ID: 917178772

View in Genome Browser
Species Human (GRCh38)
Location 1:172269074-172269096
Sequence CAACTCCAGTTTAAATCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917178772_917178775 7 Left 917178772 1:172269074-172269096 CCCAAGGATTTAAACTGGAGTTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 917178775 1:172269104-172269126 AGCCATTAGTAGTGCCAGCAAGG 0: 1
1: 0
2: 0
3: 7
4: 86
917178772_917178777 14 Left 917178772 1:172269074-172269096 CCCAAGGATTTAAACTGGAGTTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 917178777 1:172269111-172269133 AGTAGTGCCAGCAAGGATTTTGG 0: 1
1: 0
2: 0
3: 11
4: 134
917178772_917178779 29 Left 917178772 1:172269074-172269096 CCCAAGGATTTAAACTGGAGTTG 0: 1
1: 0
2: 0
3: 8
4: 139
Right 917178779 1:172269126-172269148 GATTTTGGTCAAAGTGTTTGAGG 0: 1
1: 0
2: 1
3: 13
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917178772 Original CRISPR CAACTCCAGTTTAAATCCTT GGG (reversed) Intronic
901244455 1:7718313-7718335 AAACACCACTTGAAATCCTTGGG - Intronic
901285795 1:8077701-8077723 AAACTCCACTTCATATCCTTTGG + Intergenic
908996838 1:70165763-70165785 TAACTACTGTTTAAATACTTAGG + Intronic
916532369 1:165669351-165669373 GATCTCCAATTTTAATCCTTTGG + Exonic
917178772 1:172269074-172269096 CAACTCCAGTTTAAATCCTTGGG - Intronic
918211321 1:182353649-182353671 GAACTCCAGATTAAAACCATGGG + Intergenic
919497664 1:198295589-198295611 CTATTCCTGTTTAACTCCTTAGG + Intronic
921223721 1:212995980-212996002 CTTCTCCACTTTAAATCCTTTGG + Intronic
922427762 1:225515535-225515557 CAACTCTACTTCAAATCCTATGG - Intronic
1063756479 10:9015960-9015982 CAACTCCAGTTCAGTTTCTTGGG - Intergenic
1065150635 10:22819265-22819287 TAACTTCAGTTTAATTTCTTGGG - Intergenic
1065341011 10:24705065-24705087 CAACTCAAATTAAATTCCTTTGG + Intronic
1065917103 10:30362413-30362435 TAAATCCATTTTAAACCCTTGGG + Intronic
1066335383 10:34472177-34472199 CAACTCCAAATTTAATACTTTGG + Intronic
1073108951 10:101049485-101049507 CAACTCCAGTTTCTCTTCTTTGG + Intergenic
1074227067 10:111494821-111494843 CCACTCCAGTTTGAATTCTAAGG - Intergenic
1075948573 10:126458308-126458330 AAACCCCAGTTTTATTCCTTTGG - Intronic
1077073070 11:686431-686453 CTATTCCAGTTTAGCTCCTTGGG - Intronic
1078610822 11:12817897-12817919 CCTCTCCAGTATAAATCCGTGGG - Intronic
1079862443 11:25690877-25690899 CATCTCCAGATTAAATTGTTGGG + Intergenic
1086167424 11:83795824-83795846 CAACCCCAATTTATATCATTAGG + Intronic
1087650147 11:100856711-100856733 TAACTACATTTTAAATCATTTGG + Intronic
1092807392 12:12236983-12237005 CAGCTCCACTTCACATCCTTGGG - Intronic
1092831247 12:12446616-12446638 CACCTCCTGATGAAATCCTTTGG - Intronic
1093428627 12:19057818-19057840 CCACTTTAGATTAAATCCTTTGG + Intergenic
1103514491 12:121498403-121498425 CAACTCCAGCTTACCTCCTATGG + Intronic
1105468689 13:20672114-20672136 CAACTGCAGTTTCTATCCCTAGG - Intronic
1109079779 13:57884290-57884312 CAACTTTAGTTTAACACCTTTGG + Intergenic
1110194639 13:72773489-72773511 AAATTCCAGTGTAAATCATTTGG - Intronic
1110619483 13:77578913-77578935 ATACTACATTTTAAATCCTTGGG - Intronic
1114171618 14:20278612-20278634 CACTTCCTGTTTGAATCCTTGGG + Intronic
1116146673 14:41081531-41081553 CATCTCCAGTTCAACTGCTTCGG + Intergenic
1116664638 14:47759317-47759339 CAATTCCAGTTTAGTTCATTTGG - Intergenic
1118150108 14:63179963-63179985 AAACTCCAGAATAAATGCTTTGG + Intergenic
1118545516 14:66883623-66883645 TAACTCCTGTTAAAATCCTTTGG + Intronic
1130259092 15:82341068-82341090 TAACTCCATTTTAAACCCTCGGG - Intronic
1130282201 15:82528444-82528466 TAAGTCCATTTTAAACCCTTGGG - Intergenic
1130473543 15:84244276-84244298 TAACTCCATTTTAAACCCTCGGG + Exonic
1130480957 15:84358340-84358362 TAACTCCATTTTAAACCCTCGGG + Intergenic
1130490755 15:84429419-84429441 TAACTCCATTTTAAACCCTCGGG - Intergenic
1130502342 15:84508187-84508209 TAACTCCATTTTAAACCCTCGGG - Intergenic
1130595825 15:85248879-85248901 TAACTCCATTTTAAACCCTCGGG + Intergenic
1130764897 15:86859957-86859979 CAACTTCAGATTTAATCCTCTGG - Intronic
1132363564 15:101238677-101238699 CAGGTCCATTTTAAATCCATAGG - Intronic
1135208501 16:20503453-20503475 CAACTCCTGCCTAAATCCTCAGG - Intergenic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1137936131 16:52637236-52637258 CAACTCCACTCTAAATCCAAGGG - Intergenic
1144388207 17:14769833-14769855 CAATTACAGCTTAACTCCTTGGG + Intergenic
1148530820 17:48389545-48389567 CATTTCCATTTTAAATGCTTGGG + Intronic
1149738954 17:59024853-59024875 CAATTCCAGTCAAAATACTTTGG + Intronic
1154223436 18:12477941-12477963 TAACTCCTGCTTAAAACCTTCGG - Intronic
1155050814 18:22146345-22146367 TCACTCCAGTTTAAAACTTTAGG - Intergenic
1155894627 18:31309531-31309553 CAAATTCAGTTTAAATATTTTGG + Intergenic
1157728346 18:49982590-49982612 CAACCCCTGTTTTACTCCTTAGG - Intronic
1158587478 18:58754364-58754386 TAACTTCAGGTCAAATCCTTTGG - Intergenic
1158755359 18:60317802-60317824 CCACTCCAGTTTATAACCTTAGG - Intergenic
1159881748 18:73864873-73864895 CAACTCTCATTAAAATCCTTTGG + Intergenic
1160546963 18:79664468-79664490 CCACTCCAGTTGTAATCCCTAGG - Intergenic
1162618466 19:11820741-11820763 CAACTCCAGTTTCCATTCATTGG + Intronic
1162660436 19:12164198-12164220 CAACCCCAGTTTCCATCCTTTGG + Intronic
929956981 2:46465549-46465571 CAATTCTATTTTAAATGCTTGGG - Intronic
932002878 2:67900609-67900631 CAACTCCAGTCTCTGTCCTTTGG - Intergenic
933273962 2:80264339-80264361 CAAGTCCAGATTAAATTTTTGGG - Intronic
939011679 2:136854310-136854332 CAACTCCAGTTGAAAATTTTGGG + Intronic
939396334 2:141634972-141634994 TAATTCCTCTTTAAATCCTTAGG - Intronic
940608486 2:155959545-155959567 CAAATTCAGCATAAATCCTTAGG - Intergenic
940988892 2:160077677-160077699 CATCTCTAGTTAACATCCTTTGG + Intergenic
942531483 2:176914907-176914929 CAACTCCAGTTTTACTCCTCAGG - Intergenic
943518799 2:188921209-188921231 CAACTGCAATTAAAATCCATAGG - Intergenic
944039072 2:195334746-195334768 CACCGCCAGTTCAAATGCTTGGG + Intergenic
945555683 2:211272443-211272465 CAACTCAAATTCAAAGCCTTTGG + Intergenic
945884195 2:215357387-215357409 CAATGCTAGTTTCAATCCTTTGG + Intergenic
946825133 2:223670222-223670244 CACCACCACTTAAAATCCTTCGG + Intergenic
946940818 2:224768676-224768698 TAACTTCAGTTTAAATCATGAGG + Intronic
1170414516 20:16125667-16125689 GAACTCCAGCTGAAATCCTAGGG - Intergenic
1173115745 20:40241271-40241293 CAACTCCAGTTTAAATGAATAGG + Intergenic
1173341022 20:42153123-42153145 GAACTCTAGTTCAAATGCTTTGG - Intronic
1177599971 21:23298450-23298472 CAAATCCTGTTTAAATTCTAGGG + Intergenic
1178669322 21:34577071-34577093 CAACTGCAGTTTCCATCCTACGG + Intronic
1180974088 22:19836372-19836394 CATTTTTAGTTTAAATCCTTGGG + Intronic
1181284769 22:21743903-21743925 CAAATCCTGCCTAAATCCTTCGG + Intergenic
1182710265 22:32318205-32318227 CATATGCTGTTTAAATCCTTGGG - Intergenic
949713193 3:6896146-6896168 CAGCTCCAATTCACATCCTTTGG - Intronic
952566386 3:34663778-34663800 CAACACAAGTTCAAATCATTTGG + Intergenic
953097833 3:39796034-39796056 CATTTCCTGTTTAAATCCTCTGG + Intergenic
957198002 3:77095742-77095764 CCACTCATGTTTAAATACTTTGG + Intronic
957269899 3:78016338-78016360 CAACTCCAGTCTTTATCCATTGG + Intergenic
962106439 3:132395453-132395475 GAACTCAAGTTTAAACCCCTGGG - Intergenic
964514194 3:157489406-157489428 AAACTCCAGTCTACAGCCTTAGG + Intronic
966060103 3:175743605-175743627 CAACCCCAGTTAAGATACTTTGG - Intronic
966858398 3:184212818-184212840 CAATTCCACTTAAAATCCATGGG - Intronic
967974532 3:195025661-195025683 AAACTCCTGTTCAAAGCCTTAGG + Intergenic
968348640 3:198033239-198033261 CAAATCCTGTGTACATCCTTAGG + Intronic
972085863 4:35214744-35214766 CCAGTCCAGTTCAATTCCTTTGG - Intergenic
972460945 4:39301565-39301587 CCACTCCATTTTTAATCCATAGG + Intronic
972693595 4:41423056-41423078 GAACTCCATTTTAAATCCCCAGG - Intronic
975227267 4:71888689-71888711 CAAATACAATTTAAATACTTAGG + Intergenic
977961792 4:103094059-103094081 AAACTGCAATTAAAATCCTTTGG + Intronic
978903212 4:113978490-113978512 GTTCTCCAGTTTAACTCCTTCGG + Exonic
982832067 4:160074956-160074978 TTGCTGCAGTTTAAATCCTTAGG + Intergenic
983435307 4:167707670-167707692 CAAGCCCAGTTTAAATTCTATGG + Intergenic
984487113 4:180384821-180384843 TAACTCCAGTTTAAGTTCTATGG - Intergenic
984975125 4:185223458-185223480 AAACTCCTGTTTGATTCCTTTGG + Intronic
985232783 4:187839154-187839176 GAATTCCGCTTTAAATCCTTTGG + Intergenic
988986817 5:36628261-36628283 CAACTCCAATTTCAATTCTTGGG - Intronic
989098284 5:37801010-37801032 CATTTCCAGTTAGAATCCTTTGG - Intergenic
991591211 5:68253312-68253334 CAAGTCCAGCTTGAATCCTATGG - Intronic
991996500 5:72392296-72392318 CAACTCCAACTTAAATGCTATGG - Intergenic
993317369 5:86428205-86428227 CAACACCAGATTACATGCTTTGG - Intergenic
994240341 5:97412037-97412059 CAACTCCAATTTAAGTCAATTGG - Intergenic
997888584 5:137654863-137654885 CAACTATAGATTAAATCCCTGGG + Intronic
998424307 5:142013459-142013481 CAACACAAGTTTTAATACTTGGG - Intergenic
1002656367 5:180751369-180751391 CAGCTCCTGTTGAAAGCCTTGGG + Intergenic
1004929484 6:20448047-20448069 AAACTCCAGTTTCATTCCTGGGG + Intronic
1005626529 6:27667804-27667826 CAACTCGGGCTGAAATCCTTCGG + Intergenic
1006598288 6:35209318-35209340 CACCTCCAGTTTAGCTCCCTTGG - Intergenic
1009350282 6:62667033-62667055 CAACTCCAGTTTATTTTATTAGG - Intergenic
1011511913 6:88110834-88110856 CTGCTCCAGATTGAATCCTTTGG + Intergenic
1012074141 6:94661987-94662009 CAACTCCTGTTTACAACGTTCGG - Intergenic
1012353679 6:98286118-98286140 CAAATAAATTTTAAATCCTTGGG + Intergenic
1015255163 6:131171080-131171102 CTACTCAAGTATAATTCCTTGGG - Intronic
1016568096 6:145480945-145480967 CAACTCCAGTTTAGACTCATAGG - Intergenic
1016951074 6:149580781-149580803 CCACTCCATTTTAAATGCTAGGG - Intronic
1022190043 7:28008470-28008492 CAATTCCAGTATAAATTCTAAGG + Intronic
1023972570 7:45002115-45002137 CACCTCCAGTTTAATAACTTCGG + Intronic
1028801713 7:94973258-94973280 CAACTCTAGTTTATAACCTAAGG - Intronic
1037105182 8:15098020-15098042 CAACACCAGTTTAATTCCCAAGG - Intronic
1037352868 8:17981058-17981080 CATCTCCTGCTTCAATCCTTTGG + Intronic
1038943798 8:32335093-32335115 CCACTTCAGTTTAAATCCTATGG - Intronic
1040987980 8:53317301-53317323 CTACTCCAGTTTAAACTCCTCGG - Intergenic
1042521803 8:69720598-69720620 CAACTCAAGTTTCAACCCATTGG + Intronic
1044463021 8:92469316-92469338 AAACTATAATTTAAATCCTTTGG - Intergenic
1045148892 8:99380538-99380560 CAGAACCAGTATAAATCCTTAGG - Intronic
1048807292 8:138252757-138252779 CATCTCCAGGTTAAATACTAGGG - Intronic
1056015767 9:82385984-82386006 CATCTCCAAGTTAAACCCTTAGG + Intergenic
1057454823 9:95198687-95198709 CATTTCCAGTGTAAATACTTGGG - Intronic
1057689850 9:97273942-97273964 CAGCTCCAGGTTAAATTCTAAGG - Intergenic
1058401112 9:104620486-104620508 CAACTCCACTTTTTATACTTTGG + Intergenic
1058857972 9:109084870-109084892 CAACTCAACTTTAAAACTTTAGG + Intronic
1187482084 X:19666795-19666817 CAACTCCGATTTAAATTTTTGGG - Intronic
1194172357 X:90602714-90602736 CAATTGCATTTTAAATTCTTAGG - Intergenic
1194275317 X:91873060-91873082 CAACTCCTGTTCAAATCCCGTGG + Intronic
1195768718 X:108325185-108325207 AAACTCCAGTTTAAACTTTTTGG + Intronic
1199520625 X:148731255-148731277 CCACTTCAGTTTAGGTCCTTTGG - Intronic
1200518582 Y:4180451-4180473 CAATTGCATTTTAAATTCTTAGG - Intergenic
1200592562 Y:5094457-5094479 CAACTCCTGTTCAAATCCCGTGG + Intronic
1202367479 Y:24176136-24176158 TAACTCCATTTTAAACCCTCGGG + Intergenic
1202503304 Y:25493987-25494009 TAACTCCATTTTAAACCCTCGGG - Intergenic