ID: 917177682

View in Genome Browser
Species Human (GRCh38)
Location 1:172255435-172255457
Sequence GTCAAACAAAATTGAATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917177679_917177682 16 Left 917177679 1:172255396-172255418 CCTAGATGCAGAGTGGAACAGGT 0: 1
1: 0
2: 1
3: 9
4: 123
Right 917177682 1:172255435-172255457 GTCAAACAAAATTGAATCCATGG 0: 1
1: 0
2: 1
3: 18
4: 236
917177676_917177682 24 Left 917177676 1:172255388-172255410 CCTTCTTGCCTAGATGCAGAGTG 0: 1
1: 0
2: 1
3: 11
4: 164
Right 917177682 1:172255435-172255457 GTCAAACAAAATTGAATCCATGG 0: 1
1: 0
2: 1
3: 18
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917177682 Original CRISPR GTCAAACAAAATTGAATCCA TGG Intronic
903489383 1:23716574-23716596 ACCAAACAAAATTGAGCCCACGG - Intergenic
903696382 1:25210495-25210517 GGCAAATGAAATTGAACCCAGGG - Intergenic
904469838 1:30729482-30729504 GTCAGCCAAACTGGAATCCAGGG + Intergenic
905153711 1:35955311-35955333 GTCAAACAAATTTTAATTAATGG - Intronic
905559395 1:38914540-38914562 ATCAAACAAAATTTAGTTCATGG - Intronic
907890242 1:58630276-58630298 ATCAAACAAACTGGAATCAAGGG - Intergenic
908896106 1:68901698-68901720 TTAAAACAAACTTGAATCCCAGG - Intergenic
909061756 1:70886870-70886892 GTCAAACAAACCTTGATCCAAGG - Intronic
910093404 1:83492334-83492356 GAGACACAAAGTTGAATCCAGGG - Intergenic
910804506 1:91177144-91177166 GTCCAACTACATTGAGTCCATGG - Intergenic
911948749 1:104144668-104144690 GAACAACAAAATTGAATACAAGG + Intergenic
911990333 1:104688242-104688264 GTGAAACAAAAATAAAACCAAGG + Intergenic
916708922 1:167383687-167383709 GTAAAACAAGATTGAATGTAAGG + Intronic
916951452 1:169784525-169784547 GACAAACAAAATTGGATGGAAGG - Intronic
917177682 1:172255435-172255457 GTCAAACAAAATTGAATCCATGG + Intronic
917432078 1:174980695-174980717 CACAAACAAAATAAAATCCAAGG - Intronic
918006783 1:180548743-180548765 GTTAGACAAAATTGGAGCCAAGG - Intergenic
921193793 1:212732774-212732796 GTCAAAAAAAATTACCTCCAAGG - Intronic
1063702259 10:8395848-8395870 TTTAAACAAAAATGAAACCAAGG + Intergenic
1063825404 10:9891708-9891730 TTCAAATACAATTGAATTCATGG - Intergenic
1067094717 10:43292758-43292780 GTCACAGAAGCTTGAATCCATGG + Intergenic
1067811788 10:49433814-49433836 CTCAAAAAAAAATGAATACATGG + Intergenic
1067903366 10:50264980-50265002 GTCAGACAAAAGTGAATTAAAGG + Intergenic
1068308847 10:55252648-55252670 GTGAACCAAAAATAAATCCAAGG + Intronic
1068422269 10:56809567-56809589 GTCAAAAAAAATTGAACTCATGG - Intergenic
1068833822 10:61529781-61529803 TACAAATAAAATTGAATCCCCGG + Intergenic
1071520058 10:86324930-86324952 ATCAGACAAAATAGAATTCAAGG + Intronic
1073948127 10:108776075-108776097 GTCATTCAAAAATGAATCTAGGG - Intergenic
1075118127 10:119644232-119644254 CTCAAACATAAGTGAATCAACGG - Intergenic
1076151597 10:128166674-128166696 GTTGAACAGAATTGAATACATGG + Intergenic
1078697190 11:13646236-13646258 TTCAAAGAAAACTGAAGCCATGG - Intergenic
1080609719 11:33893279-33893301 GTCAAGCAAAATTGTTTCCATGG + Intergenic
1084828772 11:71752032-71752054 TTCATACAAAACTGTATCCAGGG + Intergenic
1085466843 11:76729910-76729932 GCCAAACTCAATTGAATCCAGGG + Intergenic
1085997998 11:81944942-81944964 GTCAAACAGAATTTAGTTCAAGG + Intergenic
1086381642 11:86261299-86261321 AACAAACAAGATTAAATCCAAGG + Intronic
1087529706 11:99363685-99363707 GTCAAACAAAATAAATCCCATGG + Intronic
1089670544 11:120054084-120054106 ATCAAAAAAGATTGACTCCAAGG + Intergenic
1091270979 11:134311623-134311645 GTAAAACCAATGTGAATCCAAGG - Intronic
1093003780 12:14030001-14030023 TTCAAACAAAATTGCATGCTGGG + Intergenic
1093354113 12:18141958-18141980 TACAAACAAAATTCAATTCAAGG - Intronic
1094361055 12:29631694-29631716 GAAGAACAAAATAGAATCCAGGG - Intronic
1098145708 12:67495940-67495962 TTCAAATACAATTGAATACAGGG - Intergenic
1099325478 12:81209600-81209622 CTCACACAAGATTGAATTCAGGG + Intronic
1103236841 12:119380169-119380191 GTAAAACAAAACTGCTTCCAAGG - Intronic
1105586530 13:21750232-21750254 GTAATACAAAAATGTATCCATGG - Intergenic
1105716180 13:23067259-23067281 ATAGAACAAAATTGAATGCAAGG + Intergenic
1106792350 13:33168497-33168519 GTTAGACAAATATGAATCCAAGG + Intronic
1107398582 13:40045138-40045160 ATCTAAAAAAATTGAAGCCAGGG + Intergenic
1110036650 13:70694679-70694701 GTTAAATCAAATTGAAGCCAAGG - Intergenic
1110073941 13:71215079-71215101 GTCAAACACAATTTAATTGATGG + Intergenic
1111366249 13:87249583-87249605 TTGAAACAAACTTGCATCCAAGG - Intergenic
1115382973 14:32760608-32760630 CTCAAAGAAGATTGAATACACGG - Intronic
1115948442 14:38692634-38692656 TTAAAACAATATTAAATCCATGG - Intergenic
1116467145 14:45247191-45247213 GTCAAAAAAGATTGCATCCATGG + Exonic
1117862596 14:60108401-60108423 GTTACAAAAAAATGAATCCATGG + Intronic
1121858401 14:97292338-97292360 GAGAAATAAAATTGAATCCATGG + Intergenic
1121880513 14:97496570-97496592 GTGAAATAAAATTGCACCCACGG - Intergenic
1123911855 15:24976010-24976032 GAAAAACAAAATTGAAACCTGGG - Intronic
1125642560 15:41243458-41243480 GGCAATCAAAATTCAATCCCAGG - Intronic
1126483532 15:49154833-49154855 GTGAAAGATAATTGAACCCATGG - Intronic
1130160399 15:81393344-81393366 CTCAAAGAACATTGACTCCAAGG + Intergenic
1132306412 15:100817421-100817443 GTCAAAGATAATTGTTTCCATGG - Intergenic
1132427180 15:101727585-101727607 GTCAAATAACATTCAATTCATGG - Intergenic
1135560981 16:23476769-23476791 GTTAAGCAAAATTTGATCCATGG - Intronic
1135592117 16:23712252-23712274 GTCAAACAAAATTCATTTCTGGG - Intronic
1138881883 16:61026518-61026540 TTTAAACATAGTTGAATCCAGGG - Intergenic
1140194207 16:72843634-72843656 GTCAAACAAGACAGAAGCCATGG + Intronic
1147435232 17:40408524-40408546 GTAAAACATAATAGAATCAAGGG - Exonic
1150495287 17:65603257-65603279 GTCAAGGAAAATGGCATCCAAGG + Intronic
1152937301 17:83147142-83147164 ATTTAACAACATTGAATCCATGG + Intergenic
1157783261 18:50458732-50458754 CCCAAACAAAGTTGAAGCCAAGG + Intergenic
1157929440 18:51805048-51805070 GTCAGACAAAATTTAACCCAAGG + Intergenic
1158928735 18:62299276-62299298 ATCAAACTAATTGGAATCCAAGG + Intronic
1162174623 19:8822113-8822135 GTCAGACAAGCCTGAATCCATGG - Intronic
1164392564 19:27838387-27838409 GTAAAACAAATTTATATCCATGG + Intergenic
1165261315 19:34621421-34621443 GTCTCACAAAATGGAATCCTTGG + Intronic
1166150444 19:40870081-40870103 GCCAAAAAAAATTGAACTCATGG - Intronic
925612192 2:5711059-5711081 CTCCAAAAAAATAGAATCCATGG + Intergenic
926455620 2:13064967-13064989 GTCAAAAGGAATTCAATCCAGGG - Intergenic
928494189 2:31814751-31814773 GTTAAAAAAAATTAAAACCATGG - Intergenic
928667911 2:33569330-33569352 ATCACACAAAATTAAATTCAAGG + Intergenic
928694740 2:33837888-33837910 GAGAAAAAAAATTGACTCCATGG + Intergenic
929522287 2:42665023-42665045 GTTAAAAAACATTGAAGCCATGG + Intronic
930334883 2:50032813-50032835 GTCATCCAAAATTGAATGGATGG + Intronic
931510555 2:62987298-62987320 GTCAACCAAAATTAAATATACGG - Intronic
931946131 2:67309745-67309767 GTCTAATATTATTGAATCCATGG + Intergenic
931946864 2:67318832-67318854 GAAAAAAAAAATTGAAACCAGGG + Intergenic
933041617 2:77474763-77474785 ATCCAACATAATTGAATCAAAGG - Intronic
936472544 2:112811799-112811821 GTCTTAGAAAATAGAATCCAAGG + Intergenic
936869130 2:117111400-117111422 GTCAAACAAATTCCAATTCAGGG - Intergenic
940819816 2:158340399-158340421 GTGAAACAAAATTGAATTAAAGG + Intronic
940843318 2:158610608-158610630 GACAAAAAAACTTCAATCCATGG - Intronic
941033807 2:160544004-160544026 ATCAAGCAAAGTTGAATTCATGG - Intergenic
941283842 2:163584554-163584576 TTAAAAAAAAATTGAACCCAGGG - Intergenic
942005087 2:171690158-171690180 GTCAGACAAAAGTGAATTAAAGG + Exonic
943305736 2:186260198-186260220 TTCAGACAAAATGGAATTCATGG - Intergenic
944333596 2:198502227-198502249 GTTATAGAAAATCGAATCCAGGG + Intronic
945441146 2:209881776-209881798 GTGAAGGAAAATTGACTCCAAGG - Intronic
947338590 2:229113075-229113097 TTCAAACAAGATTGAAGCTATGG + Intronic
947390807 2:229637285-229637307 GTCAAACAAAATGGAATGAATGG - Intronic
947951508 2:234151985-234152007 GTGGAAGATAATTGAATCCAGGG - Intergenic
948194999 2:236088713-236088735 ATCAAACAAAAGAGAATCTATGG - Intronic
1169180163 20:3557488-3557510 CTCAAACAAGAGTGAATTCAGGG + Intronic
1170360127 20:15537099-15537121 GTCGGACATAATTGAATCCTGGG + Intronic
1170790350 20:19503553-19503575 GTCAAAAAATATTGAATGTATGG + Intronic
1174519328 20:51117618-51117640 GTTAAACAAAATTGAGTCACGGG + Intergenic
1174848862 20:53971653-53971675 TTCAAATAAAATTTAATTCAGGG - Intronic
1177224852 21:18241198-18241220 GTAAGACAGCATTGAATCCAAGG - Intronic
1177418095 21:20820642-20820664 GCCAAACAAAAATGAGTCAAGGG + Intergenic
1177910313 21:27022911-27022933 TTCAAACAAAATCTAATCCTGGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
949379954 3:3433424-3433446 GTCAAACTTAATTAAACCCAGGG + Intergenic
950678044 3:14566363-14566385 GGCACACAAAATTGAAACCCTGG + Intergenic
950981491 3:17311665-17311687 GAGAAACAAAATTAAATCCTAGG + Intronic
951583479 3:24190738-24190760 GTCAAACAAGGCTGAATCCTGGG - Intronic
951624083 3:24641262-24641284 GTCAAAATAAATTGGCTCCATGG - Intergenic
953393510 3:42548256-42548278 ATTAAACAAAATAGAATCCTGGG + Intronic
956312031 3:67891865-67891887 GTCAAACAAACTAGCATCCGTGG - Intergenic
957216171 3:77322267-77322289 GTCAAACATAATTCCTTCCAAGG - Intronic
958963433 3:100533195-100533217 GTCAACTGAAATTGAAACCATGG - Intronic
960177155 3:114531578-114531600 TTGAAACAAAATAGAATCAATGG + Intronic
961501503 3:127339663-127339685 GTCAAACAGACTTGAATTCTAGG + Intergenic
962016282 3:131443740-131443762 GTGCAGCAAAATTGAACCCATGG + Intergenic
962770983 3:138609859-138609881 CTAAAACAAGATAGAATCCACGG + Intronic
964150119 3:153514214-153514236 GTCAATCAAAATGGAATGGAGGG + Intergenic
964543675 3:157808292-157808314 TTTAAACAAAATTGTAACCATGG + Intergenic
966321987 3:178711178-178711200 GTCAGTCAAAATTCAAGCCAGGG + Intronic
966562390 3:181337442-181337464 TTCAAACAAAATTGAGTGGAAGG - Intergenic
968147660 3:196312797-196312819 CTCAAACACAAAAGAATCCAGGG + Intronic
971888219 4:32481233-32481255 TTCAAATAAAGTTGAATTCAGGG + Intergenic
971889765 4:32505092-32505114 CTCAGACAAAATAGAAACCAAGG + Intergenic
972902044 4:43697241-43697263 ATCAGACAAAATAGATTCCAAGG - Intergenic
973267054 4:48221285-48221307 GTGAGACATAATTGAATCCTGGG + Intronic
973316032 4:48761140-48761162 TTCAAACAAAATTATATACAGGG - Intronic
973856252 4:55013167-55013189 GACAAAAAAAAAAGAATCCATGG + Intergenic
975572845 4:75835772-75835794 GAGAAACAAAAATGAATTCACGG - Intergenic
975667896 4:76751963-76751985 GTCCAAAAAAATTGAAAGCAGGG + Intronic
976201503 4:82583913-82583935 GTTAAACAAAATGGAATTTAAGG + Intergenic
976395784 4:84554026-84554048 GCCAAACAAAATTGAAAAGAAGG + Intergenic
977332822 4:95659231-95659253 ATCAAACATCATTAAATCCATGG - Intergenic
977389967 4:96395644-96395666 GCCAAAAAAAATTGAGTTCATGG - Intergenic
977821693 4:101479121-101479143 ATAAAACAAAATAGAATTCAAGG - Intronic
978020459 4:103804043-103804065 ATAAAATAAAATTGAATACAAGG - Intergenic
978108982 4:104938910-104938932 TTCAGACACAATTGAATCCAGGG - Intergenic
978212389 4:106153839-106153861 ATCAGACAAAATAGAATTCAAGG - Intronic
978264605 4:106808499-106808521 GACTAACAAAATTGACCCCAGGG + Intergenic
978463415 4:108983213-108983235 GTCAAATAAAATGAACTCCATGG + Intronic
978775615 4:112503600-112503622 GAAAAACAAAATTGAATCCAAGG + Intergenic
979642627 4:123026967-123026989 GTGAAACAAAATGGTATCTAGGG - Intronic
979644208 4:123048585-123048607 GTCAAAGAAAATTTATTCCTAGG + Intronic
980466878 4:133198286-133198308 ACCAAACAAAATTGAATTAAAGG + Intronic
982745497 4:159102060-159102082 GGCAAACAAAAATAAATCCCTGG + Intergenic
983679646 4:170338470-170338492 ATCAAAAAAAGTTGAATTCATGG + Intergenic
983806695 4:172002180-172002202 GACCAAGAAAATTCAATCCATGG - Intronic
983810893 4:172060758-172060780 GTCAAACAAAATGGAATGCTGGG - Intronic
985164697 4:187080332-187080354 GTCAAAAAATATTTTATCCATGG - Intergenic
985522421 5:382326-382348 GTCCAAGGAAATTGAATTCATGG - Intronic
986815982 5:11411797-11411819 GTCAACCAACATTAAAGCCAAGG + Intronic
987293131 5:16526614-16526636 GTTAAACAAAATTAAAACCTTGG - Intronic
987747385 5:21993711-21993733 GTCTCACAAGATTGAAACCAAGG - Intronic
988062591 5:26192698-26192720 GTCAAACAACCTTGCATTCATGG - Intergenic
988131325 5:27110344-27110366 GTCACACAAGAAAGAATCCAGGG + Intronic
988914503 5:35878881-35878903 GCCAAACAACATTGAAACAAAGG - Exonic
989117291 5:37967463-37967485 GTCCACCAAACTTGAATCCCTGG - Intergenic
990490623 5:56299573-56299595 CTCAAAAGAAATTGAATCAATGG + Intergenic
991153221 5:63397232-63397254 GTGAAACACAATTCATTCCATGG + Intergenic
991214408 5:64145737-64145759 GTCAAACAAAATAAAAACCTAGG + Intergenic
991271618 5:64790145-64790167 GTAAATGGAAATTGAATCCATGG - Intronic
991767559 5:70003504-70003526 GTCTCACAAGATTGAAACCAAGG - Intergenic
991846793 5:70878580-70878602 GTCTCACAAGATTGAAACCAAGG - Intergenic
992377371 5:76201278-76201300 GTCAAATGAAAATGAATCAATGG - Intronic
992497919 5:77311151-77311173 GAAAAACAAAATTGGATCCATGG + Intronic
993065527 5:83093756-83093778 GACAAACAAAAATGAAAACACGG + Intronic
994141072 5:96342030-96342052 GTGAGACCAAACTGAATCCAAGG + Intergenic
995844498 5:116479416-116479438 GGCACACAAAATGGAAACCATGG - Intronic
996898175 5:128511208-128511230 GGCAAACAAAATAGAATGAAGGG - Intronic
998240817 5:140442856-140442878 GTCAAACAAAATTGCACATAGGG - Intronic
998660587 5:144232702-144232724 ATAAAACAAAATTAAATACATGG - Intronic
1002128385 5:177064098-177064120 GTCAAACAGGCTTGAATCCCAGG - Intronic
1002756976 6:171535-171557 GTGGGACATAATTGAATCCAGGG + Intergenic
1007917469 6:45574614-45574636 GTCAAAGAATATTGAATAGAGGG - Intronic
1008434630 6:51461169-51461191 GTTGAACAAGATTGAATTCAAGG + Intergenic
1011482892 6:87812662-87812684 ATCAAACTAATTTGAATGCATGG - Intergenic
1012533703 6:100269826-100269848 GCCAAACAAAAATAAATCTAAGG + Intergenic
1013028489 6:106305474-106305496 GACAAACTTAATTGAATTCAGGG + Intronic
1013634767 6:112018744-112018766 GACAAACAAAACCAAATCCAGGG - Intergenic
1014045046 6:116876106-116876128 AACAAACAAAATGGGATCCAAGG - Intergenic
1015555979 6:134461815-134461837 GGTAAACATAATTGAAACCAAGG - Intergenic
1016807950 6:148232049-148232071 GTCAAACAGAATTGGGTTCAAGG - Intergenic
1020862621 7:13513862-13513884 TTGAAACAATCTTGAATCCATGG - Intergenic
1021402341 7:20223512-20223534 GGCAAGGAAAATTGGATCCATGG - Intergenic
1021565671 7:22014275-22014297 GTCAGACAAAAGGGAAGCCAAGG + Intergenic
1022290013 7:28992362-28992384 CTCAAAAGAAATTGAATCGATGG - Intergenic
1022538952 7:31117764-31117786 ATCAAACAAAATAGAATTTAAGG - Intergenic
1024731583 7:52259324-52259346 CTCAGGCAAAATTGTATCCAGGG + Intergenic
1024757614 7:52554103-52554125 GTCAAACCAAGTTGAATTCAAGG - Intergenic
1027932874 7:84562153-84562175 GTCGAAAAAAAATAAATCCATGG - Intergenic
1028036995 7:85996952-85996974 GTCAGACAAAATAGATTTCAAGG - Intergenic
1028049228 7:86161199-86161221 TTGAAACAACATTGAATCCAAGG - Intergenic
1028333119 7:89621732-89621754 GGGAAACAGAATTGAAGCCAAGG + Intergenic
1030261376 7:107568169-107568191 GTCAAAAAGAATTGAAAGCAGGG - Intronic
1030885617 7:114933015-114933037 GGAAATCAAAATTGAATCAAAGG - Intronic
1030926641 7:115464604-115464626 GTCAGACAAAATAGAATTCAAGG - Intergenic
1031288118 7:119898519-119898541 GTAAAAAAAAAATGAATCCAAGG + Intergenic
1031306523 7:120133792-120133814 GTCAGACAAAATAGATTTCAAGG + Intergenic
1032486759 7:132293455-132293477 GTGAAAGATAATTGAATCCTGGG - Intronic
1032959046 7:137008831-137008853 GTCAAGAAAAAACGAATCCATGG - Intronic
1037506026 8:19530250-19530272 AACAAAAAAAATTCAATCCATGG + Intronic
1038613379 8:29072726-29072748 TTCATACAAAATAGAATCCAGGG + Intronic
1038863485 8:31413440-31413462 TTCAAACAAAATTTAATATAAGG - Intergenic
1039073132 8:33664069-33664091 CACAAACAAAATTTAATTCATGG + Intergenic
1039112280 8:34052901-34052923 TTCAATCAAAAATAAATCCAAGG + Intergenic
1040446370 8:47499413-47499435 GTCAAGCAGACTTGAATCCCTGG + Intronic
1041206358 8:55502173-55502195 TTCAAATATATTTGAATCCATGG + Intronic
1042941504 8:74113304-74113326 GCAACACAAAATGGAATCCAAGG - Intergenic
1043375896 8:79649142-79649164 GGCAATTAAAATGGAATCCAGGG + Intronic
1043521122 8:81046580-81046602 GGCAAACATAATTTAATGCACGG + Intronic
1044901782 8:96954011-96954033 GTTAAACAAGATTGTATCAAGGG + Intronic
1046106867 8:109676599-109676621 GTCAAGCAACTTGGAATCCAGGG + Intronic
1046282057 8:112046134-112046156 GTCAATCAGAATTGAAACAAAGG - Intergenic
1047824190 8:128555280-128555302 GTATAACCAAATAGAATCCATGG - Intergenic
1048258571 8:132925120-132925142 GTTTATCAAATTTGAATCCATGG + Intronic
1050064840 9:1748823-1748845 ATGAAACAATATTGAAACCATGG + Intergenic
1051138555 9:13952228-13952250 GACAAAGAAAATAGAATCCATGG + Intergenic
1052415149 9:28168256-28168278 GTAAAATAAAATAGAAACCATGG - Intronic
1053377802 9:37622769-37622791 ATTAAACAAAATTGGATGCAAGG + Intronic
1054157957 9:61654276-61654298 GCCAAACAAATTGGAATCCCTGG + Intergenic
1054477730 9:65585281-65585303 GCCAAACAAATTGGAATCCCTGG + Intergenic
1056683854 9:88743569-88743591 CTCAAACAAATTAGAGTCCAGGG - Intergenic
1057789852 9:98117697-98117719 GTCACAGAAATTTGAATCTATGG + Intronic
1058449110 9:105079743-105079765 GTCAAACAACAATTAATTCAAGG - Intergenic
1059778698 9:117503791-117503813 TTCAAACAAACTTGCATCCCAGG + Intergenic
1061352040 9:130073126-130073148 GTAAAACAAACTGGAATGCAGGG - Intronic
1187400531 X:18955941-18955963 GTCAACCAGAATTGAAACCTAGG + Intronic
1188140624 X:26546163-26546185 AGCAAAAAAAATTGAATCTATGG + Intergenic
1189555312 X:42138303-42138325 GACAAACAATATTCAAACCATGG + Intergenic
1192429051 X:71100404-71100426 CTCAAAGAAAGTTGAATCCAGGG - Intronic
1193599921 X:83498679-83498701 ATCAAACAATATTTAAGCCATGG + Intergenic
1193737127 X:85171285-85171307 GTCTCATAAGATTGAATCCATGG + Intergenic
1196456039 X:115892424-115892446 GTGAAACAGAAATGAATGCAAGG + Intergenic
1197359435 X:125481517-125481539 TTCAAAGTAAATTAAATCCATGG - Intergenic
1198612221 X:138414349-138414371 ATCAGACAAAATTGATTTCAAGG + Intergenic
1199538808 X:148934331-148934353 GCCAAACAAAACTGCATTCACGG - Intronic
1199910389 X:152280649-152280671 GAAAAACAAAATGGAATCCTGGG - Intronic
1201200871 Y:11539118-11539140 TTCAAATAAAATAGAATCAATGG + Intergenic
1201201260 Y:11542479-11542501 TTCAAATAAAATAGAATCGATGG + Intergenic
1201201650 Y:11545840-11545862 TTCAAATAAAATAGAATCGATGG + Intergenic
1201202297 Y:11551464-11551486 TTCAAATAAAATAGAATCGATGG + Intergenic
1201202954 Y:11557170-11557192 TTCAAATAAAATAGAATCGATGG + Intergenic
1201204249 Y:11568314-11568336 TTCAAATAAAATAGAATCGATGG + Intergenic
1201204898 Y:11573916-11573938 TTCAAATAAAATAGAATCGATGG + Intergenic
1201205549 Y:11579523-11579545 TTCAAATAAAATAGAATCGATGG + Intergenic
1201206197 Y:11585129-11585151 TTCAAATAAAATAGAATCGATGG + Intergenic
1201206846 Y:11590731-11590753 TTCAAATAAAATAGAATCGATGG + Intergenic
1201737981 Y:17290970-17290992 GTCCAAGAAAATTGAATCATAGG - Intergenic