ID: 917185287

View in Genome Browser
Species Human (GRCh38)
Location 1:172347078-172347100
Sequence CAGACCTTACATTCAAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917185287 Original CRISPR CAGACCTTACATTCAAATGG GGG (reversed) Intronic
901348765 1:8572709-8572731 TAGAACTTCCATTCCAATGGAGG + Intronic
901615728 1:10538083-10538105 CAGAGCTTAAATTCTAGTGGAGG + Intronic
902058331 1:13620677-13620699 TAGAGCTTACATTCTAATGCTGG + Intergenic
902183883 1:14710779-14710801 CAGAACTTTCATTCCACTGGAGG - Intronic
903208885 1:21804166-21804188 TAGAACTTACATTCCAGTGGAGG - Intergenic
903398197 1:23019093-23019115 AAGAACTTACAGTCTAATGGGGG - Intergenic
903468702 1:23569479-23569501 CAGACCTTACAATCTGAGGGTGG - Intergenic
903488248 1:23707557-23707579 TGGAGCTTACATTCTAATGGAGG + Intergenic
904096250 1:27980102-27980124 CATGCCTTACATTCATATGAGGG + Intronic
904365524 1:30008607-30008629 CAGAACCTAAATTCAAATGCTGG + Intergenic
904396810 1:30227793-30227815 CCTCCCTTACATGCAAATGGAGG + Intergenic
906257773 1:44363624-44363646 TAGAGCTTACATTCGAATGAAGG + Intergenic
906921700 1:50071263-50071285 TAGAGTTTACATTCAAATGAAGG - Intronic
908730715 1:67223324-67223346 CAGACCTTAAATTTAAACTGTGG - Intronic
908778171 1:67661960-67661982 CAGACCCTATATTCAAATCCTGG - Intergenic
909272223 1:73637836-73637858 CAGAGCTTATATTCCAATGGAGG - Intergenic
910091310 1:83467634-83467656 CAGTGTCTACATTCAAATGGGGG - Intergenic
910608873 1:89118003-89118025 TAGAGCTTACATTCTAATGATGG + Intronic
911617915 1:100035551-100035573 CAGAGCTTACATTCTAGTGGGGG - Intergenic
912504252 1:110144877-110144899 CAGAGCATAGATTCAAAGGGAGG + Intergenic
912516289 1:110218568-110218590 GGGACCTTACATTCTAGTGGAGG - Intronic
912889683 1:113516239-113516261 CAGACCTTACATTCAAATCTTGG + Intronic
913130610 1:115835176-115835198 CAGACCTCCCATTCACATGTAGG - Intergenic
916143333 1:161718817-161718839 TGGAGCTTACATTCTAATGGGGG + Intergenic
916358713 1:163943147-163943169 CAGAGCTTGCAATCAGATGGAGG + Intergenic
916863849 1:168835377-168835399 CACATCTTACAATCACATGGAGG - Intergenic
917185287 1:172347078-172347100 CAGACCTTACATTCAAATGGGGG - Intronic
917978994 1:180257900-180257922 CAGACCTCACAGACAAACGGTGG - Intronic
918940632 1:190992046-190992068 CAGACATTACATACAAACAGTGG - Intergenic
920785692 1:209039039-209039061 CAAACTTTAGATTCATATGGTGG + Intergenic
921145929 1:212356342-212356364 CAGAGCTTACGTTCTAATGGAGG - Intronic
922376344 1:224971500-224971522 TAGAACTTAGATTCTAATGGAGG + Intronic
922876298 1:228942404-228942426 CAGAGCTTCCATACAAAGGGAGG - Intergenic
923056541 1:230430387-230430409 TAGCACTTACATTGAAATGGTGG + Intergenic
923336116 1:232971645-232971667 TGGAGCTTACATTCTAATGGAGG + Intronic
923806512 1:237263845-237263867 CAGAACTTGCATTCTAGTGGGGG + Intronic
923840350 1:237664365-237664387 AGGAGCTTACATTCTAATGGGGG + Intronic
924599045 1:245472091-245472113 CAGATCTTACATTCTGATAGAGG + Intronic
924933561 1:248749238-248749260 CAGACCTAACAGCAAAATGGGGG + Intronic
1063187492 10:3664499-3664521 CAGAGCTTATAGTCGAATGGGGG - Intergenic
1064409272 10:15091337-15091359 CAGCCATTACATCAAAATGGTGG - Intergenic
1064458067 10:15507278-15507300 CAGAACTGACATTCAAATCTAGG - Intergenic
1066615519 10:37289564-37289586 TAGAACATACATTCAAATGGTGG + Intronic
1068022810 10:51605416-51605438 CACACCTTACATTGCAAAGGTGG + Intronic
1071490431 10:86132732-86132754 CAGTCTTTATATTCAAATTGCGG + Intronic
1071712935 10:88067542-88067564 TAGAGCTTATATTCCAATGGAGG + Intergenic
1071767580 10:88685935-88685957 CAGAGCTTACATTTTAGTGGTGG + Intergenic
1072501951 10:96026371-96026393 TGGAGCTTACATTCAAATAGGGG + Intronic
1073496494 10:103896278-103896300 CAGAACTTAAATTCTGATGGAGG + Intronic
1075303942 10:121350877-121350899 CAGACTTTACATTCTAGTAGGGG - Intergenic
1078396734 11:10988118-10988140 CAGAGCTTACATTCTAGAGGAGG - Intergenic
1079291833 11:19195097-19195119 AAGAGATCACATTCAAATGGGGG + Intronic
1083191906 11:61058143-61058165 AAAACCTTACATCCAAATGTAGG + Intergenic
1083799858 11:65040412-65040434 CAGCCCTTACATTAAAAAGGAGG - Exonic
1084023184 11:66430562-66430584 CAGACCTTACACTGAAGTTGTGG + Intergenic
1085607435 11:77914730-77914752 CAGATCTTACATACAAAAGCAGG + Intronic
1086094907 11:83040687-83040709 TAGAACTTACATCCAAATGGTGG - Intronic
1086535291 11:87836907-87836929 AAAACCTTTCATTAAAATGGGGG - Intergenic
1087059107 11:93961262-93961284 CAGAACTGACACTCAAATGTAGG + Intergenic
1087191109 11:95255598-95255620 CCGACATTACATTCAAAGGTTGG + Intergenic
1087285167 11:96257331-96257353 AAGAACTTACAGTCCAATGGAGG - Intronic
1088500397 11:110477254-110477276 CAGCGCTTTCATTCAAATTGAGG - Intergenic
1088879983 11:113965499-113965521 TAGAGCTTACATTCTAGTGGAGG + Intergenic
1089580855 11:119481342-119481364 CAGAGATTACATCCTAATGGGGG - Intergenic
1089758408 11:120704578-120704600 CAGAGCTTACATTCTAGTAGAGG - Intronic
1090085644 11:123648531-123648553 TGGAGCTTACATTCCAATGGAGG + Intronic
1094806956 12:34102895-34102917 CAGAGCTTCCATACAAAGGGAGG - Intergenic
1096791928 12:54050927-54050949 CAGACTTGACATTCAGTTGGGGG + Intronic
1098443705 12:70544921-70544943 CAGAGGTTACATTCTCATGGAGG + Intronic
1098670923 12:73230287-73230309 CAGACTTTTAATTCAAATAGAGG + Intergenic
1098823590 12:75265155-75265177 TGGAGCTTACATTCTAATGGGGG - Intergenic
1100485514 12:95022640-95022662 CAGTCCTTACAGCCAAGTGGAGG - Intronic
1100876881 12:98971605-98971627 CTCACCTAACATTCAAATGAAGG + Intronic
1100976197 12:100125021-100125043 TAGACCTTACATTAAAATCTGGG + Intronic
1101520064 12:105474410-105474432 TGGAACTTCCATTCAAATGGGGG + Intergenic
1101720021 12:107342957-107342979 AAGAGCTTACAGTCCAATGGAGG - Intronic
1101943905 12:109121433-109121455 CAGATCTTACCTTCTAGTGGGGG + Intronic
1103373514 12:120437627-120437649 CAGACTTTATATTCTAGTGGGGG + Intergenic
1103506668 12:121445664-121445686 CAGAGCTTACATTTTAGTGGAGG + Intronic
1104375654 12:128263999-128264021 TGGACCTTACATTCTAGTGGAGG - Intergenic
1105588935 13:21773156-21773178 GAGAGCTTACATTCTAGTGGAGG - Intergenic
1108115037 13:47118305-47118327 TGGAGCTTACATTCTAATGGGGG + Intergenic
1109523597 13:63545246-63545268 CAGAGCTTTCATACAAAGGGAGG + Intergenic
1109762473 13:66847902-66847924 CATACAATATATTCAAATGGTGG + Intronic
1110562567 13:76925121-76925143 TAGAACTTACATTCTAATAGAGG - Intergenic
1111174792 13:84580232-84580254 CAGAGCTCCCATTCAAAGGGAGG + Intergenic
1112655088 13:101443888-101443910 CAGAACTTGCATTGAAATGGGGG + Intergenic
1113113937 13:106854715-106854737 CAGCACTGACACTCAAATGGGGG + Intergenic
1113274085 13:108708768-108708790 AAGACCTTACAGATAAATGGTGG + Intronic
1114392380 14:22323886-22323908 CAGACCTTACATTCTCAGTGAGG - Intergenic
1115070916 14:29320774-29320796 GAGACCTTAGTTCCAAATGGAGG + Intergenic
1115678966 14:35714835-35714857 CTGACCAAACTTTCAAATGGAGG - Intronic
1119731176 14:76952195-76952217 TAGAGCTTACATTCCATTGGAGG - Intergenic
1121220420 14:92280781-92280803 CGGAGCTTACATTCTAGTGGGGG + Intergenic
1121418781 14:93797854-93797876 AAGACCTCACCTTCTAATGGAGG + Intergenic
1121810864 14:96888583-96888605 GGGACTTTACATTCAAATAGGGG - Intronic
1122001001 14:98653410-98653432 CAGAGCTCCCATTCAAAGGGAGG - Intergenic
1122443436 14:101750549-101750571 CAAAACCTACATTCTAATGGGGG - Intergenic
1124095746 15:26647484-26647506 CAGATCTTACATTCAGGTGGAGG + Intronic
1125413401 15:39428275-39428297 TAGGGCTTACATTCTAATGGGGG + Intergenic
1125727338 15:41874784-41874806 GGGACCTTAAATTCACATGGAGG + Intronic
1125852222 15:42914841-42914863 CAGACCTAACAGTCAAGAGGTGG - Intronic
1125971386 15:43914589-43914611 TGGAGCTTACATTCCAATGGGGG + Intronic
1126728352 15:51655744-51655766 CAGAGCTCGCATACAAATGGAGG + Intergenic
1126804712 15:52335787-52335809 AAGAACTTACAGTCTAATGGAGG - Intronic
1126835676 15:52662285-52662307 CAGACCTTACATGAAACTGAAGG + Intronic
1131350768 15:91697824-91697846 CAGACCTTACAGTCTATTGAGGG + Intergenic
1134470924 16:14525454-14525476 CAAACATTCCATTCAAATGAAGG + Intronic
1135352120 16:21737979-21738001 AAGAGCTTACTTTCAAATGGAGG + Intronic
1135450610 16:22554102-22554124 AAGAGCTTACTTTCAAATGGAGG + Intergenic
1135768481 16:25198232-25198254 AAGACTTTACAGTCAAATCGGGG - Intergenic
1137340833 16:47602637-47602659 CAGATTTTACATTCAAATCCTGG - Intronic
1137762805 16:50954170-50954192 AAGAGCTTACATTCTAATGGGGG - Intergenic
1137905798 16:52320658-52320680 TGGAGCTTACATTCTAATGGAGG - Intergenic
1138586242 16:57972084-57972106 TGGAGCTTACATTCCAATGGAGG + Intergenic
1139833620 16:69820731-69820753 TAGACCTTACATTCTATTTGTGG - Intronic
1143911469 17:10253473-10253495 CAGAGCTTACTTTTGAATGGTGG - Intergenic
1145776066 17:27529904-27529926 AAGACCTCAGATTCAAGTGGGGG - Intronic
1145968125 17:28935659-28935681 GAGACTGTACATTCAATTGGAGG + Intronic
1146208634 17:30924757-30924779 CAGAGCTTACATTCTAGTGTGGG + Intronic
1146318129 17:31825160-31825182 CAGTGCTTACATTCAGGTGGTGG + Intergenic
1149499269 17:57139097-57139119 GAGAGCTTACAGTCCAATGGGGG - Intergenic
1150506596 17:65704726-65704748 CACACCTCACATTCACATGACGG + Intronic
1151121349 17:71796676-71796698 CAGAGCTGACATTCTAGTGGTGG - Intergenic
1153935126 18:9914318-9914340 CAGACCTCAAATTCAAAGGTAGG + Exonic
1154280174 18:12995614-12995636 TAGAGCTTACATTCTAATGTGGG + Intronic
1155110359 18:22708490-22708512 CATACAATACATTAAAATGGGGG - Intergenic
1156715060 18:39997930-39997952 CAGAACTTACATTCCCATTGAGG - Intergenic
1157175929 18:45452208-45452230 CAGACCTGGGATTCAAATGCAGG - Intronic
1157241766 18:46016563-46016585 CAGACCTCAGAGTCTAATGGAGG + Intronic
1157699943 18:49755933-49755955 CTGAGCTTACATTCAAATGGAGG - Intergenic
1158894134 18:61897361-61897383 CAGAACTTACATTCTAATGGAGG + Intergenic
1162845701 19:13390848-13390870 CAAACCTTACATCCAGATGCTGG - Intronic
1166561669 19:43736709-43736731 TAGGGCTTACATTCGAATGGGGG + Intronic
1167687689 19:50966908-50966930 CTGAACTTACTTTCTAATGGGGG - Intronic
1168487645 19:56778155-56778177 TAGAGCTTGCATTCTAATGGGGG - Intronic
925691215 2:6525345-6525367 CAGACCTTCCTTTCAAATCTGGG + Intergenic
926816382 2:16802009-16802031 CAGAGCTTCCATACAAAGGGAGG + Intergenic
927517639 2:23681453-23681475 AAGACCTTCCTTTCAAATCGAGG - Intronic
929311602 2:40432285-40432307 CAGAGCTTATATTCTAATGGTGG + Intronic
931214961 2:60233590-60233612 CAGAACTTGCATACAAATTGTGG + Intergenic
931653740 2:64491278-64491300 CAGAACTTACATTCTAGTGGTGG + Intergenic
932686798 2:73877506-73877528 CAGCCCTTACATACAACTGGAGG + Intergenic
933820054 2:86103067-86103089 CAGGCCTTACATTCTATTGGAGG + Intronic
939000994 2:136734324-136734346 TGGAGCTTACATTCTAATGGTGG - Intergenic
940734970 2:157440345-157440367 CAGACCTTACTTGGAAATGGCGG - Intronic
941351812 2:164447375-164447397 CAGCCCCTACATTGAATTGGGGG + Intergenic
942158519 2:173157118-173157140 GAGACAGTTCATTCAAATGGAGG + Intronic
943993243 2:194725314-194725336 CAGACCTGAGATTCAAAGAGAGG - Intergenic
944298327 2:198092796-198092818 CGGAGTTTACATTCAAATTGAGG - Intronic
944639533 2:201709351-201709373 TGGAGCTTACATTCTAATGGGGG - Intronic
945154228 2:206821298-206821320 CAGATCTTGCATTCTACTGGAGG + Intergenic
945776031 2:214107231-214107253 CGGACCTTATATTCTAGTGGAGG - Intronic
945781917 2:214185949-214185971 CAGAACTTACATTATAGTGGGGG - Intronic
947102206 2:226633052-226633074 CCGGCCTTACATTCAAATATGGG + Intergenic
947164755 2:227250543-227250565 TAGAGCTTACATTCTCATGGGGG + Intronic
949005555 2:241645000-241645022 CAGATCTTACTTTATAATGGAGG - Intronic
1168860356 20:1041903-1041925 AAGAACTTACATTCCAGTGGAGG + Intergenic
1170123160 20:12933687-12933709 TGGTCCTTACATTGAAATGGAGG - Intergenic
1170843142 20:19940173-19940195 CAGAGCTTACCTTCTAGTGGTGG - Intronic
1172190035 20:33056402-33056424 CAGAGGTTACACTCAAATGGTGG - Intronic
1173860592 20:46280685-46280707 CAGAACTGACATTCAAATCCAGG - Intronic
1178373659 21:32048905-32048927 CAGAGCTTACATTCCAGTGACGG + Intergenic
1178459798 21:32792760-32792782 AAGACCTTAGGATCAAATGGGGG - Exonic
1179061359 21:37982441-37982463 CAGCCCTTGTATTCAGATGGAGG - Intronic
1184026202 22:41858760-41858782 CAGAACTTACTGTGAAATGGAGG + Intronic
949306377 3:2646344-2646366 CAGACTTTAGATTCAAATATTGG + Intronic
949426265 3:3919583-3919605 CACACCATACATACAAAGGGTGG + Intronic
949577594 3:5353662-5353684 CAGAGCTGAAATTCAAATGTAGG - Intergenic
949842037 3:8330188-8330210 CAAACTTTTCATTTAAATGGAGG + Intergenic
950211363 3:11126054-11126076 CAGAGCTTATATTCCAGTGGAGG + Intergenic
951481553 3:23167271-23167293 TAGAGCTTACATTCTAGTGGGGG - Intergenic
951890503 3:27563809-27563831 TAGAGCTTACATTCTACTGGTGG - Intergenic
954898767 3:54000824-54000846 AAGACCACACATTCAAAAGGTGG - Intergenic
957112980 3:75990657-75990679 CTTACCTTACCTTCCAATGGCGG - Intronic
957149397 3:76465686-76465708 CAGAAATTATATTAAAATGGTGG - Intronic
957322090 3:78644302-78644324 CAGACCTTACATTATAGTGGCGG - Intronic
957593856 3:82234744-82234766 CAGACCTTACAATCTAATGAAGG - Intergenic
958018746 3:87972154-87972176 TAGATCTTACATTCTAATGAGGG + Intergenic
962409840 3:135131495-135131517 CAGACCTGCCATTCGAAAGGGGG + Intronic
962645902 3:137439739-137439761 CAGATCTTACATTTTAGTGGAGG - Intergenic
963007973 3:140743925-140743947 CAGCAGTTACATTCAAATAGTGG - Intergenic
963075105 3:141338864-141338886 TAGACCTGACATTCTAGTGGGGG + Intronic
963658135 3:148085987-148086009 CAGATCTTACATTCTTTTGGAGG - Intergenic
966961602 3:184945404-184945426 GAGAATTTACATTCTAATGGAGG + Intronic
970953866 4:21787876-21787898 CAGAGCTGACATTCTAGTGGGGG + Intronic
970988713 4:22188631-22188653 CAGACCTTACATTCTAATGTGGG - Intergenic
972256119 4:37357665-37357687 CGGAGCTTACATTCTAATGTGGG + Intronic
972351424 4:38239567-38239589 CAGTCTTCACATTCAAGTGGAGG + Intergenic
973635104 4:52854880-52854902 TAGACCTTACATTTAACTGAGGG + Intergenic
973717497 4:53691695-53691717 AGGACCTTACGTTCAACTGGAGG - Intronic
975155984 4:71073650-71073672 TAGAGCTTACATTCCAGTGGAGG - Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
977536049 4:98258243-98258265 GAGAACTTACATTTAAATGTGGG + Intergenic
978067936 4:104428986-104429008 CAGAGTTTATATTCAAATAGAGG + Intergenic
980896094 4:138861985-138862007 CAGAGCTTACATTCTAATAAAGG + Intergenic
981345085 4:143665370-143665392 AAGAACTTACAGTCTAATGGGGG - Intronic
982065490 4:151650974-151650996 CAGAGCATACATTCTACTGGGGG - Intronic
982572348 4:157066145-157066167 GAGACCTTACATTTTAGTGGAGG + Intergenic
982692635 4:158566271-158566293 AAAAACTTACTTTCAAATGGTGG + Intronic
985167198 4:187109362-187109384 CAGAGCTTACATTCTCAGGGAGG + Intergenic
985199848 4:187473874-187473896 CAGAACTTACATTCCAGTGGGGG + Intergenic
985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG + Intronic
986008944 5:3694760-3694782 CAGGACTTACATTAAAATTGGGG - Intergenic
988125085 5:27021991-27022013 CAGACATTACATTGAAACAGAGG + Intronic
988751734 5:34194680-34194702 CGGAACTTTCATTCTAATGGGGG - Intergenic
989480075 5:41920500-41920522 CAGAGCTTATATTCTAGTGGAGG + Exonic
990116102 5:52393593-52393615 CAAAACTTACATTCAAATCTTGG + Intergenic
991737058 5:69637454-69637476 CGGAACTTTCATTCTAATGGGGG - Intergenic
991739494 5:69655487-69655509 CGGAACTTTCATTCTAATGGGGG - Intergenic
991758008 5:69897692-69897714 CGGAACTTTCATTCTAATGGGGG + Intergenic
991788632 5:70217178-70217200 CGGAACTTTCATTCTAATGGGGG - Intergenic
991791069 5:70235228-70235250 CGGAACTTTCATTCTAATGGGGG - Intergenic
991813382 5:70492283-70492305 CGGAACTTTCATTCTAATGGGGG - Intergenic
991816514 5:70513564-70513586 CGGAACTTTCATTCTAATGGGGG - Intergenic
991818954 5:70531605-70531627 CGGAACTTTCATTCTAATGGGGG - Intergenic
991837411 5:70773574-70773596 CGGAACTTTCATTCTAATGGGGG + Intergenic
991881078 5:71217542-71217564 CGGAACTTTCATTCTAATGGGGG - Intergenic
991883515 5:71235563-71235585 CGGAACTTTCATTCTAATGGGGG - Intergenic
992324756 5:75649886-75649908 CAGACATTACATTTCAGTGGTGG - Intronic
992800677 5:80293053-80293075 TAGAACTTACATTCTAATAGAGG + Intergenic
994070735 5:95599072-95599094 CAGAGCTAACATTCTAATGTGGG - Intronic
994309991 5:98258834-98258856 AAGACTTTACATTCAGAAGGTGG + Intergenic
995230184 5:109752487-109752509 TGGAGCTTACATTCTAATGGTGG + Intronic
995848523 5:116520346-116520368 TAGAGCTTACATTCTAGTGGAGG - Intronic
997890172 5:137669273-137669295 CAGAACTTATATTCACATAGAGG - Intronic
998331446 5:141331362-141331384 CAGAATTTACATTCAGGTGGTGG + Exonic
998602985 5:143604030-143604052 AAGAGTTTACATTCTAATGGAGG + Intergenic
998744809 5:145246380-145246402 AGGCTCTTACATTCAAATGGGGG + Intergenic
998754732 5:145364467-145364489 GGGAGCTTACATTCTAATGGAGG - Intergenic
999594437 5:153186722-153186744 TGGTCCTTACATTCTAATGGGGG - Intergenic
999709912 5:154308946-154308968 TAGAGCTTACATTCCACTGGGGG + Intronic
1000297144 5:159921788-159921810 CAGCCCTTTCATTCAAATGGGGG + Intronic
1000465643 5:161572683-161572705 CAGAGCTTATCTTCAAGTGGAGG - Intronic
1001849554 5:174951761-174951783 AAGAGCTTACATCCTAATGGGGG + Intergenic
1006000646 6:30962542-30962564 CAGAGCTTATATTCAAATAAGGG - Intergenic
1007973781 6:46079693-46079715 CAGACCTTACCTTCACAAAGAGG + Exonic
1009505927 6:64478274-64478296 AAAATTTTACATTCAAATGGGGG - Intronic
1009702451 6:67201613-67201635 CAGAGCTCACATACAAAGGGAGG - Intergenic
1012889361 6:104881193-104881215 CAGAACTTAAATACAAATTGGGG - Intergenic
1014627809 6:123751067-123751089 CAGAGTTTACATTCTAGTGGGGG + Intergenic
1015108795 6:129568540-129568562 AAGCCCTTACATTCTAGTGGAGG - Intergenic
1015589972 6:134813731-134813753 TAGAACTTACATTCTAATGAAGG + Intergenic
1016615904 6:146048139-146048161 CAGACCTTACAAAGATATGGAGG - Intronic
1020331183 7:7018430-7018452 CAGAGTTTACAATCAAAAGGAGG - Intergenic
1020464585 7:8462542-8462564 CAGAACTGAGATTCAAATGCAGG + Intronic
1022629029 7:32067929-32067951 TGGAACTTACATTCTAATGGAGG + Intronic
1022645907 7:32228514-32228536 CAGTCCTGAAATTCAAATGCAGG + Intronic
1022989909 7:35696539-35696561 CAGAGCTTCCATACAAAGGGAGG - Intergenic
1025016738 7:55445480-55445502 CAGACCTCAAAGTCAATTGGGGG - Intronic
1025845573 7:65193517-65193539 CAGATCTTACATACAAAAGCAGG - Intergenic
1025895792 7:65699230-65699252 CAGATCTTACATACAAAAGCAGG - Intergenic
1027866342 7:83652228-83652250 GAGAACTTACCTTGAAATGGTGG + Intergenic
1030819540 7:114079130-114079152 CAAACCTCACATTCTAATGAAGG - Intergenic
1030842981 7:114379127-114379149 CAGAGCTCCCATACAAATGGAGG + Intronic
1033437872 7:141350380-141350402 CAGACCTTACATTCTAGTGGGGG - Intronic
1033472298 7:141661115-141661137 GAGAAATAACATTCAAATGGTGG - Exonic
1038054016 8:23840920-23840942 CATATTTTAAATTCAAATGGGGG - Intergenic
1038523885 8:28256985-28257007 CTGACCTTATATTCAAATTCAGG - Intergenic
1039792345 8:40885946-40885968 CAGAGCTTAGATTCAAGTGGGGG - Intronic
1041633384 8:60114370-60114392 CAGATTTTACTTTCAAATAGAGG + Intergenic
1041990073 8:63976988-63977010 CAGTGATTACATTCAAATGCAGG - Intergenic
1042524045 8:69746133-69746155 CAGACCTTGCCCTCAAAGGGAGG - Intronic
1045243628 8:100423957-100423979 CAGAGCTTACATTTTAGTGGGGG + Intergenic
1047417634 8:124678351-124678373 CAGACCCTGCACTCAAGTGGTGG - Intronic
1050068562 9:1786630-1786652 CAGAGTTTACATTCTAGTGGGGG - Intergenic
1050656419 9:7833421-7833443 TAGAGCTTACATTCTAGTGGAGG - Intronic
1050783109 9:9364333-9364355 AAGTGCTTACATTCTAATGGAGG + Intronic
1051042325 9:12826417-12826439 CAGACCTTTCATTCTAGTGTGGG - Intergenic
1051208615 9:14716987-14717009 TAGAGCTTACATTCTATTGGGGG - Intergenic
1051995288 9:23208583-23208605 CGGAGCTTACATTCTAATGCAGG + Intergenic
1052075765 9:24138006-24138028 CAAACCTATCCTTCAAATGGTGG + Intergenic
1052432109 9:28379851-28379873 CAGAAGTTGCATTCAAGTGGGGG + Intronic
1054931925 9:70644164-70644186 CAGAGCTTACATCCTACTGGTGG + Intronic
1055724133 9:79209470-79209492 CAGACTTTACATTTAAATACAGG - Intergenic
1057785405 9:98083696-98083718 GAGAACTTCCATTCAGATGGGGG + Intronic
1057800523 9:98188379-98188401 AAGAGCTTACAATCAGATGGGGG - Intronic
1058379967 9:104366846-104366868 AAGAACTTACAGGCAAATGGTGG - Intergenic
1059397077 9:114042108-114042130 CAGACTTTACATTCACAAAGGGG - Intronic
1059737420 9:117116065-117116087 AAGAGCTCACATTCAGATGGAGG + Intronic
1060293243 9:122323915-122323937 CAGAGCTGGCATTCAAATTGAGG + Intergenic
1061206796 9:129168900-129168922 TAGAGCTTACATTCTAGTGGTGG - Intergenic
1191925172 X:66301304-66301326 CAGAACTTACATTCTAGTGGAGG - Intergenic
1192037352 X:67578526-67578548 CAGACTTTAGTTTCAAATAGTGG + Intronic
1192372256 X:70524197-70524219 AAGAGCTTACATTCTAGTGGGGG - Intergenic
1192604162 X:72496742-72496764 CAGAACTTACAATTAAATTGGGG + Intronic
1197140826 X:123115634-123115656 CAGAGCTGGCATTCAAATTGAGG - Intergenic
1197181488 X:123541629-123541651 CAGAGCTTCCATTCTAGTGGAGG + Intergenic
1197263715 X:124344126-124344148 TGGACCTTACATTCTAGTGGGGG + Intronic
1197329761 X:125139144-125139166 CAGAGCTTACAATCTGATGGGGG + Intergenic
1197445370 X:126546912-126546934 CAGAGCTCATATTCAAGTGGAGG + Intergenic
1198599848 X:138270665-138270687 TAGATCTTACATTCCAGTGGAGG - Intergenic