ID: 917183458

View in Genome Browser
Species Human (GRCh38)
Location 1:172324286-172324308
Sequence TCCAGCTGGTTTGAATATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917183458 Original CRISPR TCCAGCTGGTTTGAATATGC CGG (reversed) Intronic
901957346 1:12796168-12796190 TCCAGCTGGTCTCAAACTGCTGG + Exonic
901973741 1:12928420-12928442 CCCAGCTGGTCTGAAACTGCTGG + Intronic
902011437 1:13273347-13273369 CCCAGCTGGTCTGAAACTGCTGG - Intergenic
910261444 1:85297225-85297247 TCCAGCACCCTTGAATATGCTGG - Intergenic
911472091 1:98331652-98331674 TCCAGCTGGTATGATAATACTGG + Intergenic
914844770 1:151276520-151276542 TCCTGCTGATTTAAATATCCAGG + Intergenic
915857883 1:159409510-159409532 TGCAGCTGGTTGGAAGAGGCAGG - Intergenic
917183458 1:172324286-172324308 TCCAGCTGGTTTGAATATGCCGG - Intronic
917783860 1:178430770-178430792 TCTAGCTGATGTGAATATGTAGG + Intronic
919113663 1:193253284-193253306 TCCAGGTAATTTGAATGTGCAGG + Exonic
1062847806 10:721291-721313 GCCAGCTGGTTGGAATGTGGGGG - Intergenic
1064994525 10:21284790-21284812 ACCAGTTGGCTTGAATATGATGG - Intergenic
1065397922 10:25261072-25261094 CCCAGATGGTTTTAATGTGCAGG - Intronic
1066812152 10:39354245-39354267 TCCATCTAGTTTTAATATGAGGG + Intergenic
1068773237 10:60845456-60845478 AGCAGATGGTTAGAATATGCTGG + Intergenic
1070287027 10:75091354-75091376 ACCAACTGCTTTGCATATGCCGG - Intergenic
1072546040 10:96439997-96440019 TCCAGCTGGTTGTACTATGATGG - Intronic
1079661271 11:23039749-23039771 TATAGCTGGTTTGAAGATGGAGG + Intergenic
1083371156 11:62182691-62182713 TTCACTTGGTTTGAATTTGCTGG + Intergenic
1083686098 11:64376218-64376240 TCCAGCTGATTAGACCATGCAGG - Intergenic
1084381166 11:68813741-68813763 TCCCACTGGGTTGAATATGATGG + Intronic
1087877820 11:103379011-103379033 TCCAGCTGGTTTGAGTTACCAGG - Intronic
1090344715 11:126060825-126060847 TGCAGGTGGTTTGACTTTGCAGG - Intronic
1091089388 11:132755959-132755981 TCCAGCTGCTAGGAAAATGCAGG + Intronic
1098091013 12:66901035-66901057 TGCAGCTGATTTAAATATTCTGG - Intergenic
1100071471 12:90724846-90724868 GCCAGCTGTTTTTAATATACTGG - Intergenic
1101286486 12:103318698-103318720 ACCAGCTGGTTAGAATACACGGG - Intronic
1102154909 12:110717315-110717337 ACCAGCTGGCTTGAATCTGCAGG - Intergenic
1105394189 13:20012916-20012938 TCAAGATTGTTTGAATATTCTGG + Intronic
1106041123 13:26094893-26094915 TCCAGCTGGACTGAATATGTTGG + Intergenic
1107529445 13:41267989-41268011 GCCAACCGGTTTGAAGATGCTGG - Intergenic
1114699667 14:24664262-24664284 TCCTGCTGGCTTGAAGATCCTGG + Intergenic
1116427091 14:44804472-44804494 TGCAGCTGATTTGAATCTTCAGG - Intergenic
1117994644 14:61467341-61467363 TCCAGCTGGCTTCAACATGTGGG + Intronic
1122171441 14:99878698-99878720 CCCAGCTTGTTGGAATATGAGGG - Intronic
1123476620 15:20595821-20595843 TCCAGGTGCCTTGAATCTGCTGG + Intergenic
1123641391 15:22404543-22404565 TCCAGGTGCCTTGAATCTGCTGG - Intergenic
1123967495 15:25473618-25473640 TCCAGCTGCTTTGTATACTCTGG - Intergenic
1126278475 15:46914200-46914222 TCCAGCTGGTTTCAAACTCCTGG + Intergenic
1126554102 15:49966498-49966520 TCCGCCTGGTTTGAACATCCTGG - Intronic
1127638230 15:60891390-60891412 GGCAGCTGCTCTGAATATGCAGG + Intronic
1127682641 15:61312428-61312450 TCCAGCTGCTTTGCATATTAAGG - Intergenic
1129433905 15:75522148-75522170 TCCAGCTGGTTCTAAGATCCTGG - Intronic
1133868222 16:9663824-9663846 TGCAGCTGGTGTGAACAGGCTGG + Intergenic
1137572877 16:49578264-49578286 TCCAGCTGCTATGGATAGGCTGG - Intronic
1139102222 16:63782234-63782256 TAGAGCTGTTTTGAATTTGCGGG + Intergenic
1150067221 17:62121197-62121219 TCCCTCTGCTTTGACTATGCAGG - Intergenic
1150679613 17:67274252-67274274 TCCAGCTGGTCTGAAACTCCTGG + Intergenic
1153772925 18:8429618-8429640 CCCAGGTGATTTGAATGTGCAGG + Intergenic
1156586496 18:38437113-38437135 TCCAGCTGTTTTGTATACCCAGG + Intergenic
1157925326 18:51758800-51758822 TCCAACTGCTTTGTATATACTGG - Intergenic
1159753746 18:72336823-72336845 TCCAGCTTGTTTTCATAAGCTGG + Intergenic
1160193981 18:76737878-76737900 TCCAGGTGGTGTGAATTTGGGGG + Intergenic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
1166919280 19:46217888-46217910 TACAGCTGATTGGAAAATGCTGG + Intergenic
1168241127 19:55089350-55089372 GCCAGCTTGTTTGAACATCCTGG + Intergenic
930735265 2:54772341-54772363 TCCAGTTGGTTTGGATAAGAAGG + Intronic
933407790 2:81883522-81883544 TCCAACTTGTTTTAGTATGCAGG + Intergenic
936230999 2:110699494-110699516 TCCAGCTGCTTTGTATTTGGAGG - Intergenic
937783962 2:125873510-125873532 CCCAGCTGTTTTGATTTTGCAGG + Intergenic
945118874 2:206438111-206438133 TCTAGGTGATTTGAATGTGCAGG + Intergenic
947552869 2:231059464-231059486 TCCAAGAGGTTTGACTATGCAGG + Intronic
948325811 2:237119807-237119829 GCCACATGGTTTGAATGTGCAGG - Intergenic
1169398839 20:5262137-5262159 TTCAAATGTTTTGAATATGCTGG + Intergenic
1169897187 20:10516997-10517019 TCCAGCAGGTTTTAAGTTGCAGG - Intronic
1170944182 20:20875671-20875693 TACTGCTGGTTTGATTATTCTGG + Intergenic
1174317613 20:49714533-49714555 GCCAGCTTTTTTGAATAAGCTGG + Intergenic
1176064826 20:63188928-63188950 TCCAGCAGGTTTGGTTTTGCAGG - Intergenic
1176365282 21:6029099-6029121 GCCAGCTGGTGTGAGGATGCAGG + Intergenic
1179758236 21:43509446-43509468 GCCAGCTGGTGTGAGGATGCAGG - Intergenic
1179831289 21:43998287-43998309 TCCACCTGGATTGAATCTGCTGG - Intergenic
1180825452 22:18858007-18858029 TCCTGTTGCTTTGAAGATGCTGG + Intronic
1180986341 22:19906099-19906121 TCCAGCTGGTTTGTGTATTAGGG - Intronic
1181187280 22:21116540-21116562 TCCTGTTGCTTTGAAGATGCTGG - Intergenic
1181211918 22:21293953-21293975 TCCTGTTGCTTTGAAGATGCTGG + Intergenic
1181397578 22:22632933-22632955 TCCTGTTGCTTTGAAGATGCTGG - Intergenic
1181496494 22:23290129-23290151 TCCAGCTGGTTTCACAATACAGG - Intronic
1181651826 22:24263125-24263147 TCCTGTTGCTTTGAAGATGCTGG + Intergenic
1181705549 22:24647614-24647636 TCCTGTTGCTTTGAAGATGCTGG - Intergenic
1182108757 22:27707753-27707775 TCCATCTGGCTTGAGTGTGCTGG - Intergenic
1184200195 22:42963285-42963307 TCCACATGGTTTGAGTAGGCTGG - Intronic
1203215036 22_KI270731v1_random:1479-1501 TCCTGTTGCTTTGAAGATGCTGG - Intergenic
1203275600 22_KI270734v1_random:83910-83932 TCCTGTTGCTTTGAAGATGCTGG + Intergenic
953582635 3:44171199-44171221 TCTAGCTGATTTCAATATGGAGG - Intergenic
960318835 3:116209495-116209517 TCCAGTCTTTTTGAATATGCTGG + Intronic
960377507 3:116921669-116921691 ACTAACTGGTTTGAGTATGCTGG + Intronic
961796199 3:129410865-129410887 TCCAGCTGTGATGAAAATGCAGG + Intronic
964754999 3:160084762-160084784 CCCAGCTGGCTTTAATTTGCTGG + Intergenic
964756660 3:160095383-160095405 TCCACCTGGCTTTAATTTGCTGG + Intergenic
964756889 3:160096842-160096864 TCCACCTGGATTTAATTTGCTGG + Intergenic
966418028 3:179709025-179709047 TCCAGGTGGTTGGAAGGTGCAGG + Intronic
966506774 3:180712160-180712182 TTCAGCTGGTTTGAAAATTAAGG - Intronic
970768240 4:19577423-19577445 GCCATCTGGTAGGAATATGCTGG - Intergenic
971667571 4:29509918-29509940 TCTAGCTGGTTTAATAATGCAGG + Intergenic
974492493 4:62585210-62585232 TCCAGCTGGTTTGGAACTCCTGG - Intergenic
976191320 4:82489828-82489850 TCCAGATTGTTTCAATCTGCAGG - Intronic
976707778 4:88037017-88037039 CCCAGCTGGTTTCAAAATCCTGG - Intronic
976809183 4:89082128-89082150 TCCTGCTGGCTTGAAGATGGAGG + Intronic
979557412 4:122065393-122065415 TTAAGCTGGTTAGAATATCCTGG - Intergenic
979877691 4:125913843-125913865 TCCAGATTGTTTGCTTATGCTGG - Intergenic
982924278 4:161316464-161316486 TCCAGCTACTGTGTATATGCTGG + Intergenic
989104061 5:37844267-37844289 TGCAGCTGCTTTGACTATGAGGG + Intergenic
990544937 5:56814263-56814285 TCCAGCTGGTTTGTTTAGGATGG - Intergenic
990675804 5:58183359-58183381 TCCAGGTGGTTTTAATGTGGAGG - Intergenic
992144591 5:73833047-73833069 AGCAGATGGTTTGAATGTGCTGG + Intronic
993257170 5:85605844-85605866 TCCTGCTGCTTTGACTGTGCTGG - Intergenic
996394097 5:122995249-122995271 TCCAGCAGCTTTGAAAATGCTGG + Intronic
997127789 5:131245646-131245668 TCCAGGTGATTCTAATATGCAGG - Intronic
997439120 5:133896794-133896816 TCCAACTGCTTAGAATATTCTGG + Intergenic
999939611 5:156527720-156527742 TCCAGCTGGTTTGGATTTGGGGG - Intronic
1003179369 6:3779137-3779159 TCAGGCTGGTTTGGACATGCAGG - Intergenic
1003702440 6:8483002-8483024 TTCAGCTGTTTCTAATATGCTGG + Intergenic
1010365089 6:75041302-75041324 TCCAGGTGGCTTGATTATGCTGG - Intergenic
1010512013 6:76731220-76731242 TCCTGCTGGCTTGAAGATGGAGG + Intergenic
1011330005 6:86193649-86193671 TCCAGAGACTTTGAATATGCAGG + Intergenic
1011375685 6:86683656-86683678 TTCAGCTGGTTTAATTATGAGGG + Intergenic
1012018862 6:93890266-93890288 TCCAGGTGGTTTGAAAATGCTGG + Intergenic
1013377148 6:109528663-109528685 TCACCCTGGTGTGAATATGCTGG - Intronic
1013459956 6:110365381-110365403 TCCTGCTCTTTTGAATATGAAGG - Intergenic
1014143887 6:117973972-117973994 TGCAGCTGGTATGCATATCCAGG + Intronic
1015044626 6:128762457-128762479 TCCTGCTGGTATGTAGATGCAGG + Intergenic
1016165826 6:140941796-140941818 ACTTGCTGGTTTGAAGATGCAGG + Intergenic
1021449226 7:20766728-20766750 TCTTGCTGGTTTGTCTATGCTGG - Intronic
1026279285 7:68907319-68907341 TGCAGCTGGATGGAATTTGCAGG - Intergenic
1026323556 7:69288175-69288197 CCCAGCTGGTTTGAAACTTCAGG - Intergenic
1029912857 7:104173708-104173730 TCCTTCTGGTTTGAATACTCCGG + Intronic
1031771162 7:125846285-125846307 ACCAGTTGATTTTAATATGCAGG + Intergenic
1031978744 7:128110564-128110586 TCAAGTTGGTTTGAATTTGTTGG + Intergenic
1032413052 7:131713962-131713984 TTCATCTGGTTTTGATATGCAGG + Intergenic
1032996915 7:137457113-137457135 TCCAGCTGGAATGAGTATCCGGG + Intronic
1034076784 7:148239728-148239750 TCAAGCTGGTTTGAAGGTACTGG - Intronic
1034935378 7:155196706-155196728 TCCAGCTGTTTTAAAAATGGGGG - Exonic
1037525750 8:19722612-19722634 GCCAGCTGGATTGAATTTGGTGG - Intronic
1037828073 8:22171501-22171523 TGCAGCTGGTTTGTGTATGTTGG + Intronic
1038275018 8:26114161-26114183 TCTGGGTGGTTTCAATATGCAGG + Intergenic
1048155127 8:131940112-131940134 TCTAGCTGGTTAGAATTAGCAGG + Intronic
1049607715 8:143537413-143537435 TCCAGCTGGTCTGAGTGGGCAGG - Intronic
1055086251 9:72317039-72317061 CACAGCTGTTTTAAATATGCAGG - Intergenic
1056371175 9:85955714-85955736 TCCAGATGATTTTAATATGCAGG - Intronic
1057755312 9:97830271-97830293 TCCAGGTGATTTTAATGTGCAGG + Intergenic
1058373917 9:104301847-104301869 TCTAGGTGATTTTAATATGCAGG - Intergenic
1058858297 9:109088505-109088527 TCCAGATGATTTTATTATGCTGG - Intronic
1187965571 X:24608151-24608173 TCCAGCTGGGCTGACTCTGCCGG - Intronic
1189249701 X:39590955-39590977 CACATCTGCTTTGAATATGCAGG - Intergenic
1191759344 X:64629777-64629799 TCAAGCAGCTTTGGATATGCTGG - Intergenic
1193352024 X:80474913-80474935 TCCACCTGGTTTGAACTTCCCGG + Intergenic
1195247952 X:103013458-103013480 TACTGCTGGTTTGAAGATGGAGG - Intergenic
1197455041 X:126669109-126669131 CCCAGCTGGTTTCAAAATCCTGG + Intergenic
1198432623 X:136582609-136582631 TCCAGGTGATTCTAATATGCAGG + Intergenic
1200754570 Y:6978054-6978076 TCCTGATGGTCTGAATATGGAGG + Intronic