ID: 917173958

View in Genome Browser
Species Human (GRCh38)
Location 1:172210478-172210500
Sequence TTCTAACACCAGGAGCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917173954_917173958 27 Left 917173954 1:172210428-172210450 CCTTGCAGGAAGAACTGAGGTTG 0: 1
1: 0
2: 1
3: 15
4: 244
Right 917173958 1:172210478-172210500 TTCTAACACCAGGAGCTGTATGG 0: 1
1: 0
2: 0
3: 9
4: 114
917173953_917173958 28 Left 917173953 1:172210427-172210449 CCCTTGCAGGAAGAACTGAGGTT 0: 1
1: 0
2: 0
3: 25
4: 178
Right 917173958 1:172210478-172210500 TTCTAACACCAGGAGCTGTATGG 0: 1
1: 0
2: 0
3: 9
4: 114
917173956_917173958 -7 Left 917173956 1:172210462-172210484 CCAAGAAGCACAATGTTTCTAAC 0: 1
1: 0
2: 0
3: 16
4: 171
Right 917173958 1:172210478-172210500 TTCTAACACCAGGAGCTGTATGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917173958 Original CRISPR TTCTAACACCAGGAGCTGTA TGG Intronic
904712747 1:32443105-32443127 TTCTAAAAGAAAGAGCTGTAAGG - Intergenic
907126393 1:52054848-52054870 TTCAAACTCCAGGAGCGGTTGGG + Intronic
917173958 1:172210478-172210500 TTCTAACACCAGGAGCTGTATGG + Intronic
917736548 1:177926493-177926515 TTCCATCACCATGAGCTGTTTGG - Intronic
921782919 1:219189580-219189602 TTCTGACCCCAGAAGCTGTGTGG - Intronic
924309167 1:242722203-242722225 TTATCACACCAGGAGCCGAATGG + Intergenic
924420886 1:243908649-243908671 TTCTAACATCAGCAGCTGTTTGG + Intergenic
924472231 1:244352536-244352558 TTCTAAGCCCAGGACCTGAAAGG + Intergenic
1063956381 10:11271332-11271354 TTCAGACACCAAGAGATGTAAGG - Intronic
1064484861 10:15775757-15775779 TTCAGGCACCAGGAGCTGGAGGG - Intergenic
1064553344 10:16523461-16523483 TTCCAATACCAGGAGCAGTGTGG - Intergenic
1065669905 10:28104990-28105012 TTCTAAGACCAAGAGTTGAATGG + Intronic
1065859636 10:29861190-29861212 TTCTAACTTCAAGAACTGTAAGG + Intergenic
1066278560 10:33892004-33892026 TACTAGCACCAGGAGCAATATGG - Intergenic
1067169594 10:43895716-43895738 TTCTGACACCAGGTTCTGTAGGG - Intergenic
1070942672 10:80360216-80360238 TTCTGACCCCAAGACCTGTAAGG - Intronic
1075946646 10:126439080-126439102 TTCTACCACCAGGAACGTTATGG - Intronic
1080404555 11:31967237-31967259 TTCTCGAACAAGGAGCTGTACGG + Intronic
1081244335 11:40746218-40746240 AACTAACACTAGGAGCTGTCAGG + Intronic
1083250027 11:61460432-61460454 TTCTAACAGTGAGAGCTGTACGG + Intronic
1088661053 11:112046628-112046650 ATCACACACCAGGACCTGTAGGG - Intronic
1089869868 11:121662872-121662894 ATGTCACACCAGGTGCTGTAGGG + Intergenic
1091133468 11:133166413-133166435 CTCTGCCATCAGGAGCTGTATGG - Intronic
1096173677 12:49496037-49496059 TTCTAAAGCCAGGAGCAGCAGGG - Intronic
1096774738 12:53956999-53957021 TTCTAACCCCAGGAACTGTGAGG - Exonic
1096992509 12:55816872-55816894 TGGTAACACCAGGAGATGCAGGG + Intronic
1100320993 12:93492500-93492522 TTCTAGAACCAGAATCTGTAAGG - Intronic
1102310169 12:111838439-111838461 TTCTAGCATCTGGAGCTGTGAGG + Intergenic
1103153655 12:118664100-118664122 TTCAAACATTAGGAGCTTTATGG + Intergenic
1105913082 13:24889696-24889718 CTCGAACACCATGAGCTGAAGGG - Intronic
1113822603 13:113225711-113225733 CTCTGACTCCAGGAGCTGGACGG - Intronic
1114515269 14:23295280-23295302 TTCTCACACCAGATGCTGGAAGG - Intronic
1114779495 14:25522260-25522282 TCCTACCACCAGCAGCTGTTAGG + Intergenic
1115762173 14:36585394-36585416 TTCTAGAACCAGGAGCTACAGGG - Intergenic
1118683363 14:68266118-68266140 TTTGGGCACCAGGAGCTGTAGGG + Intronic
1118973546 14:70657577-70657599 TTCTACTGCCAGGAGCTGTTTGG - Intronic
1119560312 14:75584372-75584394 TTCTAACATCAGGAGCTGACTGG + Intronic
1120102179 14:80457940-80457962 TTCTAATGCCTGGAGATGTATGG - Intergenic
1121289390 14:92761875-92761897 TTCTAACGTCAGGAGCTGACTGG - Intergenic
1126377964 15:48015129-48015151 TTCCAACTCCAGTAGCTATAAGG + Intergenic
1128079360 15:64847004-64847026 TACTAACAGCAGAAGTTGTAAGG - Intronic
1129974583 15:79811608-79811630 TTCCAACACCAGGACCCATAAGG - Intergenic
1135524840 16:23206344-23206366 CTCTAACCCCAGAAGCTGTGGGG + Intronic
1140566629 16:76049723-76049745 ATCTGCCACCAGGAGCTGTTGGG - Intergenic
1143261248 17:5599904-5599926 TTCTGACACGTGGAGCTGAAGGG + Intronic
1147186153 17:38714071-38714093 TTCTAGAACCAGGAGATGGAGGG + Intronic
1147304549 17:39554234-39554256 TTATAACACCAGAACCTGGAAGG + Intronic
1148775522 17:50093372-50093394 TGCTAAGACCAGGAGATCTAAGG + Intergenic
1152453929 17:80401921-80401943 TTCTAACATCAGGAGCTGACTGG - Intergenic
1159959546 18:74545025-74545047 TGCCAACACCAGAAGCTGGAGGG + Intronic
1164922621 19:32100746-32100768 TTCTGACAGCAAGAGCTGTGGGG - Intergenic
926273540 2:11386259-11386281 TTCTAGCCTCCGGAGCTGTAGGG + Intergenic
926885545 2:17595068-17595090 ATCTCACTCCAGCAGCTGTATGG - Intronic
927450035 2:23201239-23201261 TTTTAACACAATGAGCTGAAAGG - Intergenic
927581352 2:24252090-24252112 TTCTAAGAACAAGAGTTGTAGGG - Intronic
930094755 2:47558589-47558611 TGCTAACACCAGGACCTGCCAGG - Intronic
931799109 2:65741359-65741381 TTCTGACACCAGGAGGTGCCTGG + Intergenic
932673639 2:73759196-73759218 TGCTAACACGAGGAAATGTAAGG + Intergenic
934163673 2:89275180-89275202 TTCTAAAACCAGCAGCTTTATGG - Intergenic
934203599 2:89907344-89907366 TTCTAAAACCAGCAGCTTTATGG + Intergenic
934312712 2:91883596-91883618 TCATAACACCAGGAGTTCTAAGG + Intergenic
935898099 2:107759477-107759499 TTCTAACCCCATGAGCTACAAGG + Intergenic
937313301 2:120915325-120915347 TTCCAACACCACGAGCTGGCTGG - Intronic
937717905 2:125055884-125055906 TTCTAACATCAGAAGATATAAGG - Intergenic
938157499 2:128953975-128953997 GACTAACATCAGGAGCTGCAAGG - Intergenic
940397899 2:153213538-153213560 TTATTACACCAGATGCTGTAAGG + Intergenic
942574104 2:177344628-177344650 TTCTTGCACCAGGTGCTGGAAGG - Intronic
946007976 2:216541607-216541629 TGCTATCACCATGAGCTGTGTGG - Intronic
1168954463 20:1825185-1825207 TTTTTACATCAGGAGCTGTTGGG - Intergenic
1169830485 20:9819895-9819917 ATCTAAACCCAAGAGCTGTAGGG + Intronic
1170019020 20:11815061-11815083 TACTAAAACCAGTAGCTATATGG + Intergenic
1171399394 20:24862292-24862314 GTCTAACACCAGAACCTGTCAGG + Intergenic
1173318382 20:41965249-41965271 ATCTCACACCAGGACCTGTCAGG - Intergenic
1176668489 21:9709643-9709665 TGCTGCCACCAGCAGCTGTATGG - Intergenic
1177198420 21:17927603-17927625 TTTTAATAGCAGCAGCTGTAGGG + Intronic
1177476732 21:21633444-21633466 TTATAGCACCAGTAACTGTAAGG + Intergenic
1180782908 22:18530651-18530673 CTCTAAATCCATGAGCTGTAAGG - Intergenic
1181239806 22:21470013-21470035 CTCTAAATCCATGAGCTGTAAGG - Intergenic
1183720826 22:39560420-39560442 TTTTGACACCAGGAGCTGGGGGG - Intergenic
951891095 3:27568780-27568802 TTTTAGCCCCAGGAGCTGTCAGG - Intergenic
955851193 3:63221839-63221861 TTATACCACAAGGAGCTATAGGG + Intergenic
956948018 3:74245960-74245982 TTCTAACATCAGGAACAGAACGG + Intergenic
957063683 3:75503480-75503502 TTACAGCACGAGGAGCTGTAAGG + Intergenic
961712746 3:128839887-128839909 TTCTAACGTCAGGAGCTGACTGG + Intergenic
966169161 3:177058291-177058313 TTCTAAAATCTGGATCTGTAGGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967127881 3:186442049-186442071 TTCTAACTCCATCAGCTGTGTGG + Intergenic
975923113 4:79416697-79416719 TTCTAACAACAGTAGCTGTGGGG - Intergenic
976511088 4:85910645-85910667 TGCTAATAGCAGGAGTTGTAGGG - Intronic
976543630 4:86307446-86307468 TTATAACACAAGGAACTTTAAGG + Intronic
983062442 4:163174747-163174769 TTCTAATATCAGGAGCTGCCTGG - Intergenic
983169753 4:164522121-164522143 GTGTAACACAAGGAGGTGTATGG + Intergenic
984085716 4:175308739-175308761 TTCTCACACAATGAGCTGTGTGG - Intergenic
987074953 5:14372443-14372465 TACTAACACCATTAGCTGAAAGG - Intronic
987112977 5:14703864-14703886 TTTTAACAAAAGGAGCAGTAAGG + Intergenic
991512630 5:67396878-67396900 TTCTAGGAGCAGGAGCTGTGTGG - Intergenic
993495385 5:88602927-88602949 TTCTCACACCAGACGCTGGAAGG - Intergenic
993532737 5:89044151-89044173 TTCTAAGACCATGTGCTGGAGGG - Intergenic
997469094 5:134106873-134106895 TTCTAAAACCAGGAACTGGAAGG - Intergenic
997493184 5:134296890-134296912 CCCTAACAACAGGAGCTGTCAGG - Intronic
1000954440 5:167525721-167525743 TTCTCAGATCAGGAGCTCTATGG + Intronic
1008518033 6:52336675-52336697 TTTTGACACCAGGAACTGTGTGG + Intergenic
1011344827 6:86357903-86357925 TTCTAACACCTGCACTTGTAGGG - Intergenic
1013748615 6:113375068-113375090 ATGTTACATCAGGAGCTGTAGGG - Intergenic
1015181574 6:130366446-130366468 GTCTCACTCCAGGAGCTGTCGGG - Intronic
1020123555 7:5519582-5519604 CTCTCACACCATGAGCTGTGGGG - Intergenic
1020515725 7:9116286-9116308 TTCAAACACCAGGAAATGTGTGG - Intergenic
1021788506 7:24176608-24176630 TTCTCACACCAAGATTTGTAAGG + Intergenic
1036994232 8:13636279-13636301 TTCTGACAACAGGAGGTGGATGG - Intergenic
1037347004 8:17911703-17911725 TAGGAACACCAAGAGCTGTAAGG + Intergenic
1038688631 8:29741418-29741440 TTCTAGAAGCAGGAGCTGCATGG - Intergenic
1039042132 8:33417979-33418001 TACTAACACTGGGAGCTGTCTGG + Intronic
1039234647 8:35488556-35488578 TTCTAACTCAAGGGGCTGGAAGG + Intronic
1043349395 8:79341967-79341989 TCCTAACACTAGAATCTGTATGG + Intergenic
1043415521 8:80044463-80044485 TGCTTTCACCCGGAGCTGTAAGG + Intronic
1043565175 8:81539840-81539862 TTCTTACAGCTGGAGCTGTTGGG + Intergenic
1051570029 9:18545354-18545376 CCATAACACCAGGAGCTATATGG + Intronic
1055804970 9:80082444-80082466 TTCTAAAAGCAGTGGCTGTAAGG - Intergenic
1061398437 9:130355749-130355771 TTCAGCCACCAGGAGCTGTGGGG - Intronic
1062100923 9:134728211-134728233 TTCCCACACCAGGAGCTGGGAGG - Intronic
1203657377 Un_KI270753v1:11302-11324 TGCTGCCACCAGCAGCTGTATGG + Intergenic
1186593173 X:10952914-10952936 GTCCAACACAAAGAGCTGTATGG + Intergenic
1190787367 X:53664470-53664492 TCCAAACACCAGAAGATGTAGGG - Intronic
1191880801 X:65842261-65842283 CTCTAAAACCAGAAGCTATAAGG + Intergenic