ID: 917186130

View in Genome Browser
Species Human (GRCh38)
Location 1:172358087-172358109
Sequence CCTCCCAATAGGATTAAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917186130_917186134 16 Left 917186130 1:172358087-172358109 CCGCTTTTAATCCTATTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 87
Right 917186134 1:172358126-172358148 AAAGAAAAAATAATAATGAATGG 0: 1
1: 6
2: 53
3: 789
4: 9644
917186130_917186135 29 Left 917186130 1:172358087-172358109 CCGCTTTTAATCCTATTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 87
Right 917186135 1:172358139-172358161 TAATGAATGGCTGTGTTCTTTGG 0: 1
1: 0
2: 0
3: 21
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917186130 Original CRISPR CCTCCCAATAGGATTAAAAG CGG (reversed) Intronic
901732909 1:11293320-11293342 CCTCCCATTAGGATCACAAATGG + Intronic
905903490 1:41597996-41598018 TTTCCCATGAGGATTAAAAGAGG + Intronic
908896931 1:68911241-68911263 TCTCCCCTTAGGAATAAAAGAGG - Intergenic
909064862 1:70923429-70923451 CTTCCAAAGAGGATTAAAACAGG - Intronic
909417960 1:75429034-75429056 CCTCCCTGTAGGTTTTAAAGAGG + Intronic
917186130 1:172358087-172358109 CCTCCCAATAGGATTAAAAGCGG - Intronic
917815198 1:178702448-178702470 CCTCCAAATAGAATTAAGACTGG - Intergenic
1066579215 10:36861650-36861672 CCTCCAAAGAGGAATCAAAGAGG + Intergenic
1068499913 10:57831714-57831736 CCCCCAAATAGTATTAAAATTGG - Intergenic
1072187335 10:93052685-93052707 CTTCCCAAAAGGATTTAAGGTGG + Intronic
1075451837 10:122557095-122557117 CTTCCCAATCGGGTTATAAGGGG - Intergenic
1077725291 11:4668423-4668445 CCTGCTAAGAGGATGAAAAGAGG - Intergenic
1093463470 12:19427118-19427140 CCTCCCAAAGGGATTACAGGCGG - Intronic
1094649243 12:32359041-32359063 CCTCCCATAAGGACTAAAAGAGG + Intronic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098465347 12:70780691-70780713 CCTCCCAATATCATGTAAAGGGG - Intronic
1101998419 12:109541448-109541470 CCTGCCATGAGGATTAAACGAGG + Intergenic
1102035930 12:109770552-109770574 CCTCCCCTTAGGAGTGAAAGGGG + Intergenic
1111550310 13:89801045-89801067 CATGCCAATAGCATTAAAACTGG - Intergenic
1120587207 14:86327868-86327890 CTCCAAAATAGGATTAAAAGTGG - Intergenic
1120942619 14:89963331-89963353 CCTCCCAAAAGGCAGAAAAGCGG + Exonic
1123470438 15:20547682-20547704 CCTCCCAATAGGTTTCAAGATGG - Intergenic
1123647621 15:22453018-22453040 CCTCCCAATAGGTTTCAAGATGG + Intergenic
1123730737 15:23142659-23142681 CCTCCCAATAGGTTTCAAGCTGG - Intergenic
1123748876 15:23340085-23340107 CCTCCCAATAGGTTTCAAGCTGG - Intergenic
1124042947 15:26121709-26121731 CCTCCCAACAGGGTTGGAAGCGG - Intergenic
1124281248 15:28363968-28363990 CCTCCCAATAGGTTTCAAGATGG - Intergenic
1124301454 15:28547653-28547675 CCTCCCAATAGGTTTCAAGATGG + Intergenic
1124531107 15:30507366-30507388 CCTCCCATTAGGATTCAAGATGG + Intergenic
1124767548 15:32500330-32500352 CCTCCCATTAGGATTCAAGATGG - Intergenic
1125322597 15:38504536-38504558 CCTTCCAATAGGATAAGATGTGG - Intronic
1125471732 15:40011052-40011074 CCTGACAAAAGAATTAAAAGGGG - Intronic
1125521859 15:40352573-40352595 CCTCCCACCAGGATTGGAAGGGG - Intronic
1135486216 16:22867696-22867718 ACTCACAATAGCACTAAAAGTGG - Intronic
1135927510 16:26708547-26708569 ATTCCCAAAAGGTTTAAAAGAGG - Intergenic
1136100695 16:27993444-27993466 CCTCCAAATATGATTGAAAGTGG - Intronic
1137005046 16:35268316-35268338 CCTACCAATAGGAAGAGAAGGGG + Intergenic
1138010104 16:53371308-53371330 CCTCCCAATAGGATTCAAGATGG - Intergenic
1144373632 17:14617480-14617502 CCTCGGAAGAGGATTAAAATGGG + Intergenic
1147179829 17:38677292-38677314 CCTCCTCATAGGAGAAAAAGAGG + Intergenic
1148261370 17:46186554-46186576 CCTCCCAAGAGAATGAAAAATGG - Intronic
1149480469 17:56999384-56999406 CCTCCCTATAGGACTAAAGTAGG - Intronic
1150611548 17:66737546-66737568 CCTCCCAAGAGTTTTCAAAGAGG - Intronic
1155975976 18:32132303-32132325 TCTCCCAATATGAGTAAAATGGG + Intronic
1158011722 18:52736224-52736246 CTGACCAATAGGATCAAAAGAGG + Intronic
1158055460 18:53274372-53274394 GTTCCTAATAGGATGAAAAGTGG - Intronic
1160934581 19:1587669-1587691 CCTCCCAAAGGGATTATAGGCGG + Intronic
1164701955 19:30291586-30291608 CCACCCAAAAGAATTAAGAGTGG - Intronic
925707717 2:6703002-6703024 CTTCCCAAAAGAATTAAGAGAGG + Intergenic
930963378 2:57288698-57288720 TCTCCCAAAATGACTAAAAGTGG + Intergenic
932363828 2:71132887-71132909 CCTCCCAATAGGATTCAAGAGGG + Exonic
932800966 2:74742107-74742129 CTTCCCAAGAGGATTTAAATAGG + Intergenic
933564253 2:83930589-83930611 GCTCCTTAAAGGATTAAAAGTGG + Intergenic
937102506 2:119282665-119282687 CCTCCTAAGAGGATTAAGCGGGG + Intergenic
938711985 2:133982891-133982913 CCTCACAATAGCCTTAAGAGAGG - Intergenic
946675842 2:222158448-222158470 CCCTCCAAGAGGATTTAAAGAGG - Intergenic
1168946969 20:1769119-1769141 GCTCCCAATGGGCTTATAAGCGG + Intergenic
1174512322 20:51063162-51063184 CCTCCCAACATGATGAAATGGGG - Intergenic
1176366823 21:6038226-6038248 TCTCCAAATAGAAATAAAAGAGG - Intergenic
1179756695 21:43500318-43500340 TCTCCAAATAGAAATAAAAGAGG + Intergenic
951004802 3:17603490-17603512 CTACCCTATATGATTAAAAGGGG + Intronic
956049902 3:65236490-65236512 CCTCCCAATAAGATTTAACATGG + Intergenic
957936285 3:86947680-86947702 CCTCCAAAAAGTATTTAAAGTGG + Intronic
960958099 3:123049118-123049140 ACTCCTAAGAGGATTAAATGAGG + Intergenic
962037833 3:131671628-131671650 CCTCCCCATTAGAGTAAAAGGGG + Intronic
962564286 3:136641474-136641496 CCTCCTAATAGGATAAACAAAGG + Intronic
964965530 3:162488080-162488102 CCTTCCAATAGGACAAAATGTGG - Intergenic
966248472 3:177835128-177835150 CCTCCCAGTAGGATTAAGCCAGG + Intergenic
969459063 4:7318163-7318185 CCTACCAACAGGATCACAAGAGG - Intronic
972910392 4:43809228-43809250 CCTCCCAAGATTATTACAAGAGG - Intergenic
973285225 4:48408430-48408452 CCTTCCAATAGGATAAGATGTGG + Intronic
973595053 4:52479588-52479610 CCTCAAGATAGGATTAAATGAGG - Intergenic
976014008 4:80527929-80527951 CTTCACATTAGGATTACAAGTGG + Intronic
984683926 4:182644487-182644509 CCTCCCCATAAAATAAAAAGGGG - Intronic
988550254 5:32194438-32194460 CCTACCAATAGGATAAGATGAGG + Intergenic
989266826 5:39484600-39484622 CCTCTTAATAGGATTAAGGGTGG + Intergenic
990555249 5:56927475-56927497 CCTTCCTTTAGGATGAAAAGAGG + Intronic
993193893 5:84715508-84715530 CCTCCCAATATCAGAAAAAGTGG - Intergenic
997670293 5:135665834-135665856 GCTCCCAATATGATGAAATGTGG + Intergenic
1002799392 6:506878-506900 CCTTCCTATATGATTAAAAGAGG - Intronic
1007082526 6:39118017-39118039 CTTCCAAAAAGGATTTAAAGAGG - Intergenic
1014207418 6:118671402-118671424 GCTCCCAAAAGGATTTAAGGTGG - Intronic
1015778907 6:136843116-136843138 CCTCACATTGCGATTAAAAGTGG + Intronic
1016592856 6:145765777-145765799 GCTCCCACTGGGATTAAAAGAGG + Intergenic
1022347042 7:29526757-29526779 CCTCCCAATATGAGAAAGAGAGG + Intergenic
1028515712 7:91675991-91676013 CTTCCCAACTGAATTAAAAGAGG + Intergenic
1033885231 7:145935835-145935857 CCTCACAGTAGTATTAAAATAGG + Intergenic
1034660167 7:152761804-152761826 CCTCAAAATAGGACAAAAAGTGG + Intronic
1050864478 9:10480351-10480373 CCTCCAGCTAGGATTATAAGGGG + Intronic
1055246607 9:74252953-74252975 CCTCCCAATATGATTATATTGGG - Intergenic
1055743573 9:79417062-79417084 CAGCCTAATAGGATGAAAAGGGG - Intergenic
1188405061 X:29797570-29797592 TCTCCAAAGAGGATTAAAAGGGG + Intronic
1189859014 X:45252933-45252955 CCTGTCATTAGGATTACAAGAGG + Intergenic
1193124543 X:77857294-77857316 CCTCCCAGTAAGATTCAAAGGGG + Intronic
1196586497 X:117435447-117435469 ACTTCCAATAGGAAAAAAAGAGG - Intergenic
1197810660 X:130439798-130439820 CATCCAAATTGGATTAAAAGAGG - Intergenic
1198015764 X:132609123-132609145 CCTCACTGTAGGATTAGAAGGGG + Intergenic