ID: 917188552

View in Genome Browser
Species Human (GRCh38)
Location 1:172388788-172388810
Sequence GGGCCCCGCCCAGTGTCCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 241}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917188546_917188552 5 Left 917188546 1:172388760-172388782 CCTCCACAAGTTCCATCTAGGCC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 241
917188542_917188552 16 Left 917188542 1:172388749-172388771 CCTTCGGAGCCCCTCCACAAGTT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 241
917188545_917188552 6 Left 917188545 1:172388759-172388781 CCCTCCACAAGTTCCATCTAGGC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 241
917188547_917188552 2 Left 917188547 1:172388763-172388785 CCACAAGTTCCATCTAGGCCTAC 0: 1
1: 0
2: 1
3: 5
4: 77
Right 917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 241
917188550_917188552 -7 Left 917188550 1:172388772-172388794 CCATCTAGGCCTACGAGGGCCCC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 241
917188543_917188552 7 Left 917188543 1:172388758-172388780 CCCCTCCACAAGTTCCATCTAGG 0: 1
1: 0
2: 2
3: 0
4: 98
Right 917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917188552 Original CRISPR GGGCCCCGCCCAGTGTCCCA AGG Exonic
900392123 1:2438312-2438334 GGGCAGGGCCCAGTGTCCCTGGG + Intronic
901446236 1:9309887-9309909 GGGCCCTGACCAGTCTCCCTTGG + Intronic
901843346 1:11966878-11966900 GGAGCCCTCCCAGTGTCCCCGGG - Intronic
902518997 1:17005257-17005279 GGGACCTGCCTAATGTCCCATGG + Intronic
903540139 1:24092206-24092228 GGGCCCCGCCCAGTGACACCCGG - Exonic
904239152 1:29132812-29132834 GGGCCGGGCCCAGTGGCTCATGG + Intergenic
904938417 1:34148101-34148123 TGGACCCTCCCAGTGTCCCTGGG - Intronic
905036013 1:34918746-34918768 GGGCCCTGGCCAGGGTCCTAGGG - Intronic
905510099 1:38512555-38512577 GAGCACTGCCCAGTGCCCCATGG + Intergenic
906144169 1:43550234-43550256 GGGCACAGCCCAGCCTCCCACGG + Intronic
906248538 1:44293895-44293917 GAGCCCAGCCCAGTGTTACATGG - Intronic
906411853 1:45584740-45584762 AGGCCCCGCCCCCTGCCCCAGGG - Intronic
907341604 1:53739328-53739350 GGGCCCCGCCCAGACCCCCAGGG - Intergenic
911143740 1:94532879-94532901 GGGCCCTGCCCAGAGTCACAGGG + Intronic
916501729 1:165393168-165393190 TGGCCCCGCCCAGCCTCCCCAGG - Intergenic
917074764 1:171192920-171192942 GTTCTCTGCCCAGTGTCCCAGGG + Intronic
917188552 1:172388788-172388810 GGGCCCCGCCCAGTGTCCCAAGG + Exonic
919785182 1:201254165-201254187 GGGCCTTGCCCTGAGTCCCACGG + Intergenic
919855992 1:201706504-201706526 GGGGCCTGCCCAGTGTCACCAGG - Intronic
920119289 1:203643674-203643696 GGTCCCCTCCCAGTTTCTCAGGG + Intronic
922196333 1:223363587-223363609 GGCCCCCGCCCCCTTTCCCACGG + Exonic
1062902400 10:1156222-1156244 AGGCTCCGCCCCATGTCCCAGGG + Intergenic
1063121987 10:3111726-3111748 AGTCCCAGCCCCGTGTCCCAGGG + Intronic
1069211075 10:65760691-65760713 GGGCCAGGCCCAGGGTCCCCAGG - Intergenic
1069619133 10:69825729-69825751 GGGTGCCGCCCAGGGCCCCAAGG - Intronic
1070792235 10:79196381-79196403 GGACCCAGCCCAGTGCCCCTTGG + Intronic
1071570711 10:86695312-86695334 GGTCCACCCCCAGAGTCCCAGGG + Intronic
1073146422 10:101284668-101284690 GGGCCCCGCCCGCTGTGCAAGGG + Intergenic
1073425933 10:103455492-103455514 GGGCCGTGGCCAGTGTCCCGTGG + Exonic
1076443380 10:130495658-130495680 GGTCCCTGCCCAGTCCCCCATGG + Intergenic
1076793323 10:132787693-132787715 GGGCCCCTCCCAGCACCCCAAGG + Intergenic
1076849557 10:133086330-133086352 GAGCCCTGCCCTGAGTCCCACGG - Intronic
1076901387 10:133340167-133340189 GGGCCCCCCCCAGAGTCTCCAGG + Intronic
1077413738 11:2415020-2415042 GGGCCCGGCCAAGCGGCCCACGG - Exonic
1077423267 11:2462841-2462863 GGGCCCAGCCCAGAGTGACAGGG + Intronic
1078642773 11:13111741-13111763 TGCCCCCACCCACTGTCCCAGGG - Intergenic
1082236454 11:49823938-49823960 GGGCCCCGGGCAGTGTCAGATGG + Intergenic
1082239903 11:49858445-49858467 GGGCCCCGGGCAGTGTCAGATGG + Intergenic
1082656743 11:55866709-55866731 GGGCCCCGGGCAGTGTCAGATGG - Intergenic
1083099449 11:60287940-60287962 GGGCCCCAATCAGTGTCCCCAGG - Intronic
1083609383 11:63997929-63997951 GGGACTTGCCCAGGGTCCCAGGG + Exonic
1084070173 11:66728474-66728496 GGGCCCCGCCCAGAGCCCCGCGG - Intronic
1084387960 11:68855715-68855737 CGGCCCGGCCCAGCGTCCCCAGG + Intergenic
1087252907 11:95923836-95923858 GGGCCCCGCCCAGCGTCCGAAGG - Intronic
1089633025 11:119795122-119795144 GGGCCCTTTCCAGGGTCCCATGG - Intergenic
1090337885 11:125986253-125986275 GTTCCCCGCCCTGTGTCCGAGGG - Intronic
1090541086 11:127706782-127706804 GTTCCCCGCCCTGTGTCCAAGGG + Intergenic
1092196349 12:6551834-6551856 GGACCCTGCCCTGTGGCCCAGGG - Intronic
1096233314 12:49909580-49909602 GGGCCCAGCCCTGGGGCCCATGG + Intergenic
1097233535 12:57525868-57525890 GGGCCCCTCCCAGGGGCCCCAGG - Exonic
1099973725 12:89525494-89525516 GGGCCCCGCCCGCTGGCCCAAGG + Intronic
1100885661 12:99067068-99067090 GTGCCCTGGCCAGTCTCCCATGG + Intronic
1100982565 12:100172996-100173018 GGGCCCCACCCAGTGCCTCTGGG - Intergenic
1103612946 12:122135170-122135192 GGGCCAGGCCCTGTGGCCCAGGG + Intronic
1103794437 12:123493728-123493750 GGGCCGGGTCCTGTGTCCCAGGG - Intronic
1103953982 12:124566756-124566778 GGACCCCGCCCAGCGCCCCGTGG + Intronic
1104723636 12:131061149-131061171 GAGCCCCGCCCAGCCTCTCAAGG + Intronic
1104811120 12:131621032-131621054 CAGCCCCGCCCAGAGCCCCAGGG + Intergenic
1104901042 12:132189694-132189716 GGGCCCCGCCCCGACTCCCTCGG - Intergenic
1107888152 13:44891615-44891637 CGGCCTAGCCCAGGGTCCCACGG + Intergenic
1108378950 13:49838802-49838824 GGGCCCAGCACAGGGGCCCAAGG + Intergenic
1113819746 13:113204575-113204597 GGGCTGCACCCAGTGTCCCACGG + Intronic
1113944342 13:114035420-114035442 AGCCCCCGCCCAGGGCCCCATGG - Intronic
1114408519 14:22478789-22478811 GGGCTCCACCCACTCTCCCAGGG - Intergenic
1115251906 14:31357876-31357898 GGGCCCCAACCAGTGGGCCACGG + Intronic
1122211877 14:100178719-100178741 GGGACCAGGCCAGTGACCCAAGG - Intergenic
1122776493 14:104119203-104119225 GGGTCTGGCCCAGTGGCCCAGGG - Intergenic
1122986236 14:105212888-105212910 GGTCCCTTCCCAGTGTCCCGAGG - Intronic
1123035262 14:105469365-105469387 GGCCCCGGCCCATTGTCCCAAGG + Intronic
1124159140 15:27253309-27253331 AGGCCCCTCCCAGCATCCCAGGG - Intronic
1124334733 15:28848370-28848392 GGGCCCCCCCCAGTGCCTCTGGG - Intergenic
1124664276 15:31578829-31578851 GGGCCAGGCACAGTGGCCCATGG - Intronic
1125883430 15:43211701-43211723 GGACCCAGCCCAGAGTCCCTGGG + Intronic
1129738615 15:77979120-77979142 GGGCCGCTCCCACTGTCCCCTGG + Intergenic
1129847457 15:78774494-78774516 GGGCCACTCCCACTGTCCCCTGG - Intronic
1130254446 15:82319418-82319440 GGGCCACTCCCACTGTCCCCTGG + Intergenic
1130600519 15:85270552-85270574 GGGCCACTCCCACTGTCCCCTGG - Intergenic
1132454665 16:15772-15794 GGGCCCCACACAGTCTCCAAAGG - Intronic
1132827945 16:1914250-1914272 GAGCCGCACCCAGCGTCCCAGGG + Intronic
1133024118 16:2980285-2980307 GCGCCCCGCCCAGTCGCCCCAGG - Exonic
1133304525 16:4801166-4801188 GGGTCCCGCCCAGAGTCGCAGGG + Intronic
1136419394 16:30122736-30122758 GGGCCTCGCCCCGTGTCACTAGG + Intronic
1138326552 16:56176220-56176242 GTTCCCCGCCCTGTGTCCAAGGG - Intergenic
1139374876 16:66490805-66490827 GGGCCCCTCCCAGTGGAGCAGGG - Intronic
1139483611 16:67244424-67244446 GGGCCGGGCCTAGTGTCCCTGGG - Intronic
1141424333 16:83935545-83935567 GGGCCCCTCCCTGTGACCCTGGG - Intronic
1142638536 17:1271890-1271912 AGGCCCCGCCCAGCATTCCAAGG - Intergenic
1143619208 17:8071597-8071619 GAGCCCAGCACAGTGGCCCAGGG - Intergenic
1143866550 17:9927921-9927943 GGGAACCGCCCTGTATCCCAGGG + Intronic
1144772976 17:17770000-17770022 GGGCCCTGCCCAGGGTGACAGGG + Intronic
1144879881 17:18425752-18425774 AAGCCCCGCCCTGGGTCCCAGGG - Intergenic
1145152352 17:20518632-20518654 AAGCCCCGCCCTGGGTCCCAGGG + Intergenic
1145884401 17:28372177-28372199 GGGCCCCGCGAAGTGTCGCCGGG + Exonic
1146255554 17:31390142-31390164 GGTCCCCGCCCACTGTCAGAAGG + Intergenic
1146841647 17:36160517-36160539 ATCCCCCTCCCAGTGTCCCAAGG + Intergenic
1146853957 17:36248477-36248499 ATCCCCCTCCCAGTGTCCCAAGG + Intronic
1146866281 17:36337710-36337732 ATCCCCCTCCCAGTGTCCCAAGG + Intronic
1146869863 17:36372369-36372391 ATCCCCCTCCCAGTGTCCCAAGG + Intronic
1146877218 17:36423450-36423472 ATCCCCCTCCCAGTGTCCCAAGG + Intronic
1147069151 17:37938322-37938344 ATCCCCCTCCCAGTGTCCCAAGG + Intergenic
1147072742 17:37972993-37973015 ATCCCCCTCCCAGTGTCCCAAGG + Intergenic
1147080679 17:38017859-38017881 ATCCCCCTCCCAGTGTCCCAAGG + Intronic
1147084264 17:38052531-38052553 ATCCCCCTCCCAGTGTCCCAAGG + Intronic
1147096622 17:38141819-38141841 ATCCCCCTCCCAGTGTCCCAAGG + Intergenic
1147100212 17:38176497-38176519 ATCCCCCTCCCAGTGTCCCAAGG + Intergenic
1147161261 17:38570717-38570739 GGGCCTGCCCCAGGGTCCCAAGG + Intronic
1147211652 17:38875480-38875502 GGGCCTATCCCAGTGACCCAGGG - Intronic
1151206695 17:72513154-72513176 GGGCCCTGCCCAGAGTCTCTTGG - Intergenic
1151493094 17:74444135-74444157 GGGACCCGCCCTGTGTCACTGGG + Intronic
1151553379 17:74834635-74834657 GGGCCCCCCGCAGAGCCCCAGGG - Intronic
1152514521 17:80815476-80815498 GGGCCCAGCCCCGTGTCCACAGG + Intronic
1152656041 17:81519612-81519634 CGGCCCCGCCCAGTGGCGGAGGG - Intronic
1152781884 17:82230404-82230426 GGGCCCTGCCCAAGGTCACATGG - Intronic
1160518897 18:79493436-79493458 GGGCGCCTCCCCGTGTCCCCTGG + Intronic
1160976943 19:1797266-1797288 CGGCCCCGTCCCGTCTCCCAGGG + Intronic
1161009672 19:1954225-1954247 AGGCCCAGCCCAGTGACGCAGGG - Intronic
1161306605 19:3572553-3572575 GGGCCCCGCCCCGGTTGCCATGG - Intronic
1161321001 19:3641492-3641514 AGGCATCGCCCAGTGTCCCCTGG + Intronic
1161468480 19:4444961-4444983 TGGGCCTGCCCTGTGTCCCACGG + Intronic
1161604289 19:5206346-5206368 GGTCCCAGCCCAGTGTCCCCAGG + Exonic
1162977607 19:14217580-14217602 GGGCCCCGCCCCTTCTCCCCAGG + Intergenic
1165388706 19:35526561-35526583 CCGCCCCGCCAAATGTCCCAGGG + Intronic
1168061172 19:53893102-53893124 GAGCCCAGCCCAGCCTCCCACGG + Intronic
925347954 2:3183588-3183610 GGGCCTAGCACAGTGTCTCAGGG + Intergenic
926001816 2:9339352-9339374 GGAACCTGCCCAGTGTCACAGGG - Intronic
926115411 2:10210074-10210096 GGGCCCCTCCTTGTGACCCATGG + Intronic
926542305 2:14196556-14196578 GGGACCTGCCCAGTGTCCAGGGG - Intergenic
926703420 2:15819375-15819397 GGGCCCTTTGCAGTGTCCCATGG + Intergenic
928200391 2:29244235-29244257 GGGCCTTGCCCAGGATCCCACGG - Intronic
932399230 2:71468238-71468260 GTGCCCTGCCCAGTGTCCTTAGG - Intronic
932819448 2:74887061-74887083 GGGCCAGCCCCAGTGTCACAAGG + Intronic
936518750 2:113198863-113198885 GGGCCCCGCCCAGAGCTCCCTGG + Exonic
939011988 2:136857281-136857303 TGGCCATGCCCAGTGTCACATGG - Intronic
941015667 2:160353318-160353340 AGGCCCCACCCAGTCTCCAAGGG - Intronic
946351787 2:219160282-219160304 GGGCCCCGCCCGGTCCCCCTGGG + Intronic
946431661 2:219629722-219629744 GGGCCCAGCCCAGAGCCACAGGG + Intronic
947515978 2:230805206-230805228 GTTCCCCGCCCTGTGTCCAAGGG - Intronic
947549886 2:231038196-231038218 GGGCCCCGCGCAGTCTCACCTGG - Exonic
947834049 2:233162800-233162822 GAGCCCGGGCCAGTGCCCCAGGG + Intronic
1170737212 20:19022400-19022422 GGGCCCCTCAAAGTGGCCCATGG + Intergenic
1171181341 20:23093163-23093185 GGTCTCAGCCCAGTCTCCCAAGG + Intergenic
1171974109 20:31583079-31583101 GGGCCCGGCGCAGTGGCTCAAGG + Intergenic
1173283342 20:41648727-41648749 GGGCCCCAGCCAGTGTCTCAAGG - Intergenic
1173479495 20:43388059-43388081 GGGCCGGGCCCAGTGGCTCATGG + Intergenic
1173594021 20:44247445-44247467 CAGCCCCGCCCATTGGCCCAGGG + Exonic
1175597981 20:60250614-60250636 GGGCCCTGCCCAGTGTCTAAAGG - Intergenic
1175844530 20:62051556-62051578 AGGCCCAGCCCTGTGTCCTATGG - Intronic
1178327426 21:31657211-31657233 AGGCCCTGCCCAGTGCCACAAGG - Intergenic
1179008101 21:37531879-37531901 GGGCCCCGCCCAGTACTGCATGG + Intergenic
1179167246 21:38944624-38944646 GGGCACTGCCCACTGTCCCCCGG - Intergenic
1179557707 21:42191047-42191069 GGGCCCTGCCCACTGTCCTGAGG + Intergenic
1179655984 21:42845011-42845033 GGGCCCAGCCCAGGGTCACACGG + Intronic
1180172217 21:46065436-46065458 GGCCCCCGCCCGGTGTCCACAGG - Intergenic
1180709117 22:17827773-17827795 GGTTCCCGGCTAGTGTCCCAGGG + Exonic
1181000909 22:19987328-19987350 GGGCCCCGCCCCCTGTCTCTGGG - Intronic
1181164534 22:20976328-20976350 GTGCCCTGCCTAGTGTCCGATGG - Intronic
1181465047 22:23106453-23106475 GGGCCCCACCCACAGTGCCAGGG - Intronic
1181633617 22:24164250-24164272 GGACCCCTCTCACTGTCCCAAGG - Intronic
1181636201 22:24175997-24176019 CTCCCCTGCCCAGTGTCCCAGGG + Intronic
1181917520 22:26292747-26292769 GGGTCCCAGCCAGCGTCCCAGGG + Exonic
1182034088 22:27183947-27183969 GGACCCAGCCCAGTCTCCCTGGG + Intergenic
1182435504 22:30327047-30327069 GGGCCCCGCCCACCCTCCCCCGG + Intergenic
1183094725 22:35545317-35545339 GTGCCTCGCCCATTGACCCAAGG - Intronic
1183406777 22:37634013-37634035 GGGCCCAGCTCAGGGTCCCTGGG - Intergenic
1183521945 22:38300671-38300693 GGGCCCCAGCCAGTGGCCCCGGG + Intronic
1183806852 22:40219154-40219176 GGGCTCAGCCCGGTCTCCCAGGG - Intronic
1184155252 22:42662726-42662748 GGGCGCCGCCCAGCGCCCCGTGG - Intergenic
1184241457 22:43213080-43213102 GGTCCCCTCCCTTTGTCCCAGGG - Intronic
1184250759 22:43258840-43258862 GGTCCCCCCTCAGAGTCCCAGGG + Intronic
1184288697 22:43486728-43486750 GGGCCCCTCCCAGCCTCCCCAGG - Intronic
1184362101 22:44024702-44024724 GGGCCCCGCACGGTGGCCCGAGG - Intronic
1185050716 22:48552761-48552783 GGGGCCCGGCCAGGCTCCCAGGG + Intronic
1185088764 22:48754729-48754751 GGAGCCCACCCAGTGTCCCCAGG + Intronic
949693010 3:6662317-6662339 GGGCCAGGCCCAGGGTCCCTGGG - Intergenic
950631262 3:14283628-14283650 GGGCGCCTCCCATGGTCCCATGG - Intergenic
953871731 3:46632870-46632892 GGGCCAAGCCCAGCCTCCCACGG - Intergenic
953879412 3:46683901-46683923 GGGCCCAAGCCAGAGTCCCAGGG + Intronic
953914572 3:46910056-46910078 GGGCCCAGCTCAGAGCCCCATGG + Intergenic
954958894 3:54547400-54547422 TGGCCCCTCCCAGAGTTCCAGGG - Intronic
956780474 3:72599389-72599411 GCGCCCCGGCCAAGGTCCCAGGG - Intergenic
957223393 3:77412806-77412828 TGGACCAGCCCAGTGCCCCAGGG - Intronic
961463707 3:127068882-127068904 GGGCTCAGCCCAGGGTCCCATGG + Intergenic
961652723 3:128425344-128425366 GGGCCCTGCTCAGTGACCCAAGG - Intergenic
967838274 3:193982419-193982441 CGGCCCTGCCCAGTCTCTCAGGG + Intergenic
968519764 4:1030078-1030100 GGGGCCCACACAGTGCCCCAGGG - Intergenic
968868149 4:3227072-3227094 GGGCACAGACCAGTGTCCCTGGG - Intronic
968974540 4:3814355-3814377 AGGCCCCGCCCACTGCCCCCTGG + Intergenic
969018023 4:4118119-4118141 GGGCCCCGCGGGGAGTCCCACGG + Intergenic
969255738 4:6000571-6000593 GGTCCTCCCCCAGTGACCCACGG + Intergenic
969478270 4:7433427-7433449 GGGCACCGACCAGTGTGCCCTGG - Exonic
969536532 4:7759830-7759852 CGGCCCCGCCCTGTGGCACAAGG + Exonic
972388118 4:38587400-38587422 AGGCCCAGCCCAGTTTACCAGGG - Intergenic
977823430 4:101502586-101502608 GGCCCCACCCCAGTCTCCCAGGG - Intronic
983923373 4:173370945-173370967 GGACCCCGCTCACTGTCACATGG - Exonic
986008142 5:3684991-3685013 GAGCCCCGCCCCGGGTCACAGGG - Intergenic
987091090 5:14508227-14508249 GGACCCCGCCAAGCGTCCCTCGG + Exonic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
992940044 5:81751859-81751881 GGGCCGCGCCCTGCGCCCCAGGG + Intergenic
998429501 5:142058734-142058756 GGGCCCTGCCCACTTTCCCTTGG - Intergenic
998557076 5:143135908-143135930 GGGCCCCTGCGAGTGTACCAGGG + Intronic
1001042942 5:168349760-168349782 GCCTCCCGCCCAGTGGCCCACGG - Intronic
1002029245 5:176416112-176416134 GGGCCCCGGCCGGGGTCCCCCGG + Intronic
1002182067 5:177435875-177435897 AGGCCGCGCCCAGGGTCCCCGGG - Intronic
1002310160 5:178309315-178309337 GGGCATCGCCCAGTGACCCTGGG - Intronic
1002928646 6:1619298-1619320 GGGGCGCGCCCGGTGTCCCGGGG + Intergenic
1006448952 6:34095031-34095053 GGGCCAGGGCCAGTGTGCCAGGG - Intronic
1008937266 6:57005393-57005415 GGGCCACGCGCAGTGGTCCATGG + Intronic
1011677979 6:89754136-89754158 GGGCCCGGCACAGAGTCCGAAGG + Exonic
1013998720 6:116340673-116340695 GTTCCCCGCCCTGTGTCCAAGGG + Intronic
1015881877 6:137878543-137878565 GGGGCACGCCCAGAATCCCATGG + Exonic
1018843912 6:167540837-167540859 GTGCCCCGTCCAGTGTCCTGTGG - Intergenic
1019274410 7:168335-168357 AGGCCCTGGCCAGAGTCCCATGG + Intergenic
1019613417 7:1948152-1948174 GGGCTCCGCCCTGTGACCCCGGG - Intronic
1019638696 7:2090759-2090781 GGGCCCCGCCCGGGCTCCAAGGG - Intronic
1019913673 7:4116888-4116910 GGGCTGGGCCCAGTGTCCCTCGG + Intronic
1022207540 7:28179614-28179636 GGGCCGCGCCCAGCGCCCCGGGG - Intronic
1022529859 7:31060042-31060064 GTCCCCAGCCCAGTGACCCAGGG - Intronic
1022809538 7:33855411-33855433 GGGCCCCTGTCAGTGACCCAAGG - Intergenic
1023828462 7:44025238-44025260 GGACAGCCCCCAGTGTCCCAGGG - Intergenic
1023967945 7:44972953-44972975 AGACCCTGCCCTGTGTCCCAAGG + Intronic
1024231581 7:47367639-47367661 GGCCCCCGCACCGGGTCCCATGG + Intronic
1026817023 7:73521569-73521591 GGGCCCCGCACTTTGTCCCGGGG - Intronic
1028121478 7:87059895-87059917 GCGCCCCTCCCAGTGGGCCACGG - Intergenic
1029756763 7:102578665-102578687 GGACAGCCCCCAGTGTCCCAGGG - Intronic
1032042174 7:128572355-128572377 GGGCCACGCTCAGTGGCTCATGG + Intergenic
1034840706 7:154392837-154392859 GGGCCCTCCCCAAAGTCCCATGG + Intronic
1034969370 7:155409504-155409526 GTGCCCCCACCAGTGTCTCATGG - Intergenic
1036282980 8:7417342-7417364 GAGCCCCTCCCAGGGTCCCTGGG - Intergenic
1036848673 8:12186673-12186695 GTGCCCTGCCCTGTGCCCCAAGG + Intronic
1036870034 8:12428954-12428976 GTGCCCTGCCCTGTGCCCCAAGG + Intronic
1039616136 8:38956376-38956398 GGGCCCCGCACAGTGAGGCAAGG + Intronic
1042857894 8:73285882-73285904 GGGCCGGGCCCAGCGTCGCAGGG - Intergenic
1045214204 8:100130368-100130390 GGGCCTGGCCCAGGGTCCCTGGG - Intronic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1048581480 8:135732720-135732742 AGCCACAGCCCAGTGTCCCAGGG + Intergenic
1049173412 8:141176348-141176370 TGGGCTCGCCCAGTGTCCGAAGG - Intronic
1049255351 8:141610760-141610782 GGGCTCTGCTCAGGGTCCCATGG - Intergenic
1049795150 8:144493789-144493811 GGAACCTGCCCAGAGTCCCATGG + Intronic
1049884085 9:16200-16222 GGGCCCCACACAGTCTCCAAAGG - Intergenic
1050092853 9:2033044-2033066 GGGCCCTCCCCAGAGTCCAATGG + Exonic
1056660095 9:88536793-88536815 GGGCACCGCCCAGCCTTCCAGGG + Intronic
1056816548 9:89805962-89805984 GAGTCCCACCCAGTCTCCCAAGG - Intergenic
1057790146 9:98119210-98119232 GAGCCCCGCCCTGTGTCCCGGGG - Intronic
1057801116 9:98192147-98192169 GGGTCCCGACAAGAGTCCCATGG + Intronic
1060554979 9:124503550-124503572 GCGCCCCGCGCAGCGTCCCGGGG + Intronic
1061061130 9:128250919-128250941 GCGCCCCGCCCGGGGTCCCCAGG + Exonic
1061149360 9:128820220-128820242 GGGCTCCACCCAGAGCCCCATGG - Exonic
1061367497 9:130179928-130179950 GGGCACCTCCCACTGTGCCAAGG + Intronic
1061407932 9:130403001-130403023 AGGCCCCGACCTGTCTCCCATGG + Intronic
1061765206 9:132877564-132877586 GGGCCTCGCCCAAAGTCACACGG + Intronic
1061790418 9:133056111-133056133 GGGCCCCCCTCAGTGTCTCAGGG - Intronic
1061825680 9:133256897-133256919 TGGCCTGGCCCAGAGTCCCAGGG + Intronic
1062431880 9:136529994-136530016 GGGCCCTGCCCTGGCTCCCAGGG + Intronic
1188081127 X:25842010-25842032 TTGCCCAGACCAGTGTCCCAAGG + Intergenic
1190560668 X:51682555-51682577 GGGGCCCGCCCCGTCCCCCAAGG - Intergenic
1190563623 X:51710766-51710788 GGGGCCCGCCCCGTCCCCCAAGG + Intergenic
1192183641 X:68931375-68931397 GGGCCCACTCCAGTGTCCCAGGG + Intergenic
1192204725 X:69088378-69088400 GGGCCCAGCCAGCTGTCCCAGGG - Intergenic
1192442596 X:71185717-71185739 GGGCCAGGCCCAGTGGCTCATGG - Intergenic
1196532583 X:116806314-116806336 GGGTACCGCCCAGAGTCACAAGG - Intergenic