ID: 917178434

View in Genome Browser
Species Human (GRCh38)
Location 1:172265106-172265128
Sequence TTTAGTCATGGCTATTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917178428_917178434 24 Left 917178428 1:172265059-172265081 CCCTGCATGGAACTGACCATTGC 0: 1
1: 0
2: 0
3: 11
4: 111
Right 917178434 1:172265106-172265128 TTTAGTCATGGCTATTTGTATGG 0: 1
1: 0
2: 0
3: 21
4: 266
917178430_917178434 8 Left 917178430 1:172265075-172265097 CCATTGCTCCTGCTACAGTTCCT 0: 1
1: 0
2: 2
3: 35
4: 380
Right 917178434 1:172265106-172265128 TTTAGTCATGGCTATTTGTATGG 0: 1
1: 0
2: 0
3: 21
4: 266
917178431_917178434 0 Left 917178431 1:172265083-172265105 CCTGCTACAGTTCCTGACAAACT 0: 1
1: 0
2: 0
3: 8
4: 143
Right 917178434 1:172265106-172265128 TTTAGTCATGGCTATTTGTATGG 0: 1
1: 0
2: 0
3: 21
4: 266
917178429_917178434 23 Left 917178429 1:172265060-172265082 CCTGCATGGAACTGACCATTGCT 0: 1
1: 0
2: 1
3: 14
4: 92
Right 917178434 1:172265106-172265128 TTTAGTCATGGCTATTTGTATGG 0: 1
1: 0
2: 0
3: 21
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917178434 Original CRISPR TTTAGTCATGGCTATTTGTA TGG Intronic
904017390 1:27432883-27432905 TGTAGTCCTGGCTACTTGTGAGG - Intronic
904100314 1:28020612-28020634 TTTAGTCATAGCTGTATGTGGGG - Intronic
904593996 1:31631720-31631742 TTTTGTCGTGGATATTAGTAAGG - Intronic
905460895 1:38122396-38122418 TTTAGCCTTAGCTATTTGGAAGG - Intergenic
905812768 1:40925193-40925215 GTTAGGCATGGCTATTAGTATGG + Intergenic
906074398 1:43041488-43041510 TGTAGTCCTAGCTATTTGGAAGG + Intergenic
906630960 1:47367887-47367909 TGTAGTCCTAGCTACTTGTAAGG - Intronic
906820973 1:48929547-48929569 TTCACTCATGGCAACTTGTATGG + Intronic
908362616 1:63383535-63383557 TATAGTCCTGGCTACCTGTAAGG - Intronic
908507360 1:64818223-64818245 TTTAATAATGGTTATCTGTAGGG - Intronic
908999634 1:70203010-70203032 TTTAGTCCTAGCTACTTGGAAGG - Intronic
909711392 1:78653475-78653497 TATAAACATGGCTATATGTATGG - Intronic
909961951 1:81856767-81856789 CTTAGCCATGCTTATTTGTAGGG + Intronic
910346187 1:86241431-86241453 TGTAGTCCTGGCTACTTGGAAGG + Intergenic
910555835 1:88531910-88531932 TTTAGTCATTACTTTTTCTAAGG + Intergenic
910594002 1:88959156-88959178 TGTAGTCATAGCTATTTGGGGGG + Intronic
912765935 1:112410636-112410658 TTTAGACATAGATATTTCTAAGG - Intronic
912970115 1:114273403-114273425 TTCAGACATGGCTACTTCTAAGG - Intergenic
913467554 1:119158261-119158283 TGTAGTCATAGCTATTTGGGAGG - Intergenic
914687437 1:149993204-149993226 TTTATTCAAGTTTATTTGTAGGG + Intronic
914741166 1:150466254-150466276 TGTAGTCTTGGCTACTTGGAAGG + Intronic
916772871 1:167930152-167930174 TTTAGTGATAGCTATTTCCAAGG - Intronic
917178434 1:172265106-172265128 TTTAGTCATGGCTATTTGTATGG + Intronic
917652718 1:177095092-177095114 TTTAGCCAAAGCTATTTCTAAGG + Intronic
920132316 1:203741696-203741718 TGTAGTCATGGGGATATGTAGGG - Exonic
920760012 1:208774455-208774477 TTTAGTCATAGCTTTTTATTGGG - Intergenic
921487886 1:215736229-215736251 TGGAGTCATTGCTATTAGTAGGG - Intronic
922235901 1:223722407-223722429 TGTAGTCCTGGCTACTTGGAAGG - Intronic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
923923094 1:238591358-238591380 TTTAGTCATGTCTATATCTATGG + Intergenic
924887801 1:248238761-248238783 TTTAGTCATGGTAAATTGTGTGG - Intergenic
1064451256 10:15444102-15444124 TTTTGTCATGGTTAGTTTTAAGG - Intergenic
1064685164 10:17854070-17854092 TTTAGTCACAGCTATTTGGGAGG - Intronic
1066294695 10:34043947-34043969 TGTAGTCCTGGCTACTTGGAAGG - Intergenic
1068754724 10:60639759-60639781 TTTAGAAATGACTATTTTTAAGG - Intronic
1069028956 10:63575518-63575540 TTTATTCATTTGTATTTGTAAGG + Intronic
1070184275 10:74045672-74045694 TTTAGACATGCCTATTTATATGG + Intronic
1070550975 10:77490415-77490437 TTAAGTCATTGCTGTCTGTAAGG - Intronic
1071372813 10:84969906-84969928 TTTAAGTATGGCTATTTTTAAGG + Intergenic
1072274491 10:93809706-93809728 TTTAGGCATGGCTATATGACAGG - Intergenic
1073246824 10:102096723-102096745 TTTAGTCCTAGCTATTTGAACGG + Intergenic
1073992475 10:109278315-109278337 TTTAGTTTTGGCTATTTCTCTGG - Intergenic
1075764648 10:124883719-124883741 TCTAGTCCTAGCTATTTGTAAGG + Intergenic
1076607884 10:131701242-131701264 CTAAGTCATGGTTGTTTGTACGG - Intergenic
1078110987 11:8392153-8392175 TTTAGGCACAGCTATTTATAGGG - Exonic
1081276777 11:41159166-41159188 TTTAGTCCTAGCTATTTGTGAGG + Intronic
1086426791 11:86692589-86692611 TTTAATTGTGGTTATTTGTAGGG + Intergenic
1093425074 12:19019434-19019456 TTTAATCATGGCTGTTTTTCAGG + Intergenic
1093869135 12:24265420-24265442 TTCAGTCTTAGCTATTTGTGAGG + Intergenic
1094558798 12:31529849-31529871 TTAAGCCATGGCTATTCATATGG - Intronic
1094626425 12:32128892-32128914 TGTAGTCCCGGCTACTTGTATGG - Intronic
1095556848 12:43517166-43517188 TTTTGTTATTGCTATTTCTAAGG + Intronic
1096118789 12:49072737-49072759 TATAGTCATTTCTAGTTGTAAGG + Intergenic
1096419771 12:51447202-51447224 TATAGTCCTAGCTATTTGGAAGG - Intronic
1096833599 12:54333583-54333605 TGTAGTCCTAGCTATTTGGAAGG + Intronic
1096874624 12:54617677-54617699 TTTAGTCCCAGCTATTTGAAAGG - Intergenic
1097092113 12:56514795-56514817 TGTAGTCCTCGCTATTTGTTGGG + Intergenic
1098989810 12:77052805-77052827 TTTTGTCATGTTGATTTGTAGGG - Intronic
1102298594 12:111755675-111755697 TTTAATCATGGCTATATCCAAGG - Exonic
1102593585 12:113975556-113975578 TGGAGTAATGGCTATTTCTAGGG + Intergenic
1102638863 12:114348638-114348660 TGTAGTCCTAGCTATTTGGAAGG - Intergenic
1103840026 12:123855458-123855480 TTTAGTTTTGGGTATTTGTTTGG - Intronic
1105478882 13:20755092-20755114 TCTAGTCATGGCTATAAGCAGGG + Intronic
1107406423 13:40118284-40118306 TGTAGTCCTAGCTATTTGGAAGG + Intergenic
1107913000 13:45123270-45123292 TTCAGTCAAGGGTATATGTATGG + Intronic
1108381717 13:49860873-49860895 TATAGTCGTAGCTATTTGGAAGG + Intergenic
1108632374 13:52298850-52298872 TTTAGTCTTGGCAGGTTGTATGG + Intergenic
1109211859 13:59544496-59544518 TTTTGTAATGGGTATTTGGAAGG - Intergenic
1110045164 13:70819056-70819078 TGTAGTCCTAGCTATTTGAAAGG + Intergenic
1110967706 13:81721647-81721669 TTTACTCAGGGTTATTTGAAGGG + Intergenic
1113831808 13:113301499-113301521 TGTAGTCATAGCTACTTGGAAGG + Intronic
1115302203 14:31897130-31897152 TGTAGTCCTGGCTGTTTGGAAGG - Intergenic
1115331089 14:32199284-32199306 TATAGTCCTAGCTATTTGTGAGG - Intergenic
1115841849 14:37481017-37481039 TGTAGTCCTAGCTATTTGGAAGG + Intronic
1116986458 14:51224943-51224965 TTCAGTCTTGGCTTATTGTAAGG - Intergenic
1118119402 14:62821691-62821713 GATATTCATGGCTATTTTTATGG - Intronic
1118385040 14:65249087-65249109 TCTAGTCCTAGCTATTTGGAGGG + Intergenic
1119911287 14:78351963-78351985 TGTAGTCCTAGCTATTTGGAAGG + Intronic
1120627797 14:86850585-86850607 TCTAGTCCTGGCTACTTGTGGGG + Intergenic
1121768945 14:96514293-96514315 TGTAGTCATAGCTACTTGTGAGG - Intronic
1122175425 14:99914545-99914567 GTTTGTCTTGGTTATTTGTAGGG + Exonic
1122639899 14:103153067-103153089 TCTAGTCCTGGCAACTTGTAAGG + Intergenic
1124000317 15:25753896-25753918 TGTAGTCATAGCTATTTGGGAGG - Intronic
1124156290 15:27227563-27227585 TGTAGTCCTAGCTATTTGGAAGG + Intronic
1126340231 15:47633287-47633309 TTTAGTCATTGCCATTTTTAAGG + Intronic
1126457599 15:48880946-48880968 TTTAGTCCTCACAATTTGTAAGG - Intronic
1126983497 15:54274363-54274385 TATAGGCATGGATATTTGTGTGG + Intronic
1128965660 15:72055162-72055184 CATAGTCATAGCTATTTGAAAGG + Intronic
1129628709 15:77233985-77234007 TGTAGTCATGGCTACTTGGGAGG - Intronic
1129863361 15:78881635-78881657 TTTAGACAGGGTTATTTGTGAGG - Intronic
1130805382 15:87315499-87315521 TTTAGTCATGGTTTTCTGTAGGG + Intergenic
1131252133 15:90837857-90837879 TGTAGTCCTGGCTATTTGGGAGG - Intergenic
1132487637 16:203584-203606 TTCAGTCCTAGCTATTTGAAAGG + Intronic
1133633229 16:7641809-7641831 GGTAGTCATGGCTATTTACATGG - Intronic
1134439289 16:14288201-14288223 TGTAGTCCTGGCTACTTGAAAGG - Intergenic
1136004270 16:27317784-27317806 TTTTGTCATGGGTGTTTGCAGGG + Intronic
1137285604 16:47013816-47013838 TTTAGTTAGGGCTCTTTGGATGG + Intergenic
1137637585 16:50000418-50000440 TGTAGTCCTGGCTATTTGGGAGG - Intergenic
1137930843 16:52585957-52585979 TTTAGGCATGGCTCTATGTGGGG - Intergenic
1140391197 16:74588539-74588561 TGTAGTCCTGGCTACTTGTGAGG - Intronic
1141195180 16:81855086-81855108 TGTAGTCACAGCTATTTGAAAGG + Intronic
1141416832 16:83882179-83882201 TTAACACATGGCTGTTTGTAGGG - Intergenic
1144274315 17:13650490-13650512 TTTAGTGAGGGCTCTTTGTTTGG + Intergenic
1145735290 17:27225553-27225575 TGTAGTCCTGGCTACTTGGAAGG - Intergenic
1145987164 17:29054807-29054829 TTCACTCATGGCGATTTGCAAGG + Intronic
1147047504 17:37765193-37765215 TTTAGATATGTTTATTTGTATGG + Intergenic
1149205334 17:54237916-54237938 ATTAGTCTTGGCAATTTGAAAGG - Intergenic
1149383150 17:56114635-56114657 TTAAGACATGGCTATTTTTGGGG - Intronic
1150834010 17:68548406-68548428 TTTAGTCCCAGCTATTTGGAAGG + Intronic
1152165215 17:78699909-78699931 TGTAGTCCCGGCTATTTGTGAGG - Intronic
1153334247 18:3905711-3905733 TTCTGACATGGCTATTTTTATGG - Intronic
1155191291 18:23433179-23433201 TGTAGTCATGGCTACTTGGGAGG - Intronic
1155291717 18:24349043-24349065 TGTAGTCCTGGCTATTTGGGGGG + Intronic
1156796071 18:41047852-41047874 TAGAGTCAGGGTTATTTGTATGG - Intergenic
1157782801 18:50455005-50455027 TGTAGTCCTAGCTATTTGGAGGG + Intergenic
1158062497 18:53362784-53362806 TTTAGTGAACACTATTTGTAAGG - Intronic
1159557314 18:69958887-69958909 TTTAGCTATTGCTATTTTTAAGG + Intronic
1161691800 19:5739716-5739738 TTTAGTCCTAGCTACTTGGAAGG + Intronic
1162005197 19:7773796-7773818 TGTAGTCCTGGCTATTTGGGAGG + Intergenic
1162869024 19:13571768-13571790 TGTAGTCCTAGCTATTTGGAAGG + Intronic
1166254620 19:41593912-41593934 TTTAGTCCTAGCTACTTGGAAGG + Intronic
1166578897 19:43874496-43874518 TTTATTCATGGTTATGTGTTTGG - Intronic
1166624444 19:44337513-44337535 TTTGGACATGGCTATTTTTAGGG + Intronic
1167041543 19:47025695-47025717 TGTAGTCCTGGCTACTTGGAAGG - Intronic
1167771518 19:51523016-51523038 TGTAGTCATAGCTATTTGAAAGG + Intronic
1168503038 19:56909527-56909549 TGTAGTCCTAGCTATTTGTGAGG - Intergenic
926101477 2:10121145-10121167 TTTAGTTGTGGCTTTGTGTAAGG + Intergenic
926793796 2:16602036-16602058 TTTGGTTATGACTATTTGAAAGG + Intronic
927293992 2:21432409-21432431 TTGAGTTGTGGCTATTTGTCAGG - Intergenic
927362600 2:22253533-22253555 TTTGGTCATGGCTTTCTGAAAGG + Intergenic
929293794 2:40223543-40223565 ATTAGTCATTGCTATTTGGATGG + Intronic
929360646 2:41085396-41085418 TATAGTGTTGGCTATTTGTGTGG - Intergenic
929458004 2:42079770-42079792 TGTAGTCCTGGCTACTTGGAAGG + Intergenic
931942205 2:67264921-67264943 TGTAGTCTTAGCTATTTGGAAGG - Intergenic
932216244 2:69967958-69967980 TGTAGTCCTGGCTATTTGGTAGG + Intergenic
932980645 2:76661904-76661926 TGTAGTCCTCGCTATTTGGAAGG - Intergenic
933859868 2:86455372-86455394 TGTAGTCCTAGCTACTTGTAAGG - Intronic
939036559 2:137138411-137138433 TTTACTCTTGGCTATTTGGGTGG + Intronic
941513883 2:166447679-166447701 TTTCTTCATTTCTATTTGTATGG + Exonic
941767515 2:169314287-169314309 TGTAGTCGTAGCTATTTGGAAGG + Intronic
942026884 2:171919579-171919601 TGTAGTCCTGGCTATTTGGGAGG + Intronic
944613729 2:201438520-201438542 TTTATTCCTGGCTCTTAGTATGG - Intronic
946292302 2:218754529-218754551 TATAGAGATGGGTATTTGTAGGG + Exonic
947532085 2:230915714-230915736 TTTATTCATGGATGTTTGTGAGG - Intronic
1169110394 20:3029259-3029281 TTTAGTCCTAGCTACTTGGAGGG - Intronic
1169330955 20:4716001-4716023 TGTAGTCATAGCTATTTGGGAGG + Intergenic
1169361730 20:4955666-4955688 TTTAGTCCTAGCTACTTGAAGGG + Intronic
1169479990 20:5970928-5970950 TTTAGTCCTAGCTACTTGTGAGG - Intronic
1169960682 20:11156489-11156511 TTTTGTCATGCGTATTTCTAGGG - Intergenic
1170976075 20:21165915-21165937 TGTAGTCCCAGCTATTTGTAAGG - Intronic
1172298740 20:33832898-33832920 TGTAGTCATAGCTATTTGGGAGG - Intronic
1174514561 20:51081870-51081892 TGTAGTCCTGGCTACTTGTGGGG + Intergenic
1175678892 20:60970187-60970209 TGTATTCCTGGCTATTTGGAAGG + Intergenic
1177394398 21:20513621-20513643 TTTAGACATACCTGTTTGTATGG - Intergenic
1178252900 21:31021452-31021474 TGTAGTCATGGCTATTTGGGAGG - Intergenic
1178791476 21:35704388-35704410 TTTAGTCCTAGCTACTTGTGAGG + Intronic
1178800841 21:35794083-35794105 TTTTGCCATGGCTTTTTGAAGGG + Intronic
1178956940 21:37031267-37031289 TTTAGTCCCGGCTATTTGGGAGG - Intergenic
1180930534 22:19587450-19587472 TTTAGTCCTGGCTACTTGGGAGG - Intergenic
1183755922 22:39764352-39764374 TGTAGTCGTAGCTATTTGGAAGG + Intronic
949595845 3:5546773-5546795 TTTACTCCTGGATTTTTGTATGG + Intergenic
950079437 3:10210628-10210650 TGTAGTCCTGGCTATTTGGGAGG + Intronic
951556023 3:23921694-23921716 TGTAGTCCTGGCTATTTGGGAGG - Intronic
952687365 3:36165023-36165045 TGTAGTCCTGGCTATTTGAGAGG + Intergenic
952961723 3:38596039-38596061 TTTACTCATGCTTATTTTTATGG + Intronic
953323226 3:41990795-41990817 TTTAGTCCTGGCTATTCGGATGG + Intergenic
954193451 3:48981208-48981230 TGTAGTCCTGGCTACTTGGAAGG + Intronic
954567889 3:51614281-51614303 TATAGTCATAGCTACTTGGAAGG - Intronic
955313422 3:57913834-57913856 TGTAGTCTTGGCTACTTGGAAGG + Intronic
956400683 3:68876559-68876581 TTTAGTCAAGAGTATTTGCAGGG + Intronic
956892688 3:73627599-73627621 TTTATTCATGTTTATTGGTATGG - Intergenic
957928368 3:86844280-86844302 TTTGGTCATGTCTAATTTTAAGG + Intergenic
959498498 3:107078503-107078525 GTTAGTCCTGGCTACTTGGAAGG - Intergenic
962216308 3:133524962-133524984 TTTAGTAATGGCTACCTGCAAGG + Intergenic
962724102 3:138205188-138205210 TTTAGTCCTGGCTACTCGGAAGG - Intronic
962993480 3:140601804-140601826 TTTAGCCATGGCAATTTTTCTGG + Intergenic
963625769 3:147670506-147670528 TTTAGCCCTGGCTACTTGTGAGG - Intergenic
963869529 3:150400179-150400201 TTTAATAATGGCTATCTCTAAGG - Intergenic
964246922 3:154664680-154664702 TGAATTCATGGCTATTTGTAGGG - Intergenic
965954872 3:174357690-174357712 GTTAGTTATGGCAATTTGTGTGG - Intergenic
966951153 3:184819086-184819108 TTAAGTCATTGCTGTTTATATGG + Intronic
969068829 4:4514266-4514288 TTTACTTATGGCAATTTTTATGG - Intronic
970252836 4:14134541-14134563 TTTAAACATGGCCATGTGTAGGG - Intergenic
971802368 4:31308669-31308691 TGTAGTCCTAGCTATTTGGAAGG - Intergenic
972459188 4:39284458-39284480 TGTAGTCATAGCTACTTGCAAGG - Intronic
973872179 4:55177756-55177778 TTGAGACAGGGATATTTGTATGG - Intergenic
973901399 4:55476413-55476435 TCTAGACATTGCTATTTGAATGG - Intronic
974460695 4:62184138-62184160 TTTGGTCATCGCCATTTGTAAGG - Intergenic
976311592 4:83618760-83618782 TTCAGTGCTGGTTATTTGTAAGG + Intergenic
976579809 4:86722400-86722422 TTGAGTCATGGCTGTTTCTAGGG - Exonic
977533791 4:98232444-98232466 TTTAGTCATGTCTTGTTGCAAGG + Intergenic
978413277 4:108448371-108448393 TGTAGTCCTAGCTATTTGGAAGG + Intergenic
979853908 4:125608578-125608600 TTTAGTGATTCCTATTTCTATGG + Intergenic
979960463 4:127013958-127013980 TGTAGTCCTGGCTACTTGGAAGG + Intergenic
980297339 4:130939099-130939121 TTTAGTGTTGCTTATTTGTATGG - Intergenic
980393404 4:132175713-132175735 TTTAGTACTGGCTTTTTCTAGGG + Intergenic
980398662 4:132249972-132249994 ATTAGACTTGGCTATTTATAAGG + Intergenic
981849673 4:149215076-149215098 TTTAGTCCTAGCTACTTGGAAGG + Intergenic
981980224 4:150782745-150782767 ATTTGTCATGGCTATTTGTTGGG + Intronic
982216013 4:153083078-153083100 TTTAGTCATTGCCATCTGTCAGG + Intergenic
985165419 4:187089199-187089221 TTTAGTAATGGTTATTACTATGG + Intergenic
986799493 5:11245094-11245116 TGTTGTCAGGGCTACTTGTAAGG - Intronic
986943743 5:12989282-12989304 TTAAGCTATGCCTATTTGTAAGG + Intergenic
987181852 5:15376028-15376050 TATACTGATGGCTATTTGTTTGG + Intergenic
988905367 5:35782748-35782770 TTTAGTAAGGGCTATTTTAATGG - Intronic
989129895 5:38096954-38096976 TATAGTCATAGCTATTTGGGAGG - Intergenic
989416819 5:41187973-41187995 ATTGTTCATTGCTATTTGTAGGG - Intronic
991382751 5:66048896-66048918 TTTAGACATGGCTTTCTGAAAGG + Intronic
992124231 5:73625313-73625335 TATAGTTAAGACTATTTGTAAGG - Intergenic
996128676 5:119754651-119754673 TCTATTCATGTCTATTTTTATGG - Intergenic
997262244 5:132474191-132474213 TTTAGTCCTGGCTACTTGGGAGG - Intronic
997736159 5:136214013-136214035 TTCTGTCATTGTTATTTGTAGGG + Intronic
997768062 5:136524941-136524963 CCTCCTCATGGCTATTTGTAGGG + Intergenic
998840517 5:146249101-146249123 TGTAGTCCTAGCTATTTGGAAGG - Intronic
1000513429 5:162211159-162211181 TGTAGTCTTAGCTATTTGAAAGG + Intergenic
1000675477 5:164117388-164117410 TTAAGCCATGGATATTTGTCAGG - Intergenic
1000731945 5:164845645-164845667 TGTAGTCCTGGCTACTTGGAAGG - Intergenic
1003587218 6:7402818-7402840 TTTCGTCATGGCTATTGTAAAGG + Exonic
1004564828 6:16786436-16786458 TTTAGTCATAGCTACTTGGGTGG + Intergenic
1004658875 6:17691920-17691942 TGTAGTCCTGGCTACTTGGAAGG - Intronic
1006714115 6:36103459-36103481 TGTAGTCCTAGCTATTTGGAAGG - Intronic
1007039165 6:38705548-38705570 TATAGTCTTAGCTATTTGTGAGG - Intergenic
1007051146 6:38831301-38831323 TGTAGTCCTGGCTATTTGGGAGG + Intronic
1007976287 6:46104777-46104799 TTTAGTCAAGGAAATTTCTAAGG - Intergenic
1009902170 6:69820793-69820815 TTTAGTCATTGCCTTTTGTTAGG + Intergenic
1010198934 6:73266023-73266045 TTTTGTCAATGCTTTTTGTATGG - Intronic
1010583082 6:77623395-77623417 TTTAGGCAAGGCTACTTGAAGGG - Intergenic
1012471652 6:99579271-99579293 TTTTCTCATGACTAGTTGTAGGG - Intergenic
1013140828 6:107332880-107332902 TATAGTGAAGGGTATTTGTATGG + Intronic
1013561993 6:111314784-111314806 TTTAGTAATGTATATATGTAAGG - Intronic
1013871638 6:114769311-114769333 TCTAGTCATGTCTATGTGCAGGG + Intergenic
1017209733 6:151841832-151841854 TGTAGTCCTAGCTACTTGTAAGG - Intronic
1021558051 7:21941723-21941745 TTTGCTCAGGGCAATTTGTAAGG - Intronic
1023975416 7:45026042-45026064 TTTAGTCATGTCTATTTCCCTGG + Intronic
1024388912 7:48784770-48784792 TTTAGTCCTAGCTACTTGGAAGG - Intergenic
1026712455 7:72754557-72754579 TGTAGTCTTGGCTACTTGTTGGG - Intronic
1027356809 7:77365080-77365102 TGTAGTCCTAGCTATTTGGAAGG - Intronic
1034823762 7:154241436-154241458 TGTAGTCCTGGCTATTTGGGAGG + Intronic
1035866435 8:3088107-3088129 TTTAATCATCCCTCTTTGTAAGG + Intronic
1037161873 8:15782355-15782377 TGTAGTCATAGCTACTTGTAAGG + Intergenic
1037384113 8:18319198-18319220 TGTGGTCATAGCTATTTGAAAGG - Intergenic
1038794133 8:30694775-30694797 TGTAGTCCTGGCTATTTGGGAGG + Intronic
1040408016 8:47127781-47127803 ATTAGGAATGGCTATTGGTAGGG - Intergenic
1041183404 8:55272398-55272420 TTTTGCCATGGCTGTTTTTATGG - Intronic
1041943119 8:63410203-63410225 ATTAGTTATGGGTATTTCTAGGG - Intergenic
1042777153 8:72445388-72445410 TGTAGTCCTGGCTATTTGGGAGG + Intergenic
1043063333 8:75532742-75532764 TTTAGTCATGGGTATTTCAGTGG - Intronic
1043208167 8:77474474-77474496 TATAGTCATGGGTAATTGGAGGG - Intergenic
1044307989 8:90659626-90659648 TGTAGTCCTAGCTATTTGTGAGG - Intronic
1044465465 8:92498622-92498644 TTTAGTGATGGATATTTAAATGG - Intergenic
1045588465 8:103565424-103565446 TGTAGTCCTGGCTACTTGGAAGG - Intronic
1045806402 8:106167575-106167597 TTTAATCTTGGCTATTTGTCTGG + Intergenic
1047636859 8:126773218-126773240 TCTTGTCATTGCTATTTGAATGG + Intergenic
1048643465 8:136390418-136390440 TTCAGTCATGGCTAGATCTAAGG - Intergenic
1050503419 9:6322625-6322647 TATAGTCCTGGCTACTTGGAAGG + Intergenic
1050656984 9:7839644-7839666 TTTAGGCATGGCTAGGTCTAAGG - Intronic
1050803738 9:9647736-9647758 TTTTGTCTTGGCTTTATGTAGGG + Intronic
1050880886 9:10699414-10699436 TTGAGTCAAGGATATTTATATGG - Intergenic
1052554421 9:29995861-29995883 TTACATCATGGCTATTTTTATGG + Intergenic
1052844627 9:33324255-33324277 TGTAATCCTGGCTATTTGGAAGG + Intronic
1055289457 9:74767852-74767874 TGTAGTCCTAGCTACTTGTAAGG + Intronic
1057600744 9:96454995-96455017 TGTAGTCCTGGCTATTTGAGAGG + Intronic
1058040150 9:100294044-100294066 TGTAGTCCTAGCTATTTGTGAGG + Intronic
1058703555 9:107620546-107620568 TTTAGTCCTGTCTAGCTGTAGGG + Intergenic
1059133000 9:111774418-111774440 TGTAGTCCTAGCTATTTGTAAGG - Intronic
1059295062 9:113263035-113263057 TATAGTCCTGGCTATTTGGGAGG + Exonic
1059579654 9:115530576-115530598 CATAGTCAGAGCTATTTGTAAGG - Intergenic
1060315032 9:122501709-122501731 TTTATTATTGGCTATTTGTCAGG - Intergenic
1185534438 X:849701-849723 TGTAATCATGGCTATTTGGGAGG - Intergenic
1186695167 X:12022742-12022764 TTTAGTCTTGGCTTTCGGTAGGG + Intergenic
1186731156 X:12411522-12411544 TGTACTCATTGCTATTTATATGG - Intronic
1188689656 X:33113992-33114014 TTTTGTCTTGGTTATTTTTATGG - Intronic
1190122914 X:47677530-47677552 TTTAGTCCTAGCTAATTGAAAGG - Intergenic
1190636455 X:52439426-52439448 TTTAGCCATTGCTAATTCTATGG - Intergenic
1192119759 X:68444330-68444352 TGTAGTCATGGTCATTTGAAGGG - Intergenic
1192295939 X:69848079-69848101 TTTCCTAATGGCTAATTGTATGG + Intronic
1193728231 X:85068834-85068856 TGTGGACATGGATATTTGTATGG - Intronic
1194054938 X:89120114-89120136 TGTAGTCCTGGCTACTTGGAAGG + Intergenic
1195660474 X:107372914-107372936 TTGAGTCATGGCTATATGTTGGG - Intergenic
1196221937 X:113121548-113121570 TTTTTTCCTTGCTATTTGTACGG + Intergenic
1196460689 X:115926519-115926541 TGTAGTCCTGGCTAGTTGGAAGG - Intergenic
1197308809 X:124878589-124878611 TTTAGTCATGGCAAAGTGGAAGG - Intronic
1198319581 X:135506510-135506532 TGTAGTCCTGGCTACTTGGAAGG - Intergenic
1201789662 Y:17825529-17825551 TGTAATCCTGGCTATTTGTGAGG - Intergenic
1201811892 Y:18080460-18080482 TGTAATCCTGGCTATTTGTGAGG + Intergenic
1202050251 Y:20773466-20773488 ATAAGTCATGCCCATTTGTAGGG - Intronic
1202351314 Y:23995279-23995301 TGTAATCCTGGCTATTTGTGAGG - Intergenic
1202519465 Y:25674840-25674862 TGTAATCCTGGCTATTTGTGAGG + Intergenic