCAAATGGAGGCTGGTTGG - Intronic
1151419436 17:73987552-73987574 CCCAACATAGAGCAGCTGGGCGG - Intergenic
1151565437 17:74894724-74894746 CCTAGGAAAGAGAAGTTGGGTGG + Intergenic
1152685523 17:81691886-81691908 AGTAGCACAGAGAAGCTGCGGGG + Intronic
1153091426 18:1349621-1349643 CCTAGGATACAGAAGATGGGAGG + Intergenic
1153525486 18:5991092-5991114 CCAAGCAAAGAGAAGAGGGGTGG - Intronic
1154415802 18:14174624-14174646 CCTGGCACGGAGCAGCTGGGAGG + Intergenic
1155384865 18:25266664-25266686 CCTAGCCAAGGGAAGATGTGAGG + Intronic
1155395244 18:25379992-25380014 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1156230813 18:35152414-35152436 CCTAGCCAAGGGAAGCAGTGAGG - Intergenic
1158350762 18:56562911-56562933 CCCAGGGAAGAGAAGCTTGGAGG + Intergenic
1161256666 19:3313688-3313710 CCAAGCAGAGACAAGTTGGGGGG - Intergenic
1162064300 19:8115745-8115767 CCTAGCAGAGAGGACCTGTGCGG - Intronic
1162714064 19:12618159-12618181 CCTTGCAAAGCCAAGGTGGGTGG - Intronic
1163260249 19:16185349-16185371 CCAATCAAAGAGAAGCGAGGCGG + Intergenic
1163323502 19:16588225-16588247 CCTAGAAGAGAGAGGCTGAGAGG - Intronic
1163767654 19:19172304-19172326 CCCAGCAGAGCGAAGCTGGCTGG + Intronic
1164283496 19:23789975-23789997 CATACAAAAAAGAAGCTGGGGGG - Intronic
1164737423 19:30552114-30552136 CCTTGCAAAGGGAAGCTAGTGGG - Intronic
1165970462 19:39624494-39624516 CCTACCCAAGGGAAGCTGTGAGG - Intergenic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166863647 19:45823536-45823558 CCCAGGAAAGAGAAGCAGGCAGG + Intronic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167974193 19:53210530-53210552 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1202692509 1_KI270712v1_random:101690-101712 CCTGGCACAGAGCAGCTGGGCGG + Intergenic
924967298 2:90776-90798 CCTAGCCAAGAGAAGCTGTGAGG + Intergenic
925252512 2:2451919-2451941 CCTAGCCAAGAGAAGCTGTGAGG - Intergenic
926463774 2:13165352-13165374 GAAAGCAAAGAGAGGCTGGGAGG + Intergenic
926827662 2:16923505-16923527 CCAAACAAAGCGAAGCTGGGAGG + Intergenic
927021390 2:19020718-19020740 CCTACCCAAGGGAAGCTGTGAGG - Intergenic
927050086 2:19319679-19319701 CCTATCAAAGAGCAACTGGAAGG + Intergenic
927182733 2:20458519-20458541 CCTAGCCAAGGGAAGCTATGAGG + Intergenic
929062974 2:37942128-37942150 CCTAGCCAAGAGGAGCTGTGAGG - Intronic
929333606 2:40713180-40713202 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
929837950 2:45425747-45425769 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
931212151 2:60207540-60207562 CCTAGCCAAGGGAAGCAGTGAGG - Intergenic
931538597 2:63304497-63304519 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
932216094 2:69966853-69966875 CCTAACATACAGAAGATGGGGGG + Intergenic
933021849 2:77204191-77204213 CATAGCACTGAGTAGCTGGGTGG + Intronic
933953892 2:87352281-87352303 CCTGGCACAGAGCAGCTGGGCGG - Intergenic
934238092 2:90248527-90248549 CCTGGCACAGAGCAGCTGGGCGG - Intergenic
934275106 2:91568209-91568231 CCTGGCACAGAGCAGCTGGGCGG + Intergenic
934322217 2:91981072-91981094 CCTGGCATGGAGTAGCTGGGCGG - Intergenic
934460505 2:94211863-94211885 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
935683678 2:105663902-105663924 CCAAGCAAAAAGAAGCTATGTGG - Intergenic
936680093 2:114760135-114760157 CCTGGTAAAGAGGATCTGGGTGG - Intronic
936807840 2:116358645-116358667 CCTAGCCAAGAGAAGCCCTGGGG + Intergenic
936900052 2:117472409-117472431 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
937188373 2:120068194-120068216 CCTAGCCAAGAGAAGCCATGAGG + Intronic
937573450 2:123391588-123391610 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
937647968 2:124286725-124286747 CCTGGAAAAGAGGAGATGGGCGG - Intronic
937807222 2:126160696-126160718 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
938874491 2:135518483-135518505 CTTAGCCAAGGGAAGCTGTGAGG - Intronic
939298184 2:140297164-140297186 CATAGGAGAAAGAAGCTGGGGGG + Intronic
939840546 2:147182429-147182451 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
940054603 2:149500438-149500460 CCAAGCCAAGGGAAGCTGTGAGG - Intergenic
940195328 2:151088128-151088150 CTCAGAAAAGAGAAGATGGGGGG - Intergenic
940330058 2:152464941-152464963 CCTAGCAGAGGGAAGCTAGATGG - Intronic
940998951 2:160180902-160180924 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
941518780 2:166511783-166511805 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
941682401 2:168413270-168413292 CCTAGCCAAGGGAGGCTGTGAGG - Intergenic
942431361 2:175914527-175914549 CCTAGACAAGGGAAGCTGTGAGG - Intergenic
943350653 2:186792928-186792950 CCTAGCCAAAGGAAGCTGTGAGG + Intergenic
943409728 2:187532494-187532516 CCTAGCCAAGGGAAGCCGTGAGG + Intronic
943552556 2:189357950-189357972 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
944635341 2:201670973-201670995 CCTAGCCAAGGAAAGCTGTGAGG + Intronic
945207165 2:207344372-207344394 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
945466977 2:210181228-210181250 CCTAGCCAAGGGAAGCCAGGAGG + Intergenic
945945136 2:215988308-215988330 CTTAGCCAAGGGAAGCTGTGAGG + Intronic
945990093 2:216388783-216388805 CCTAGCAAAGTGAAAGTGGGAGG - Intergenic
946119526 2:217497545-217497567 CCTAGCCATGACAAGATGGGAGG - Intronic
947070968 2:226287734-226287756 CCCAGTAAAGGGAATCTGGGTGG - Intergenic
948379102 2:237540780-237540802 CCTAGGAAAGAGAAGGACGGAGG - Exonic
948883431 2:240871586-240871608 CAGAGCAAAGAGGACCTGGGAGG - Intronic
1169181778 20:3575260-3575282 TCTAGAAAAGAGAAGCTGCATGG - Intronic
1169397112 20:5241946-5241968 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1169933527 20:10858646-10858668 CATAGCAGAGAGGAGCTGGAAGG + Intergenic
1170167968 20:13381302-13381324 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1170488077 20:16840499-16840521 CCTAGAAGAGAGAAGCTGGTTGG + Intergenic
1170759490 20:19237212-19237234 CCATGGAAAGAGAAGTTGGGAGG + Intronic
1171000785 20:21413741-21413763 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171464365 20:25317386-25317408 CTTGGCACAGGGAAGCTGGGAGG - Intronic
1172466707 20:35160856-35160878 CCTAGCCAAGGGAAGCGGTGAGG + Intergenic
1172642508 20:36449247-36449269 CCTAGCAGAAAGAAGCTGAGTGG - Intronic
1172995489 20:39067273-39067295 CAAAGCAAGGAAAAGCTGGGTGG + Intergenic
1173033923 20:39390444-39390466 CCTATGAAAGAGAAAGTGGGTGG + Intergenic
1174990212 20:55500800-55500822 CCTACCCAAGGGAAGCTGTGAGG - Intergenic
1176591633 21:8654902-8654924 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1176857538 21:13984680-13984702 CCTGGCACGGAGCAGCTGGGAGG - Intergenic
1176891718 21:14327071-14327093 CCTAGCCAAGGGAAGCCAGGAGG + Intergenic
1177050224 21:16224544-16224566 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1177313173 21:19424068-19424090 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1177517861 21:22177852-22177874 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1178007049 21:28233962-28233984 CCTAGCCAAGGGAATCTGTGAGG + Intergenic
1178393500 21:32219391-32219413 CCTAGCCAAGAGAAGCCATGAGG + Intergenic
1178702523 21:34845484-34845506 CGTAACACAGAGGAGCTGGGAGG - Intronic
1178864512 21:36316902-36316924 TCTACCCAAGGGAAGCTGGGAGG - Intergenic
1179926739 21:44539051-44539073 CCCAGAGCAGAGAAGCTGGGAGG + Exonic
1179937168 21:44613111-44613133 CCCAGAGCAGAGAAGCTGGGAGG - Intronic
1180274481 22:10632014-10632036 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1180548970 22:16526991-16527013 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1180914975 22:19479666-19479688 CCCAGAAAAGCGACGCTGGGCGG - Intronic
1181745832 22:24954198-24954220 CCTTGCAGAGAGAAGCTCTGAGG + Intronic
1182029068 22:27143399-27143421 CCAAGCATAGAGGAGCAGGGTGG - Intergenic
1182204422 22:28609496-28609518 CCTAGCCAAGAGAAGCCATGAGG + Intronic
1182952563 22:34391037-34391059 CCTAGCCAAGGAAAGCTGGGAGG - Intergenic
1183021556 22:35031172-35031194 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1183297962 22:37043283-37043305 CCCAGCAAGGAGCAGCTGGCAGG - Intergenic
1185088292 22:48752500-48752522 CCTATGGAAGAGCAGCTGGGGGG - Intronic
949173943 3:1035354-1035376 CCTATCCAAGGGAAGCTGTGAGG - Intergenic
950340759 3:12242058-12242080 AATAGAAAAGAGAATCTGGGTGG - Intergenic
950495781 3:13333493-13333515 CAGAGCACAGAGGAGCTGGGAGG - Intronic
950597531 3:13997516-13997538 CCTACCCAAGGGAAGCTGGGAGG - Intronic
951347304 3:21561372-21561394 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
951629180 3:24699695-24699717 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
951653742 3:24981687-24981709 CCTAACCAAGGGAAGCTGTGAGG - Intergenic
951741618 3:25931395-25931417 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
951795549 3:26534223-26534245 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
952098667 3:29985574-29985596 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
952195908 3:31075152-31075174 CCTAGTAAAGAGATGGTGGGGGG + Intergenic
952216253 3:31280529-31280551 CATAGCAAAGAGCAGCTGTAGGG - Intergenic
952423082 3:33148731-33148753 CCTAGCAAAGGGGACCTGGGAGG + Intergenic
953047169 3:39304442-39304464 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
954530999 3:51320234-51320256 CCTAGCCAAGAGAAGCCATGAGG + Intronic
955447738 3:59032111-59032133 CCTAGCCAAGGGAAGCGGTGAGG + Intronic
955657897 3:61264042-61264064 CCTAGTCAAGGGAAGCTGTGAGG - Intergenic
956207787 3:66772048-66772070 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
956436324 3:69237680-69237702 CCTATGAAAGAGAAGCTGAGAGG - Intronic
957303672 3:78427827-78427849 CCTTACAAAGAGAACATGGGAGG + Intergenic
958499768 3:94890098-94890120 TCTAGGAGAGAGAAGCTGGTTGG - Intergenic
958793524 3:98681732-98681754 CCTAGCCAACGGAAGCTGTGAGG + Intergenic
959005162 3:101011746-101011768 CCTAGGAATGACAAGCTGGGTGG - Intergenic
959120177 3:102223303-102223325 CCCAGCCAAGGGAAGCTGTGAGG - Intronic
959345645 3:105191402-105191424 CATAGCCAAGGGAAGCTGTGAGG - Intergenic
959453710 3:106533978-106534000 CCTAGCCAAGGGAAGTTGTGAGG + Intergenic
959534544 3:107470272-107470294 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
959661143 3:108869319-108869341 CCTAGGAAAGAGGAACAGGGAGG - Intergenic
959734917 3:109647803-109647825 CCTAGCCAAGGGAAGCCGGGAGG + Intergenic
960226971 3:115179837-115179859 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
960760147 3:121064198-121064220 CTTAGCCAAGGGAAGCTGTGAGG - Intronic
961210604 3:125122463-125122485 ATAAGCAAAGAGAAGTTGGGAGG + Intronic
961551007 3:127670739-127670761 CTTAGCAGAGAGAAGCAGGAGGG - Intronic
961663501 3:128482759-128482781 CCTTGCAGAGAGAAGCTAGAGGG + Intronic
961977452 3:131042016-131042038 CCTAGCGAAGGGAAGCTGTGAGG + Intronic
962687686 3:137863202-137863224 TCTCACAAAGAGGAGCTGGGAGG - Intergenic
962765646 3:138560276-138560298 ACTAGCCAAGAGAAGCTGGGAGG + Intronic
962969525 3:140385906-140385928 GCTGGCAAAGAGAAGCACGGAGG + Intronic
963014031 3:140803512-140803534 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
963898602 3:150712050-150712072 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
964378094 3:156069399-156069421 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
964509843 3:157438286-157438308 CCTAACGGAGGGAAGCTGGGCGG - Intronic
965002010 3:162966232-162966254 CCCAGCCAAGAGAAGCCGTGAGG + Intergenic
965025442 3:163296655-163296677 CCTAGCCAAGAGAAGCCATGAGG + Intergenic
966309340 3:178576260-178576282 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
966768042 3:183479819-183479841 CAAAGCAAAGAAAAGCTGGCAGG + Intergenic
967181569 3:186909765-186909787 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
968958551 4:3731058-3731080 GCTGGCAGAGAGGAGCTGGGGGG + Intergenic
969605464 4:8200135-8200157 AATAGCAAAGTGACGCTGGGGGG + Intronic
970256242 4:14172949-14172971 GAAAGCAAAGAGAGGCTGGGAGG + Intergenic
971430126 4:26556747-26556769 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
971697823 4:29929530-29929552 CCTAGCCAAGGAAAGCTGTGAGG + Intergenic
971943259 4:33241799-33241821 CCTGGCCAAAAGAAGCTGTGAGG - Intergenic
973073436 4:45894189-45894211 CCAAGCAAAGAGAATCAGCGTGG + Intergenic
973715284 4:53670039-53670061 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
974106308 4:57473118-57473140 CCTACCCAAGGGAAGCTGTGAGG - Intergenic
975104053 4:70548474-70548496 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
975212941 4:71722287-71722309 CCTAGGAAAGAGCAACTGTGTGG - Intergenic
975307537 4:72866716-72866738 CATAGCTAAGGGAAGCTGTGAGG + Intergenic
975764616 4:77654653-77654675 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
976024008 4:80664954-80664976 CCTAGCCAAAGGAAGCTGCGAGG - Intronic
976394840 4:84544867-84544889 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
976655984 4:87489316-87489338 CCTAGCGAAGGGAAGCTGTGAGG - Intronic
976715868 4:88122078-88122100 CCTAGCCAAGAGAAGCCGTGAGG + Intronic
976903580 4:90208730-90208752 CCTAGCCAAGGGAAGCCAGGAGG - Intronic
977153698 4:93546462-93546484 CCTAGCAAAGAGGACCAAGGAGG + Intronic
977154403 4:93555022-93555044 CCTAGCCAAGGGAAGCTTTGAGG + Intronic
977500309 4:97828903-97828925 CCTGGGACAGAGCAGCTGGGAGG + Intronic
977671336 4:99698963-99698985 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
977723544 4:100267990-100268012 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
977897879 4:102384535-102384557 CCTACCCAAGGGAAGCTGTGAGG - Intronic
978102437 4:104859067-104859089 GATAGTCAAGAGAAGCTGGGAGG - Intergenic
978278399 4:106978985-106979007 CCTACCCAAGGGAAGCTGTGAGG - Intronic
979417392 4:120460552-120460574 CCTAACCAAGGGAAGCTGTGGGG + Intergenic
979421330 4:120509022-120509044 CCTAGCCAAGGGAAGCTTTGAGG + Intergenic
979461671 4:120990922-120990944 TCTAGCCAAGGGAAGCTGTGAGG - Intergenic
980157697 4:129126747-129126769 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
980461961 4:133126056-133126078 CCTAGTAAACAGAAGAGGGGAGG + Intergenic
980583707 4:134786832-134786854 CCTAGCCAAGAGAAGCCATGAGG - Intergenic
980733301 4:136849184-136849206 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
981230044 4:142342012-142342034 CCTGGCCCAGAGAAGCTGTGAGG + Intronic
981411193 4:144434846-144434868 CCTAGCCAAGGGAAGCTCTGAGG + Intergenic
981443408 4:144808793-144808815 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
981481544 4:145243723-145243745 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
981629636 4:146804161-146804183 TCTAGCCAAGGGAAGCTGTGAGG + Intronic
981859913 4:149341760-149341782 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
982060340 4:151598259-151598281 CCTAGCCAAGGGAAACTGTGAGG - Intronic
982393552 4:154891901-154891923 CCTAGCCAAGTGAAGCTGTGAGG + Intergenic
982488484 4:155998764-155998786 CCTAGCAAAGTGAATCTAGAAGG + Intergenic
982717490 4:158824422-158824444 CCTTGCTTAGAGAAGCTGAGGGG - Intronic
982749814 4:159146765-159146787 GATACCAAAGAAAAGCTGGGAGG - Intronic
982825671 4:160001567-160001589 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
982915512 4:161203862-161203884 CCTAGCAAAGGGAAGCCATGTGG + Intergenic
983167758 4:164497949-164497971 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
983316139 4:166134654-166134676 CAAAGCAAAGAAAAGCAGGGTGG - Intergenic
983331451 4:166333969-166333991 CCCAGCAAAGGGAAGCTGTGAGG - Intergenic
983388130 4:167092207-167092229 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
983543225 4:168935190-168935212 CCTAGCCAAGGGAAGCCGTGAGG + Intronic
984354133 4:178636895-178636917 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
984618571 4:181926926-181926948 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
986368809 5:7060741-7060763 AAAAGCAAAGAGAGGCTGGGAGG + Intergenic
986984627 5:13486293-13486315 CTGAGCAAAGAGATGATGGGTGG + Intergenic
987274746 5:16350529-16350551 CCTAACAAAAGGGAGCTGGGAGG - Intergenic
987308028 5:16656556-16656578 TATAGCAAAAAGAAACTGGGTGG + Intergenic
987355640 5:17061277-17061299 GCTAAGAAAGAGAAGATGGGAGG - Intergenic
987656472 5:20814546-20814568 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
988080824 5:26412231-26412253 GCTAGGAAGGAGAAGGTGGGAGG - Intergenic
988480000 5:31621605-31621627 CCTGGCACATGGAAGCTGGGTGG - Intergenic
988618147 5:32794922-32794944 CCTAGCCAAAGGAAGCTGTGAGG + Intergenic
988628086 5:32899091-32899113 TCTAGCCAAGGGAAGCCGGGAGG - Intergenic
988767085 5:34389399-34389421 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
988982768 5:36588093-36588115 ACAAGGAGAGAGAAGCTGGGAGG - Intergenic
989619113 5:43367459-43367481 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
990183833 5:53191561-53191583 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
991264949 5:64706668-64706690 CCTATCAAAGAGAAAATAGGGGG + Intronic
991902619 5:71475753-71475775 CCGAGCAAAGGTAAGCTGCGAGG - Intronic
991934697 5:71790013-71790035 CCTAGCCAAGGGAAGCCGTGTGG + Intergenic
992077788 5:73206982-73207004 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
992292493 5:75293475-75293497 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
992317039 5:75566595-75566617 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
993381926 5:87218094-87218116 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
993757692 5:91751428-91751450 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
993891630 5:93482364-93482386 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
993961027 5:94296629-94296651 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
994142927 5:96361558-96361580 CCTAGCCAAGGGAAGCCAGGAGG - Intergenic
994641892 5:102421032-102421054 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
994850889 5:105053614-105053636 CTTAGCCAAGCGAAGCTGTGAGG - Intergenic
995092281 5:108192534-108192556 CCTAGGAAACATAAGCTTGGTGG + Intronic
995460525 5:112398724-112398746 TATAGCAAAGACAGGCTGGGAGG - Intronic
995474973 5:112538865-112538887 CCTAGCCAAGGGAAGCTTTGAGG + Intergenic
995890162 5:116942187-116942209 GCTAGCCAAGAGCAGCTGGCTGG + Intergenic
996647523 5:125834549-125834571 CATAGCAAGCAAAAGCTGGGAGG - Intergenic
996940216 5:128995628-128995650 CCAGGCACAGAAAAGCTGGGAGG + Intronic
997216576 5:132116686-132116708 CCTACCCAAGGGAAGCTGTGAGG + Intergenic
997809594 5:136954270-136954292 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
999602526 5:153282768-153282790 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
999688250 5:154122045-154122067 CCCAGCCAAGGGAAGCTGTGAGG + Intronic
1000194844 5:158947418-158947440 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
1000406419 5:160892960-160892982 CCTAGTCAAGGGAAGCTGTGAGG + Intergenic
1000413433 5:160958453-160958475 CCTACCAAAGATAATCTGGTTGG - Intergenic
1000996169 5:167960925-167960947 TCTAGCCAAGGGAAGCTGTGAGG - Intronic
1002699397 5:181111816-181111838 CCTAGCAAACAGACTCTGAGGGG - Intergenic
1002996051 6:2286441-2286463 CCTAGCCAAGGAAAGCTGGGAGG + Intergenic
1004944532 6:20596868-20596890 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
1005445693 6:25920226-25920248 CCTAGGAGTGAGAAGCTGGATGG + Intronic
1005795701 6:29359706-29359728 CCCAGCCAAGGGAAGCTGTGAGG + Intronic
1006861278 6:37172929-37172951 ACAAGCACAAAGAAGCTGGGTGG - Intronic
1007412863 6:41674906-41674928 GCTGGCATAGAGAAGGTGGGGGG - Intergenic
1007622229 6:43222294-43222316 CCTAGCAAGGATACGTTGGGAGG - Exonic
1007925110 6:45644038-45644060 CATAGGGAAGAGATGCTGGGTGG + Intronic
1008038700 6:46774403-46774425 CCTAGGTAAGAGATGCTGAGAGG + Intergenic
1008667690 6:53732405-53732427 CCTAGCAGTGATAAGCTGGTGGG + Intergenic
1008801576 6:55374887-55374909 CCTAGCAAAAACAAGCAGTGGGG - Intronic
1008896905 6:56566424-56566446 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1009054264 6:58316387-58316409 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1009264050 6:61531706-61531728 CCTAGCCAAGGGAAACTGTGCGG + Intergenic
1009885078 6:69616059-69616081 CTTGGGAAACAGAAGCTGGGAGG - Intergenic
1009945430 6:70336854-70336876 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1010006164 6:70997908-70997930 CCTACCTAAGGGAAGCTGTGAGG + Intergenic
1010039216 6:71361558-71361580 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1010668376 6:78656044-78656066 CCCAGCCAAGGGAAGCTGTGAGG - Intergenic
1010955537 6:82087085-82087107 CCTAGGGAAGTTAAGCTGGGTGG - Intergenic
1010979927 6:82360384-82360406 ACTAGCAGAGAGAAGCCGCGTGG - Intergenic
1011065436 6:83321068-83321090 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
1011139288 6:84134572-84134594 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
1011333600 6:86236432-86236454 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1011340368 6:86307115-86307137 CCTAGCCAAGCAAAGCTGTGAGG - Intergenic
1012043344 6:94238600-94238622 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1012127998 6:95454475-95454497 TGTAGCCAAGAGAAGCTGTGAGG - Intergenic
1012674699 6:102100668-102100690 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1013368434 6:109451565-109451587 CCTGGCCAGGAGAGGCTGGGTGG - Intronic
1013390174 6:109678871-109678893 CCTAGCCAAGGGAAGCCGTGAGG + Intronic
1013967465 6:115972099-115972121 CCCAGGAAACAGAAGCTGAGAGG - Intronic
1014177094 6:118342769-118342791 CTTAGCCAAGGGAAGCTGTGAGG - Intergenic
1014211568 6:118713797-118713819 TCTATCACAGAGAAGGTGGGAGG - Intergenic
1014278780 6:119417882-119417904 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1014294767 6:119604803-119604825 CTTAACAAAGAGTAGCTGTGGGG + Intergenic
1014568981 6:122986088-122986110 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1014836621 6:126167340-126167362 CCTAGCCAAGGGAAGCTGTTAGG - Intergenic
1014968225 6:127782524-127782546 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1015108844 6:129568891-129568913 CCTAGCCAAGGTAAGCTGTGAGG + Intergenic
1015623467 6:135156562-135156584 CCTAACCAAGGGAAGCTGTGAGG - Intergenic
1015953523 6:138577399-138577421 CCTAGCAAAGAGAACAAGAGAGG + Intronic
1016241806 6:141940007-141940029 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1016428199 6:143956396-143956418 CTTATCCAAGAGGAGCTGGGGGG - Intronic
1016466803 6:144333923-144333945 CCTAGCACATAGTAGGTGGGTGG - Intronic
1016638776 6:146324650-146324672 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1016691595 6:146943805-146943827 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1016843901 6:148552192-148552214 AGTGGCAAAGAGAATCTGGGTGG - Intergenic
1017571348 6:155748496-155748518 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1017658107 6:156649140-156649162 CTGAGCAGACAGAAGCTGGGAGG + Intergenic
1017968771 6:159290762-159290784 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1018524701 6:164696063-164696085 CTTAGCAAAGAGGAAGTGGGAGG - Intergenic
1020358344 7:7301533-7301555 CCTAGCTAAGGGAAGCTGTGAGG - Intergenic
1020590127 7:10124920-10124942 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1020608650 7:10367956-10367978 CCTAGCTAAGGGAAGCTGTGAGG - Intergenic
1020635909 7:10695802-10695824 CCTACCCAAGGGAAGCTGTGAGG + Intergenic
1020639836 7:10741826-10741848 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1020874338 7:13674245-13674267 CCTAGCCAAAGGAAGCTGTGAGG - Intergenic
1021014598 7:15517579-15517601 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
1021224629 7:18013062-18013084 CCTACCCAAGGGAAGCTGTGAGG - Intergenic
1021489763 7:21206845-21206867 ACTGGTAAAAAGAAGCTGGGTGG - Intergenic
1022033305 7:26512175-26512197 CCTAGAAAACAGAAGCTCTGTGG + Intergenic
1022058916 7:26770681-26770703 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
1022277167 7:28866705-28866727 CCCAGCAAACAGGAGCTGTGGGG - Intergenic
1022640523 7:32178172-32178194 TCTAGCACAGAAAAGCTGTGTGG - Intronic
1022848527 7:34235855-34235877 CCTAGCCAAGAGAAGCCATGAGG - Intergenic
1022888113 7:34667400-34667422 CCAAGCCCAGAGAAGGTGGGAGG + Intronic
1022893843 7:34729034-34729056 TATAGCAAAGAAGAGCTGGGAGG - Intronic
1023024691 7:36040031-36040053 CCTAGGATAGAGAAGCTGAGAGG - Intergenic
1023455318 7:40332608-40332630 CCTAGTTCAAAGAAGCTGGGAGG + Intronic
1023511691 7:40959900-40959922 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1023736629 7:43241328-43241350 CCCACCAAAGAGAACCTGGATGG - Intronic
1023885366 7:44350049-44350071 GCAAGCAAAGAAGAGCTGGGAGG - Intergenic
1024664977 7:51537005-51537027 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1024912993 7:54467149-54467171 CCAAGGAGAGAGAAACTGGGAGG - Intergenic
1025621460 7:63175223-63175245 CCTAGCCAAGGGAAGCAGTGAGG - Intergenic
1025714334 7:63941177-63941199 CCGAGCCAAGGGAAGCTGTGAGG + Intergenic
1025875815 7:65478890-65478912 ACTAGCAGAGAGAAGCAGGAGGG - Intergenic
1027843286 7:83341529-83341551 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1028142681 7:87289966-87289988 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1028320673 7:89456044-89456066 CATAGCAAAGAAAGGGTGGGGGG - Intergenic
1028523572 7:91758955-91758977 CCTACCCAAGGGAAGCTGTGAGG + Intronic
1028606637 7:92662820-92662842 GATTGCAAAGAGAAGTTGGGAGG + Intronic
1028628027 7:92898957-92898979 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1029845317 7:103406407-103406429 CTTAGCCAAGGGAAGCTGTGAGG - Intronic
1030141098 7:106304713-106304735 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1030482243 7:110119621-110119643 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1030705697 7:112690389-112690411 CCTACCCAAGGGAAGCTGTGAGG - Intergenic
1030771164 7:113476135-113476157 TCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1030841895 7:114364311-114364333 CATAACAAAGAGAAGCTTGCTGG - Intronic
1031461856 7:122061058-122061080 CCTAGAGAACAGAAGATGGGAGG - Exonic
1031710937 7:125046215-125046237 CCTAGCCAAGGGAAGCTATGAGG + Intergenic
1032124790 7:129185569-129185591 CCTAGCAAAGGGTAGCAGGAAGG - Intergenic
1032367647 7:131315332-131315354 CCTAGCCAAGGGAAGCCGTGAGG + Intronic
1032604132 7:133330685-133330707 CCTACCCAACAGAAGCTGTGAGG - Intronic
1032659819 7:133970571-133970593 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
1035794001 8:2336826-2336848 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1035798804 8:2384882-2384904 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1036143492 8:6229550-6229572 TCCAGCTAAGGGAAGCTGGGTGG + Intergenic
1036551123 8:9815884-9815906 CCTACCCAAGAGAAGCCGTGAGG + Intergenic
1036553708 8:9838581-9838603 CCTACCCAAGGGAAGCCGGGAGG + Intergenic
1039145126 8:34438509-34438531 CCTATCCAAGGGAAGCTGTGAGG + Intergenic
1039282910 8:36006327-36006349 CCTAGCCAAGGGAAACTGGGAGG + Intergenic
1039406352 8:37316014-37316036 CCCAGCAAAGAGGAGCTGCAGGG - Intergenic
1039688674 8:39837909-39837931 CCTAGGAAAGATAAGATAGGAGG - Intronic
1040417294 8:47206610-47206632 CCAAGCAAGGAGAATCTGGCGGG + Intergenic
1041041593 8:53851814-53851836 CCAAACAAAGAGAAGCAGAGTGG + Exonic
1041423503 8:57695074-57695096 CCTAGCCAAGGGAAGTTGTGAGG + Intergenic
1041459808 8:58098754-58098776 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1041584026 8:59495322-59495344 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1041630639 8:60083161-60083183 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1041666259 8:60447979-60448001 CCTAGCCAAGGGAAACTGTGAGG + Intergenic
1042622780 8:70724602-70724624 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
1042627227 8:70771139-70771161 CCTAGCCAAGGGAAGCTTTGAGG - Intronic
1042812970 8:72846172-72846194 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1042946126 8:74156419-74156441 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1042969369 8:74391407-74391429 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1043036733 8:75208566-75208588 TCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1043080853 8:75763246-75763268 CCTAGACAAGGGAAGCTGTGAGG + Intergenic
1044378101 8:91500040-91500062 CCTAGCCAAGGGAAGCTGTAAGG - Intergenic
1045783614 8:105896887-105896909 CCTAGCCAAGAGAAGCCGTGAGG + Intergenic
1045839286 8:106560924-106560946 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
1046106432 8:109672445-109672467 CCTAGCTAAGGGAAGCTGTGAGG + Intronic
1046295798 8:112218040-112218062 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1047343184 8:124002268-124002290 CCTGGTAAAGAGGATCTGGGTGG + Intronic
1048842379 8:138577285-138577307 CCTGGCAAAGAGAAGAGGGGAGG - Intergenic
1048914192 8:139165902-139165924 CCTAGCCAAGGGAAGCCAGGAGG - Intergenic
1050031701 9:1393318-1393340 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1050239956 9:3624580-3624602 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1050369095 9:4902311-4902333 CCTAGCCAAGGGAAGCCGTGCGG - Intergenic
1050963275 9:11765482-11765504 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1051112146 9:13651342-13651364 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1051199370 9:14599361-14599383 CTTAGCTAAGGGAAGCTGTGAGG + Intergenic
1051203728 9:14662176-14662198 TCTAGCAAAGAAAAGAGGGGTGG - Intronic
1051598272 9:18847026-18847048 CTTAGCAAACAGAAGCTTTGGGG - Intronic
1051674641 9:19546911-19546933 CCTACCCAAGGGAAGCTGTGAGG - Intronic
1052096656 9:24391707-24391729 CCTAGTTAAGGGAAGCTGTGAGG - Intergenic
1052382395 9:27785411-27785433 CCTGGCCAAGAGAAGCCGTGAGG - Intergenic
1052506302 9:29358873-29358895 CCAAGCCAAGGGAAGCTGTGAGG + Intergenic
1053691003 9:40587560-40587582 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054273802 9:63049931-63049953 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1054302263 9:63388531-63388553 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054401038 9:64715037-64715059 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054434644 9:65199351-65199373 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054495745 9:65822330-65822352 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1054719950 9:68594380-68594402 CCTAGCCAATAGAAGCTGTGAGG - Intergenic
1054986055 9:71262758-71262780 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1055061363 9:72072411-72072433 CCTAGCCAAGGGAAGCCGTGAGG + Intronic
1055628692 9:78200868-78200890 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1056000925 9:82215809-82215831 CCTAGCAGAGGGAAGCCGTGAGG + Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1058408404 9:104703373-104703395 CCTAGCCAAGAGAACCTATGAGG + Intergenic
1059088782 9:111334212-111334234 ACTAGCCAAGGGAAGCTGTGAGG + Intergenic
1059322511 9:113480649-113480671 CCAGGCAAAGAGGAGCAGGGAGG + Intronic
1059424017 9:114209653-114209675 CCTAGGAAAGAGAAGAAAGGGGG - Exonic
1060674402 9:125499664-125499686 ATTAGGAAAGAGAAGCTGTGAGG - Intronic
1062723448 9:138057710-138057732 CCTAGGAATGAGAACATGGGAGG - Exonic
1203621660 Un_KI270749v1:133666-133688 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1186181385 X:6976427-6976449 TCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1186599873 X:11025022-11025044 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1186807190 X:13152174-13152196 AGAAGCAATGAGAAGCTGGGAGG - Intergenic
1186961015 X:14736464-14736486 CCTAGTCAACAGAAGCTGTGAGG - Intergenic
1187476580 X:19616404-19616426 ACTAGCAACAAGAAACTGGGTGG + Intronic
1187784248 X:22866594-22866616 CCTAGCCAAGGGAAGGTGTGAGG + Intergenic
1188561311 X:31471376-31471398 CCTAGCCAACAGAAGCCGTGAGG - Intronic
1188893359 X:35636589-35636611 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1189039830 X:37530685-37530707 CCTAGCCAAGGGAAGCCGTGAGG - Intronic
1189713527 X:43840704-43840726 CCTAGCCAAGGGAAGCTGTGAGG + Intronic
1189754071 X:44253046-44253068 CCTAGCCAAGGGAAGCCGTGAGG + Intronic
1189845100 X:45128668-45128690 CCTAGCAGGGAGAACTTGGGTGG + Intergenic
1190495149 X:51021291-51021313 CCTAGCCAAGGCAAGCCGGGAGG - Intergenic
1191005012 X:55702337-55702359 CCTACCCAAGGGAAGCTGTGAGG + Intergenic
1191153193 X:57242673-57242695 CCTAGCCAAGGGAAGCTGTAAGG + Intergenic
1191222285 X:58002627-58002649 CCTAGCCAAGAGAAGCCATGAGG + Intergenic
1191788832 X:64946323-64946345 TCTAGCCAAGGGAAGCTGTGAGG - Intronic
1192018395 X:67357658-67357680 CCTCGCCAAGGGAAGCTGTGAGG + Intergenic
1192154553 X:68734169-68734191 CCTAGTGAACAGAAACTGGGAGG + Intergenic
1192755879 X:74046743-74046765 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1192980312 X:76332252-76332274 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1193079280 X:77390119-77390141 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1193254086 X:79325908-79325930 CCTAGCGAAGGGAAGCCGTGAGG - Intergenic
1193514329 X:82445513-82445535 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1193646713 X:84079229-84079251 CCTATCCAAGAGAAGCCGTGAGG + Intronic
1193685365 X:84571393-84571415 CCTAGCCGAGGGAAGCTGTGAGG + Intergenic
1193705204 X:84812881-84812903 CCGAGCCAAGGGAAGCTGTGAGG - Intergenic
1193878669 X:86895768-86895790 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1193949268 X:87778326-87778348 CTTAGCCAAGGGAAGCTGTGAGG + Intergenic
1194159139 X:90428981-90429003 CATAACAAAGAGAACCTGGCGGG + Intergenic
1194624718 X:96214421-96214443 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1194631554 X:96291616-96291638 CCCAGCCAAGGGAAGCTGTGAGG + Intergenic
1194963939 X:100266742-100266764 CCTAGCCAAGGGAAGCTGTGAGG + Intergenic
1195255099 X:103082393-103082415 CCCAGGAAAGAGCAGCTGGAGGG + Intronic
1195468978 X:105211892-105211914 CCAAGCCAAGGGAAGCTGTGAGG + Intronic
1195711259 X:107775511-107775533 CCTGGAAAAGACAAGCTGTGAGG + Exonic
1196308133 X:114128030-114128052 CCTACCCAAGGGAAGCTGCGAGG - Intergenic
1196367871 X:114943396-114943418 CCTAGCCAAGGGAAGCTCTGAGG - Intergenic
1196603029 X:117623319-117623341 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1196946660 X:120833287-120833309 CCTAGCCAAGGGAAGCTGTGAGG - Intergenic
1197051113 X:122060948-122060970 CCTAGCCAAGAGAAGCCCTGAGG + Intergenic
1197142130 X:123129518-123129540 CCTAGCCAAGGGAAGCCGTGAGG + Intergenic
1197926869 X:131656140-131656162 CCTAGCAAAGGGAAGCAACGAGG + Intergenic
1198002342 X:132451895-132451917 CCTAGCCAAGGGAAGCTGTGAGG - Intronic
1198555749 X:137791947-137791969 CCTAGCTAAGGGAAGCTGTGAGG + Intergenic
1199094414 X:143723388-143723410 CCTAGCCAATGGAAGCTGTGAGG + Intergenic
1199469881 X:148182274-148182296 CCTAGCCAAGAGAAGACGTGAGG - Intergenic
1199477431 X:148260641-148260663 CCTAGCCAAGGGAAGCCGTGAGG - Intergenic
1200740333 Y:6847027-6847049 CCTAGCCAAGAGAAGCCTTGAGG - Intergenic
1201724640 Y:17139130-17139152 GAAAGCAAAGAGAACCTGGGAGG + Intergenic
1201987483 Y:19985613-19985635 CCTACCCAAGGGAAGCTGTGAGG - Intergenic
1202583938 Y:26405712-26405734 CCTGGCATGGAGCAGCTGGGCGG + Intergenic