ID: 917184222

View in Genome Browser
Species Human (GRCh38)
Location 1:172334668-172334690
Sequence AAGCAGTTACTGCTGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917184222_917184223 15 Left 917184222 1:172334668-172334690 CCATGTTTCAGCAGTAACTGCTT 0: 1
1: 0
2: 1
3: 16
4: 193
Right 917184223 1:172334706-172334728 TTCCCTGCCCTTTGATTTGCTGG 0: 1
1: 0
2: 3
3: 26
4: 244
917184222_917184228 26 Left 917184222 1:172334668-172334690 CCATGTTTCAGCAGTAACTGCTT 0: 1
1: 0
2: 1
3: 16
4: 193
Right 917184228 1:172334717-172334739 TTGATTTGCTGGTTTGCCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917184222 Original CRISPR AAGCAGTTACTGCTGAAACA TGG (reversed) Intronic
900095646 1:939072-939094 AAGCAGTCGCTGCTGATACGGGG - Exonic
900745318 1:4356764-4356786 AAGCAGTCACTGCTCACACGTGG - Intergenic
903866624 1:26403520-26403542 AAACAGTAACTGCAGAATCAGGG + Intergenic
905249373 1:36638171-36638193 AGGCACTTTCTGCTGAAACCAGG - Intergenic
906211183 1:44013121-44013143 CAGCAGTTACAGCTGTAAAAGGG + Intronic
908016517 1:59843865-59843887 AGGCAGTGATTGCTGAAACCTGG + Intronic
909690482 1:78401731-78401753 CAGGAATTGCTGCTGAAACATGG - Intronic
910617138 1:89210974-89210996 AAACAGTTATTTATGAAACAAGG + Intergenic
911323350 1:96440776-96440798 AAACAGCTACTACTGAAACCAGG + Intergenic
912191151 1:107342353-107342375 AAGCAGTTAAATCTGAACCATGG - Intronic
913486786 1:119339179-119339201 ATCCAGATACTGCAGAAACAGGG + Intergenic
916183921 1:162112709-162112731 AAGCTGTCACTTCTGAAAAAGGG + Intronic
917184222 1:172334668-172334690 AAGCAGTTACTGCTGAAACATGG - Intronic
917201563 1:172522259-172522281 AAGCAGTTGCTTTTTAAACAGGG - Intergenic
919958654 1:202443469-202443491 AACTAGTTATTGTTGAAACATGG + Intronic
920447057 1:206025528-206025550 AAGCAGTTACGGGCAAAACATGG - Intergenic
922195965 1:223361000-223361022 AAGCAGTTACCACTGATCCAAGG - Intronic
924440326 1:244080539-244080561 AAGCAGTTACTGATGAAAGCAGG - Intergenic
1064347549 10:14546633-14546655 AACCAGTGACTGCTCAGACACGG + Intronic
1067192978 10:44088161-44088183 AAGCAGTTTCTGATAAAATATGG + Intergenic
1068192940 10:53676915-53676937 AAGAATTTAATGCTGATACAAGG + Intergenic
1072206195 10:93207227-93207249 AAGTACTTACTGCTGCAGCACGG + Intergenic
1073045732 10:100637236-100637258 CAGCACTTCTTGCTGAAACAGGG - Intergenic
1075104302 10:119527763-119527785 AAGCAGTTGCTGTTGAATCAAGG - Intronic
1075129855 10:119728232-119728254 TGGCTGTTACTTCTGAAACATGG - Intronic
1081217232 11:40416487-40416509 AAGCAGATACTGATTACACAGGG + Intronic
1086616239 11:88823961-88823983 TAGCAGTTACTTCTGGAAGATGG - Intronic
1088052289 11:105532044-105532066 AAGAAGTTAAGGCTTAAACAGGG - Intergenic
1090922694 11:131220744-131220766 AAGGAGTGACTGGTGAAACCAGG + Intergenic
1092864498 12:12748085-12748107 AAGCAGTCACAGCTGATGCAAGG + Intronic
1093091105 12:14921313-14921335 AAGAAGTTACTCCTGAAAAGTGG + Intronic
1093878816 12:24380464-24380486 AAGGAGTTACTGTCAAAACATGG + Intergenic
1094047840 12:26186871-26186893 AAACAATTACAGCTGAAGCAAGG - Intronic
1094341647 12:29418715-29418737 AAGAAGTTACCTCTGGAACATGG - Intronic
1094742455 12:33305351-33305373 ATGCAATGACTGCTGAAACATGG - Intergenic
1096216734 12:49801872-49801894 CTGGAGTTTCTGCTGAAACAGGG + Exonic
1096260483 12:50087099-50087121 GAGCAGTTACAGCGAAAACATGG - Intronic
1100898587 12:99213306-99213328 AAGCAGTTTGTGCTGAAAAGTGG - Intronic
1101902276 12:108799634-108799656 AATGAGTTACTGCAGAAAAATGG + Intronic
1103028979 12:117596799-117596821 AATCAGTTACTGCTAAAATAAGG + Intronic
1104288841 12:127449911-127449933 AAGCAGTCACTGCAGAAAAGTGG + Intergenic
1105607940 13:21942718-21942740 AGGCAGTTACAGGTGAGACAGGG - Intergenic
1106865306 13:33958197-33958219 AAGAAGTTTCTGCTGGAAGAGGG + Intronic
1106942569 13:34794381-34794403 AAACAGTTCCTGCTAAAACTGGG - Intergenic
1107029193 13:35833515-35833537 AAGAAGTTACTCCTGGAGCATGG + Intronic
1108186941 13:47897481-47897503 TAGAACTTACTGCTGAAACCAGG + Intergenic
1109111464 13:58325718-58325740 AAGCAGTTATAGCAGAAAAAAGG - Intergenic
1109119372 13:58434907-58434929 AAGCAACTACTTCTAAAACAAGG - Intergenic
1111611174 13:90609528-90609550 AAGCAGGTACAGTTGACACAAGG + Intergenic
1112751350 13:102586956-102586978 AAGCAGCTTCTGCTAGAACAGGG - Intergenic
1113404487 13:110025590-110025612 AAACAGTTCCAGCTGAAGCAAGG + Intergenic
1113520014 13:110933904-110933926 AAGCAGGCACTGCAGAAACCAGG + Intergenic
1114683984 14:24510447-24510469 AAGCAGTAACTGTTGAGACTGGG + Intergenic
1114898559 14:27026272-27026294 AGGCAGCTACTGCTAAAACATGG + Intergenic
1116869078 14:50054752-50054774 AAGCAGTTACTGAAGGAAAATGG + Intergenic
1116972220 14:51077795-51077817 GAGCAGCTGTTGCTGAAACAAGG - Intronic
1120096001 14:80388355-80388377 AAGCAGACACGGCTGAATCAAGG - Intergenic
1121573186 14:94962662-94962684 AGGCAGTGTCTGCTGAGACAAGG - Intergenic
1122124009 14:99569473-99569495 AAGCAGTTACGGCTGCCCCAGGG + Intronic
1122331435 14:100918481-100918503 AAGTGTATACTGCTGAAACAAGG + Intergenic
1128254233 15:66185292-66185314 CAGGAGTTCCTGCTGGAACAGGG - Intronic
1128355369 15:66922814-66922836 AAGCAGTTCCTCCTGATAGAAGG + Intergenic
1131550023 15:93349404-93349426 AAGCAATTACTGGTGAACAATGG + Intergenic
1132066614 15:98736398-98736420 AAACAGTTATTGGTGAGACATGG + Intronic
1133964646 16:10521713-10521735 AATCTGTTACTGCTAGAACATGG - Intergenic
1136552003 16:30986807-30986829 AGGCAGGTACTGCTGAGACCTGG - Intronic
1140722007 16:77780524-77780546 AAGCATTTACTCCTCAAATAGGG - Intergenic
1140883566 16:79221612-79221634 TAGCAGTTAATCCTAAAACAAGG + Intergenic
1141895351 16:86955524-86955546 CAGCAGTTGCCTCTGAAACATGG + Intergenic
1143204572 17:5133018-5133040 AAGCACTCTCTGCAGAAACAGGG + Intronic
1146160316 17:30556008-30556030 AATCACTTTCTGCAGAAACAGGG + Intergenic
1148411892 17:47474471-47474493 CAGTAGTTACTACTGAAAAATGG + Intergenic
1155686003 18:28551059-28551081 AATCAGTTACTGCTGAAGTGTGG + Intergenic
1156029071 18:32691324-32691346 AAGCAGAAACTGGTGTAACATGG + Intronic
1157557813 18:48624194-48624216 CAGCAGGTGCTCCTGAAACATGG - Intronic
1162836975 19:13326395-13326417 ATGAACTTACTGCTGAAATAAGG - Intronic
1164144259 19:22501140-22501162 ACACAGTTACTGTTGAAATAAGG - Intronic
1166053009 19:40271921-40271943 AAGTATGTACTGCTGAAATAGGG + Intronic
1167198656 19:48048751-48048773 AAGCTGTTATTGCTGGATCAGGG - Intronic
1167438299 19:49492911-49492933 AAACAGTTACTCCTGAATCTTGG - Intergenic
925702321 2:6651091-6651113 AAGCAGAAGCTACTGAAACAAGG + Intergenic
931704779 2:64938170-64938192 AAGCAGCTAAGGCTGAAGCAGGG - Intergenic
932588216 2:73045451-73045473 AAGTAGGTACAGCTGAAACATGG + Intronic
933560701 2:83882592-83882614 CAGATGTTACTGCTGAACCAGGG - Intergenic
934621283 2:95809820-95809842 AGTCAGTAAGTGCTGAAACAGGG + Intergenic
935496229 2:103784592-103784614 AAGCAGGTACTGCTGAGAAATGG - Intergenic
938834620 2:135088225-135088247 AAGCAGTTATGGCTAAAACTAGG - Intronic
939827538 2:147032973-147032995 ACGCTGTTACTGCTGATAAAGGG + Intergenic
940053304 2:149487040-149487062 TAGCAGTTATTGCTGAAGAATGG - Intergenic
942406830 2:175665012-175665034 AAACAGACACTGCTGACACATGG + Intergenic
942687447 2:178548340-178548362 ACTCATTTACTGCAGAAACACGG + Exonic
944266958 2:197738397-197738419 AAGATGTTACTGCTGAATTAGGG + Intronic
945199078 2:207263660-207263682 TTGCAGTTACTGCTCACACATGG + Intergenic
945290596 2:208123754-208123776 CAGCAGTTACTGAGCAAACAGGG - Intronic
945804655 2:214475833-214475855 AATCAGTTACTTCTGCAACAGGG - Intronic
948812993 2:240494523-240494545 AAGCTGTCACTGCTGGGACAGGG - Intronic
1170594650 20:17795903-17795925 AAGCATTTCTTGCTGAAAAAGGG - Intergenic
1170658457 20:18313779-18313801 TAGGATTTACTGCTGAAAAAGGG + Intronic
1174409315 20:50323264-50323286 AAACAGTTAGTGCTGGTACACGG + Intergenic
1178742698 21:35217374-35217396 AAGAAGTTACTGTTGAACAAGGG - Intronic
1180821678 22:18833282-18833304 AAGTAGATTCTGCTAAAACAGGG + Intergenic
1181191300 22:21142763-21142785 AAGTAGATTCTGCTAAAACAGGG - Intergenic
1181207898 22:21267747-21267769 AAGTAGATTCTGCTAAAACAGGG + Intergenic
1181938091 22:26453249-26453271 AAGCAGAAGCTGCTGAAGCACGG - Exonic
1182936650 22:34228988-34229010 GAGCAGTCACTGCTGAGGCAGGG + Intergenic
1203219022 22_KI270731v1_random:27669-27691 AAGTAGATTCTGCTAAAACAGGG - Intergenic
1203271803 22_KI270734v1_random:59158-59180 AAGTAGATTCTGCTAAAACAGGG + Intergenic
950761778 3:15236300-15236322 AACCAGATATTGCAGAAACAGGG - Intronic
952314885 3:32223971-32223993 AAACAGTGACTGGTGAAATATGG - Intergenic
952574039 3:34753161-34753183 AAGCAGATGCTGATGATACAGGG + Intergenic
953843819 3:46410917-46410939 ATGCAGATACTGCTGACCCAAGG + Intronic
959797375 3:110446325-110446347 ATGCAGTTATTGCTTAAGCACGG - Intergenic
962428816 3:135300703-135300725 AAACAGTTACTGGAGAAACAAGG + Intergenic
962607838 3:137047220-137047242 ATGCAGTTACTACTGTAACTTGG - Intergenic
962665270 3:137648017-137648039 CAGCAGGCACTGCTGAATCAGGG + Intergenic
965059571 3:163767637-163767659 AACCAGTTACCTCTTAAACAAGG - Intergenic
969269413 4:6088971-6088993 AAGCAATTACTGTTGGGACAGGG - Intronic
970454214 4:16206077-16206099 AAGCAATTACTGCAGATTCAAGG + Intronic
973042869 4:45494684-45494706 AAGCAGTTGATGTTAAAACAGGG + Intergenic
973277595 4:48326538-48326560 AAGGAGTTTCTGCTGACATAGGG - Intergenic
973736514 4:53877039-53877061 AAGGAGTTATAGCTAAAACAAGG - Intronic
974688006 4:65256738-65256760 TGGCAGTTACAGCTCAAACAGGG - Intergenic
975575965 4:75862980-75863002 AAACTGATACTGCTGCAACATGG + Intronic
977293073 4:95184028-95184050 AAGAAATTACTCCTAAAACAGGG + Intronic
979121189 4:116904309-116904331 AAGCAGTTAATGGTGAAGAAGGG + Intergenic
979123441 4:116933091-116933113 AAGAAGTTAATGATAAAACAGGG + Intergenic
979633330 4:122928267-122928289 AAGGAGAAACAGCTGAAACAAGG - Intronic
980940205 4:139266851-139266873 CAGCAGTCAGTGCTGAAACCGGG - Exonic
982420423 4:155189335-155189357 ATGTAGTTACTGCTGACACAGGG - Intergenic
982596328 4:157389339-157389361 AACCAGTTATTCCTGAAAAATGG - Intergenic
983530552 4:168805690-168805712 AAGCAATTACCTCTGTAACAGGG - Intronic
984108217 4:175576782-175576804 AAGCTGTTACTGAGGAAACATGG - Intergenic
984192106 4:176618452-176618474 AAGCAGTCATTGCTGAAGCGTGG - Intergenic
985053881 4:186019252-186019274 AAGCAGTGGCAGCTGAAACCTGG + Intergenic
989682785 5:44048622-44048644 AAGAAGCCACTGTTGAAACAGGG - Intergenic
990355805 5:54965051-54965073 AAGAAATTACTGCTGAAACAAGG + Intergenic
991450440 5:66745294-66745316 AAGCAGTTGCTGCCTAAAGAAGG + Intronic
991490662 5:67179747-67179769 AAGCAGTGGCTGCTGGCACAGGG + Intergenic
992045029 5:72879233-72879255 AAGCAGCTGCTGCTGAAATTTGG - Intronic
992472098 5:77068002-77068024 AAGCTGTGACTGAAGAAACATGG + Intergenic
992622111 5:78604068-78604090 ATGCAGTTAGTGCAGATACATGG + Intronic
993469759 5:88292917-88292939 AAGTAGTGAATGCTCAAACATGG + Intergenic
995058060 5:107783751-107783773 AAGCATTTACTGCTGTGAGAAGG + Intergenic
996220483 5:120926228-120926250 AAGCAATTTATTCTGAAACAGGG + Intergenic
997216230 5:132113424-132113446 AAGCAGTTTCTGCTGACCAAAGG + Intergenic
997336872 5:133114804-133114826 AAGCAGTGACTGCAAAAAGAAGG - Intergenic
998713964 5:144860136-144860158 TAGCAGTTGCTGCTTAAATACGG + Intergenic
999019404 5:148146936-148146958 AAGCAGTGACTGCTAGACCAAGG - Intergenic
1000074393 5:157771198-157771220 AAGCATTTCCTGCTTGAACAAGG + Intergenic
1000869382 5:166556983-166557005 TAGCATTAACTGGTGAAACAGGG + Intergenic
1003309905 6:4961536-4961558 AAGCAGTCACTTCTGAAATCTGG + Intergenic
1003321862 6:5058880-5058902 AAGCAGTTAATGATAAATCAGGG - Intergenic
1004319729 6:14622874-14622896 ATGCAGTTGCTGCTGGACCAGGG - Intergenic
1005992471 6:30911967-30911989 AGGCAGTGACTTCTGAGACAAGG + Intronic
1007978456 6:46125858-46125880 TAGCAATTGTTGCTGAAACAGGG + Intergenic
1008694942 6:54024801-54024823 AAGCATTTTATGCTGTAACATGG + Intronic
1011484542 6:87828539-87828561 AGGCAGTTAGTGAGGAAACAGGG - Intergenic
1014540027 6:122664187-122664209 AAGCAGCTGCTGCTGAAAGCTGG - Intronic
1015463695 6:133523045-133523067 ATGCAGTTACTCCTAAAATAGGG - Exonic
1016067930 6:139703125-139703147 AAGCAGTAGCTTCTGAGACAGGG + Intergenic
1017476510 6:154799420-154799442 ATGAAGTGACTGCTGAAACTTGG - Intronic
1018130074 6:160721560-160721582 ATGCAGTGACTGCTGAAATCTGG - Intronic
1020440147 7:8208848-8208870 AAGCATTAAGTGATGAAACATGG + Intronic
1020892088 7:13890686-13890708 TAACAGATTCTGCTGAAACACGG - Intergenic
1022069559 7:26898966-26898988 AAGAAGCTGCAGCTGAAACAGGG + Intronic
1022621979 7:31993903-31993925 AAGCACATACTGCCGAAAAAGGG - Intronic
1022651245 7:32277467-32277489 AAGCAGATACTTCTGATAAATGG + Intronic
1026250081 7:68662293-68662315 AAGCATTTATTGCAGAAAAATGG + Intergenic
1032202975 7:129836441-129836463 AAGCAGTTACGGACGAAAAACGG + Intronic
1033974081 7:147078473-147078495 AAGCTGTTACTGATTAGACAGGG + Intronic
1033980466 7:147158124-147158146 AAGAAGTCACTGGGGAAACAGGG - Intronic
1035866785 8:3092741-3092763 AAGCAATTTCTCCTGAAAAATGG - Intronic
1036015012 8:4773395-4773417 AAGCAACTGCTGCAGAAACAAGG - Intronic
1036090172 8:5656868-5656890 AAACAGTTACTGCCGAGCCATGG + Intergenic
1036106543 8:5846689-5846711 CACCAGTCTCTGCTGAAACATGG + Intergenic
1036603743 8:10287877-10287899 AAGCAATTACTGCTGGAGAAGGG - Intronic
1040030490 8:42819397-42819419 AAGCTGTTTATGCTAAAACAAGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041345501 8:56892987-56893009 AGGCAGTCACTGCTGAATCCAGG + Intergenic
1041654330 8:60333653-60333675 TATCAGTTACTGATGACACATGG + Intergenic
1042820116 8:72921402-72921424 AAGCAGGTCCTGCTGAAATGTGG - Intronic
1043191339 8:77226252-77226274 AAGCATTTACTGCTTACAGATGG + Intergenic
1044080129 8:87873146-87873168 GAGAAGTCACTGCTGAATCATGG + Exonic
1044797539 8:95919578-95919600 AAGCAGTTTCACCTGAAGCAGGG - Intergenic
1046996605 8:120530952-120530974 TATCAGTTACTGCTGAGAAATGG - Intronic
1047233442 8:123017553-123017575 AAGCAGTTACTGCTTTTGCAAGG + Intronic
1047863186 8:128991551-128991573 AAGCAGTTACTGAGCAAACAAGG + Intergenic
1048053068 8:130837514-130837536 AAGCAGTTACTTCTAATACAGGG - Intronic
1052194056 9:25690707-25690729 AAGCAGTTACTGCATAAACCAGG - Intergenic
1052230749 9:26148908-26148930 AATCAGTAACTTCTGTAACATGG - Intergenic
1052664267 9:31474250-31474272 AAGTAGTTACTGTTGATAAATGG + Intergenic
1053308336 9:36999777-36999799 AAGCAGCCACTGGGGAAACAGGG - Intronic
1054944008 9:70775372-70775394 AAGCACTTCCTGCTGTCACAAGG - Intronic
1055257968 9:74395185-74395207 TAGCAGTTAGTTCTGAAAAATGG - Intergenic
1056854286 9:90111920-90111942 AAGATGTTACTCATGAAACAAGG - Intergenic
1057330422 9:94109276-94109298 AAGAAGTTACTGCTTAAAGACGG + Exonic
1058128066 9:101219339-101219361 AAGCATTTAATGCTGAAATCTGG + Intronic
1059100612 9:111468484-111468506 CAGCAGTTACTGCCGAGAGAAGG + Intronic
1059498969 9:114734437-114734459 TAGTACTTACTGCTGAAAGACGG - Intergenic
1060538701 9:124414697-124414719 AAGCAGTCGCTCCTGAAAGACGG + Intronic
1061083933 9:128388456-128388478 ACGAAGTTACTTCTAAAACAAGG + Intronic
1062329222 9:136029679-136029701 AAGCAGCTTCTGCTGACACTGGG - Intronic
1187265812 X:17732060-17732082 AAGCTGTTACTGCTCAAGAAAGG + Exonic
1188248377 X:27860923-27860945 AAGCAGTTATTACTGCCACATGG + Intergenic
1189088569 X:38053211-38053233 ATGCTGATACTGCTGGAACAAGG + Intronic
1190423904 X:50313389-50313411 AAACTGATACTGCTGAACCAAGG - Intronic
1195478552 X:105316470-105316492 AAACAGTTATTGATGAAACCAGG + Intronic
1196297653 X:114017067-114017089 AATGACTTGCTGCTGAAACATGG + Intergenic
1198974185 X:142317169-142317191 AAGCATTTACTCCTGAAATCAGG + Intergenic
1199675099 X:150182052-150182074 AAGCAGTTACTGCTGCAGAAGGG - Intergenic
1201478234 Y:14407895-14407917 AAGCATTTACCTCAGAAACAAGG + Intergenic