ID: 917159306

View in Genome Browser
Species Human (GRCh38)
Location 1:172039808-172039830
Sequence CTCTTCATGCACTCAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917159297_917159306 23 Left 917159297 1:172039762-172039784 CCTTCCCTCCTGCCTTCCTTTCT 0: 2
1: 180
2: 3618
3: 45574
4: 43994
Right 917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 131
917159302_917159306 7 Left 917159302 1:172039778-172039800 CCTTTCTCTGTTCTTCCTCCTTC 0: 1
1: 1
2: 26
3: 303
4: 2327
Right 917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 131
917159300_917159306 15 Left 917159300 1:172039770-172039792 CCTGCCTTCCTTTCTCTGTTCTT 0: 1
1: 0
2: 38
3: 505
4: 4263
Right 917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 131
917159303_917159306 -8 Left 917159303 1:172039793-172039815 CCTCCTTCCTCTAATCTCTTCAT 0: 1
1: 0
2: 3
3: 52
4: 493
Right 917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 131
917159301_917159306 11 Left 917159301 1:172039774-172039796 CCTTCCTTTCTCTGTTCTTCCTC 0: 1
1: 1
2: 30
3: 377
4: 2925
Right 917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 131
917159299_917159306 18 Left 917159299 1:172039767-172039789 CCTCCTGCCTTCCTTTCTCTGTT 0: 1
1: 1
2: 31
3: 289
4: 2043
Right 917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 131
917159298_917159306 19 Left 917159298 1:172039766-172039788 CCCTCCTGCCTTCCTTTCTCTGT 0: 1
1: 11
2: 523
3: 4063
4: 14742
Right 917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG 0: 1
1: 0
2: 0
3: 13
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917159306 Original CRISPR CTCTTCATGCACTCAGTGTC TGG Intronic
900940976 1:5798439-5798461 CTCTGCAGACACTGAGTGTCAGG + Intergenic
901637106 1:10675596-10675618 CTCCTAATGCCCGCAGTGTCGGG - Intronic
902557286 1:17254410-17254432 CCCTTCATGGACTCAGGGCCTGG - Intronic
903383318 1:22911367-22911389 CTCTTCACACACACAGTCTCAGG + Intronic
906901987 1:49845241-49845263 CTATAAATGCACTCAGTGTGAGG + Intronic
907616316 1:55930318-55930340 ATCAGCATGCACTCCGTGTCCGG - Intergenic
912200420 1:107451506-107451528 CACTGCATGGACTCATTGTCAGG + Intronic
916823253 1:168420421-168420443 ATCTTCATGATTTCAGTGTCTGG + Intergenic
917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG + Intronic
918962346 1:191297194-191297216 CTCTTGATGCTCTCAGTTACTGG + Intergenic
919767228 1:201135266-201135288 GTCTTCAGGAACTCAGTGTCTGG - Exonic
922189739 1:223307694-223307716 GTCTTCTTGCACACACTGTCTGG - Intronic
923271046 1:232355272-232355294 CTAGTCATGTGCTCAGTGTCTGG - Intergenic
923277009 1:232405230-232405252 CTCTTAATGCAATCAGTAGCTGG - Intronic
924214811 1:241809960-241809982 CTGTTCAAGCACTCAGGGTCTGG - Intergenic
1062910877 10:1211444-1211466 CACGTCATGCATTCAGTGTCTGG - Intronic
1064640697 10:17412446-17412468 CTATTCCTGCATTAAGTGTCTGG + Intronic
1075724764 10:124605632-124605654 CTCGCCAGCCACTCAGTGTCTGG - Intronic
1076497180 10:130904863-130904885 CTCACCATGGACTCAGTGTATGG + Intergenic
1079625299 11:22609820-22609842 CTCTTCACGCACTCAAGATCAGG - Intergenic
1080695833 11:34602387-34602409 CCCTTCATGCAGGCAGTGTGTGG + Intergenic
1082763551 11:57148921-57148943 CTCTTCAAGCACACCGTGTCCGG + Intergenic
1083746473 11:64739803-64739825 CTCCTCATGCCCCCAGTTTCAGG - Exonic
1085104447 11:73830131-73830153 TTCTTCATATCCTCAGTGTCCGG + Intronic
1093738997 12:22659046-22659068 CTATTCATGCACACAATGGCTGG + Exonic
1095570193 12:43675573-43675595 GTCTTCCTCCTCTCAGTGTCTGG - Intergenic
1097349520 12:58533099-58533121 CTCTTCATCTACTCTATGTCTGG + Intergenic
1102073698 12:110043208-110043230 CTCTTCCTGCACTCCTTGCCTGG - Intronic
1102840810 12:116119069-116119091 CACTTCTGTCACTCAGTGTCGGG + Intronic
1103924732 12:124417268-124417290 CTCTTCGTGGAGTGAGTGTCCGG - Intronic
1104721869 12:131048902-131048924 CTCCTCTTGCCCTGAGTGTCAGG - Intronic
1105614286 13:21998437-21998459 CACTTCATGGACTGGGTGTCTGG - Intergenic
1106552440 13:30783865-30783887 CTGTTCATACATTCAGTGTCAGG - Intergenic
1107171561 13:37348252-37348274 CTGTTCATGAACTCTGTATCTGG + Intergenic
1109219863 13:59630106-59630128 TTCTTCATGCACTCAATTTGTGG - Intergenic
1109250288 13:60011319-60011341 ATTTTCATGGCCTCAGTGTCTGG - Intronic
1120718410 14:87865054-87865076 CCATTCATGCACACATTGTCAGG + Intronic
1120752920 14:88214959-88214981 CTATTCATGCACTCTGGGGCAGG + Intronic
1122355839 14:101122393-101122415 ATATTCATGAACTCAGTGGCGGG - Intergenic
1125104358 15:35953495-35953517 CTCTTCATTCACTCAGTTTATGG + Intergenic
1125404179 15:39335651-39335673 CTCTTCATCCTGTCAGTGTGTGG - Intergenic
1125673922 15:41492744-41492766 CCCCTCAGGCACTCAGTGTCTGG - Intergenic
1126882582 15:53115275-53115297 CTCTTCAGGAGCTCAGAGTCTGG + Intergenic
1141460890 16:84178306-84178328 CTCTGCATGAGCTCAGTGTCAGG + Exonic
1141481220 16:84308192-84308214 CCCCTCATGCCCTCAGTCTCAGG + Intronic
1141613014 16:85194180-85194202 CTGTTCTTGGACTCCGTGTCCGG + Intergenic
1143999849 17:11043173-11043195 CTCTCAATGTACTCAGTGTGTGG + Intergenic
1147046012 17:37752720-37752742 CTGGGCATGCAGTCAGTGTCTGG + Intergenic
1151533982 17:74726973-74726995 CTCTACATGCACCCAGAGGCTGG - Intronic
1153023141 18:649602-649624 CTCTACATGCACGTAGTGTTTGG - Exonic
1153893554 18:9539710-9539732 CGCTTCATTCCCTCAGTCTCAGG - Intergenic
1157637706 18:49177176-49177198 CTCCTCTTGCACTCACTGTGAGG - Intronic
1160248562 18:77180986-77181008 CAATGCTTGCACTCAGTGTCAGG + Intergenic
1161473035 19:4470475-4470497 CTATTCATTCTCCCAGTGTCTGG + Intergenic
1163443896 19:17335275-17335297 CTCCTCATGCACTCTTCGTCCGG + Intronic
1165822719 19:38686699-38686721 CTCTTCCTGGACTCTGTGTGGGG + Intronic
1166383374 19:42367206-42367228 CTCTTCAGGTTCTCAGTGTGGGG + Intronic
1167313339 19:48750269-48750291 ATCTTCAGGAACTCAGAGTCTGG + Exonic
928609696 2:32980395-32980417 TTCTTTATGCAATCAGTGTTAGG - Intronic
929311777 2:40434032-40434054 CTCTTCCTGCATGCACTGTCAGG + Intronic
931167892 2:59769292-59769314 TTGTTCATGGAGTCAGTGTCTGG - Intergenic
932199213 2:69810906-69810928 CTCTCAATGCACTGAGTGACAGG - Intronic
937924066 2:127154178-127154200 CTCTTCAGGCAGCCAGGGTCAGG + Intergenic
939422568 2:141992715-141992737 CTATTAATTCACTCTGTGTCAGG + Intronic
940172476 2:150843593-150843615 CTCTAAATGCACTCAGCTTCGGG + Intergenic
943664206 2:190591512-190591534 CTTTTCATGCACTCAAACTCAGG + Intergenic
944898123 2:204186710-204186732 CTCTTCATGCAGTCCTTGGCTGG - Intergenic
945880568 2:215320904-215320926 CTCTACATGAACTCAGAGTGAGG + Intronic
948656489 2:239479695-239479717 CTCCTCATGCACCCTGAGTCAGG - Intergenic
948699961 2:239753318-239753340 TTCTTCGTGCTCTCCGTGTCTGG + Intergenic
1169123709 20:3112262-3112284 CTCATCATGCACTGTGGGTCAGG - Intronic
1171079863 20:22168497-22168519 CTCTTCATTTACAGAGTGTCTGG + Intergenic
1171233904 20:23509201-23509223 CTTTTCAGGCAGGCAGTGTCTGG + Intergenic
1173445507 20:43114254-43114276 CTCTTCATGTACTAAGTCTTGGG - Intronic
1173840483 20:46153539-46153561 CTCTTCATGCTCTTCGTTTCTGG + Intergenic
1178365824 21:31987975-31987997 CACTGCTTGCACTCAGTGCCCGG - Intronic
1180604246 22:17044549-17044571 CTCAGCATTCACACAGTGTCTGG - Intergenic
950761523 3:15233874-15233896 ATCTTCATGCACTGACTGGCTGG + Exonic
952853089 3:37744925-37744947 CACTTCATCCACACAGGGTCCGG - Intronic
961864077 3:129940936-129940958 TGCTTCAGGCACTCAGTGTGTGG - Intergenic
962088705 3:132220214-132220236 CTCTTCAATCACTCACTGTAGGG + Intronic
969124679 4:4937957-4937979 CTCCTCAAGGACTCAGTGCCAGG + Intergenic
971110352 4:23578122-23578144 CTCTTTAGGCACACAGTGTAGGG - Intergenic
974069332 4:57110083-57110105 CTCTTCACGCACTCCATGCCCGG + Exonic
975468459 4:74736238-74736260 CTCCTCATGACCTCAGTATCTGG + Intergenic
977265772 4:94851913-94851935 ATCTTCGTACACTCAGTGCCTGG + Intronic
979316347 4:119268620-119268642 TTCTTCATGCACTCAGACTGTGG + Intronic
981432044 4:144672483-144672505 CTCTTCCTTCACTCAGTTCCAGG - Intronic
985612369 5:897469-897491 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612459 5:897865-897887 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612489 5:897997-898019 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612684 5:898855-898877 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612714 5:898987-899009 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612729 5:899053-899075 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612759 5:899185-899207 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612774 5:899251-899273 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612819 5:899449-899471 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612834 5:899515-899537 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612864 5:899647-899669 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985612879 5:899713-899735 GGCTTCATGCAGTCAGTGTGTGG + Intronic
985880338 5:2634593-2634615 TTCTTCGTGCAATGAGTGTCTGG - Intergenic
986224477 5:5800427-5800449 CTCTTCACGCATTCAGAGTTTGG - Intergenic
986941738 5:12959646-12959668 ATCTTCATGCACACTGTGTTTGG - Intergenic
987026568 5:13932767-13932789 CTCTTGATGAACCCAGTGTCTGG - Intronic
992332496 5:75731557-75731579 CTCTTAGTGCACTCTGTGTGTGG - Intergenic
994772972 5:104006946-104006968 CTTTTCATTCACGCAGTCTCAGG - Intergenic
995218007 5:109617166-109617188 CCCTGCATTCACTCAGTGCCAGG + Intergenic
995768986 5:115649451-115649473 CTCCTGAGGCACTCACTGTCTGG + Intergenic
996084583 5:119291584-119291606 CCCTTCCTGCACTCCGTGGCTGG - Intronic
1001791518 5:174461494-174461516 CTCTCCATGCAGCCAGGGTCAGG + Intergenic
1007751853 6:44075928-44075950 CTCTTCATCCAGGCAGGGTCTGG - Intergenic
1018225631 6:161626133-161626155 CTCGCCGTGCACACAGTGTCAGG + Intronic
1024164854 7:46720761-46720783 CTGTTTATGCATACAGTGTCTGG + Intronic
1024427564 7:49244921-49244943 CTCTTCATGCTTTCCATGTCTGG + Intergenic
1024720731 7:52135269-52135291 ATCTTCATGCACTGAGCCTCTGG + Intergenic
1026873058 7:73865044-73865066 CTCTTCAACCACTGGGTGTCAGG + Exonic
1027752200 7:82163407-82163429 CTTTTCATGCATTCAGTTCCTGG + Intronic
1029430313 7:100524622-100524644 CTCTTCTATCACCCAGTGTCTGG + Intergenic
1031258131 7:119482522-119482544 CTCTGCATGCACCCAGTCCCTGG + Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1034357751 7:150466067-150466089 CTCGTGATGCACCCAGTGCCAGG - Intronic
1035895129 8:3391582-3391604 TGCTTCATGCACTCAGTCTTAGG - Intronic
1037490612 8:19393872-19393894 TTCTCCATGGACTCAGTGTTGGG + Intronic
1038066223 8:23966336-23966358 CTCTTAAGCCACCCAGTGTCTGG + Intergenic
1039830516 8:41210027-41210049 CTCTCAATGCCCTCAGTGACTGG - Intergenic
1044173886 8:89092371-89092393 CTGTTCAAGCATACAGTGTCTGG + Intergenic
1046950279 8:120013701-120013723 CCCTTCCTGCACTGAATGTCAGG + Intronic
1051340066 9:16102812-16102834 CTTTTCATCCCCTGAGTGTCTGG + Intergenic
1051350736 9:16195917-16195939 CGCTCCATGCTCTCAGTTTCTGG - Intergenic
1051498471 9:17751308-17751330 ATCTTCATACACTCAGTCACTGG + Intronic
1052194079 9:25691075-25691097 TTCTTCCTCCACTCTGTGTCTGG + Intergenic
1057522270 9:95769480-95769502 CTCTTCATGGCCTCAGTGATTGG + Intergenic
1057522292 9:95769625-95769647 CTCTTCATGGCCTCAGTGACTGG + Intergenic
1057807537 9:98230618-98230640 CTGTTTTTGCACTCAGTGTCTGG - Intronic
1058419354 9:104819763-104819785 CTCTGCCTTCACTCACTGTCTGG - Intronic
1058898222 9:109418367-109418389 CTCTTTATGCAATCAGTGCCAGG - Intronic
1061196340 9:129109125-129109147 CTCTGCATGGGCTCAGTGCCAGG + Intronic
1062272455 9:135715883-135715905 GTCTTCATCCACTCAGAATCAGG + Intronic
1186637988 X:11427131-11427153 CGCTTCATGATCTCAGTGTGCGG - Intronic
1187027835 X:15454739-15454761 ATCTTGATGCACTCAATGCCAGG + Intronic
1189380540 X:40499667-40499689 CTCTTTATGCCAGCAGTGTCTGG - Intergenic
1192240263 X:69322888-69322910 CTCTTCAGGCAGTCAGAGACAGG - Intergenic
1196043862 X:111235214-111235236 CTCTTCATACAGTCAAAGTCTGG - Intergenic
1198522000 X:137462291-137462313 GTCTTCAGGCACTAAGTGTCAGG + Intergenic
1200218080 X:154377473-154377495 CTCTTCATGCTCCCAGTTTGGGG + Intergenic