ID: 917188696

View in Genome Browser
Species Human (GRCh38)
Location 1:172390513-172390535
Sequence ACTGAAATCTAGAGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917188696 Original CRISPR ACTGAAATCTAGAGGGTAGA GGG (reversed) Intronic
900014868 1:141072-141094 ACTGAACTCCAGGGGGAAGAGGG + Intergenic
900045134 1:499681-499703 ACTGAACTCCAGGGGGAAGAGGG + Intergenic
900067331 1:741411-741433 ACTGAACTCCAGGGGGAAGAGGG + Intergenic
901441737 1:9282269-9282291 AATGAAATCCAGAGGCCAGAAGG + Intergenic
905176214 1:36137118-36137140 ACTGAGTTCTGGAGGGCAGAGGG + Exonic
906089650 1:43167873-43167895 ACTGGCATCTAGTAGGTAGAGGG - Intronic
906800540 1:48733299-48733321 ACTGAAATCCAGAGCCCAGATGG + Intronic
908479251 1:64521086-64521108 ACTGAAATCAAGATGGCAGCTGG + Intronic
909652155 1:77987605-77987627 ACTAAAATAGAGAGGGGAGAAGG - Intronic
910678101 1:89835134-89835156 ACTGAAATCATGGGGGTGGAGGG - Intronic
911910529 1:103628583-103628605 ACTGAAATGGAGAGGGATGAGGG + Intergenic
911917945 1:103722708-103722730 ACTGAAATGGAGAGGGATGAGGG + Intronic
912186849 1:107287600-107287622 TCTTAAATTTAGAGGGTTGATGG + Intronic
915589613 1:156862999-156863021 AGGGAAAGTTAGAGGGTAGAGGG + Intronic
915712662 1:157916253-157916275 ACTGAAATATAGAGAAAAGAAGG - Intergenic
916084418 1:161258412-161258434 AAAGAAATCAAGAGGGTACACGG - Intergenic
917188696 1:172390513-172390535 ACTGAAATCTAGAGGGTAGAGGG - Intronic
917314764 1:173713318-173713340 ACTGAAAGCTAAAGGCAAGATGG - Intergenic
918065797 1:181100869-181100891 GTTGATATCTAGAGGGAAGAGGG + Intergenic
918401960 1:184172458-184172480 ACTACACTCTAGAGGGTACAAGG - Intergenic
918570655 1:185987936-185987958 GCTGAAATTAAGAGGGAAGAGGG + Intronic
919853674 1:201691172-201691194 ACTGGCATCTAGTGAGTAGAGGG - Intronic
921072225 1:211670649-211670671 TCTGGCATCTAGAGGGTAGAGGG - Intronic
921773854 1:219074286-219074308 ACTGACATTTAGAGCGCAGAGGG - Intergenic
922021531 1:221709756-221709778 ATTGAAATCTGGAGGGGAGGGGG + Intronic
922194213 1:223345843-223345865 GCTGAATTCTGGAGGGCAGAGGG - Intronic
923508906 1:234632241-234632263 AATGAAATCAAGAGAGAAGAAGG + Intergenic
923609525 1:235477670-235477692 ACTGGCATCTAGTGGGTAAAGGG - Intronic
924728215 1:246689656-246689678 ACTGAAATCTTGCCAGTAGAGGG + Intergenic
1063742278 10:8837137-8837159 ACTGAAACCATGATGGTAGATGG - Intergenic
1065504336 10:26414368-26414390 ACTAAAGGTTAGAGGGTAGAAGG + Intergenic
1067352943 10:45493531-45493553 AATGAAATCTAGAGGGCATGAGG - Intronic
1068146136 10:53073214-53073236 AAGGAAATGTAGAGAGTAGATGG - Intergenic
1068763899 10:60742055-60742077 AATGAACAGTAGAGGGTAGAAGG - Intergenic
1072424699 10:95320251-95320273 ACTTAAATCTGGAGGGGAGGAGG - Intronic
1072756519 10:98025096-98025118 ACTGAGATCCAGAGAGGAGAGGG - Intronic
1075278463 10:121117451-121117473 ACTTAAGGATAGAGGGTAGAAGG + Intergenic
1076971463 11:136172-136194 ACTGAACTCCAGGGGGAAGAGGG + Intergenic
1080087304 11:28299796-28299818 TCTGAAATCAAGATGTTAGAAGG + Intronic
1081341022 11:41927644-41927666 ACTGAATTCTAGGTGGTCGAGGG + Intergenic
1081591281 11:44424963-44424985 ACTGGCATCTAGTAGGTAGAGGG + Intergenic
1084351350 11:68602200-68602222 ACTGAGGTCTAGAGGGAAGAAGG + Intronic
1085069859 11:73534224-73534246 ACTGAAAGCTAGAAAGCAGATGG + Intronic
1088068815 11:105755885-105755907 ACTGAAATTCAGAGGATGGATGG - Intronic
1089837668 11:121385252-121385274 AATTAAATCTAGAGAGGAGAGGG - Intergenic
1091026897 11:132149603-132149625 ACAGAGAACTAGGGGGTAGATGG - Intronic
1091144985 11:133271403-133271425 ACTGAAAACATGAAGGTAGATGG + Intronic
1092812345 12:12283643-12283665 ACTGGCATCTTGTGGGTAGAGGG + Intergenic
1092907795 12:13117781-13117803 CCTGCAATCTAGAGGGCAGAAGG - Intronic
1093132633 12:15410523-15410545 CCTGAAAGCTAGAGGGTCAATGG - Intronic
1093241592 12:16683564-16683586 ACTGAAATACAAAGGGTAAAAGG - Intergenic
1093565467 12:20597825-20597847 ACTGAAATCTATTGGGTACCTGG - Intronic
1095118047 12:38379981-38380003 ACTTAAAGCAAAAGGGTAGAAGG - Intergenic
1097828050 12:64194651-64194673 GGTGAAATCTAAAGGGGAGAGGG + Exonic
1099706663 12:86162482-86162504 AGTGACAACTAGAGGGTGGAGGG + Intronic
1100595616 12:96069236-96069258 ACTGGCATCTAGCGGGTAGAGGG + Intergenic
1101624347 12:106424216-106424238 AGTTAAATCTAGAGGATAGATGG + Intronic
1102958163 12:117073065-117073087 ACTGAGATCTAGCGGGGAGGTGG - Intronic
1105709395 13:22992068-22992090 ACTGAACCTTAAAGGGTAGAAGG + Intergenic
1107972425 13:45656152-45656174 AGTGAAAGCAAGAGGGCAGAGGG + Intergenic
1108261287 13:48659181-48659203 TCTGAAATCTAAAGGAGAGAGGG - Intronic
1110121356 13:71885758-71885780 CCTGGCATCTAGTGGGTAGAGGG + Intergenic
1110296338 13:73870831-73870853 AAAGAAATCTGGAGAGTAGAAGG - Intronic
1110691790 13:78439122-78439144 ACTGGCATCTAGTGGGTAGAGGG - Intergenic
1110802707 13:79718285-79718307 ACTTAAGTGTAGAGGGTAGGAGG - Intergenic
1111425186 13:88071095-88071117 ACTGAATGCTAGAGAGTTGAAGG + Intergenic
1112452814 13:99527191-99527213 ACTAATATTCAGAGGGTAGAGGG + Intronic
1113629203 13:111869491-111869513 ACTGAAATCTAGAGAGAAACAGG - Intergenic
1114259612 14:21026809-21026831 ACTGGCATCCAGAGGGAAGAGGG - Intronic
1114891374 14:26928292-26928314 ACTGTAATTTAGGAGGTAGAAGG + Intergenic
1117605581 14:57425218-57425240 ACTGTAAGCCAGAGGCTAGAAGG + Intergenic
1117654065 14:57936587-57936609 ATTGGCATCTAGTGGGTAGAGGG + Intronic
1118595366 14:67430990-67431012 TCTGAAATCTAGAGAGAATAGGG - Intergenic
1118815111 14:69306718-69306740 ACTGAAATCTTCTGGGTAGATGG + Intronic
1119494504 14:75067258-75067280 ACTTAAATTTAGGGAGTAGATGG + Intronic
1120213770 14:81660283-81660305 ACTGAATTCCAGAGGGTAGAAGG + Intergenic
1120824074 14:88939522-88939544 GCTGTAATCTAAAGGGAAGACGG - Intergenic
1122259584 14:100506070-100506092 ACTGTGGTCTAGAGGGTGGAGGG - Intronic
1123868787 15:24550725-24550747 ACTGCTAGCTAGAGGGTAAATGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126220334 15:46205994-46206016 GCTGAAATCAAGTGGGCAGATGG + Intergenic
1127291878 15:57578707-57578729 CCTGAAATCTAAACGGGAGAGGG + Intergenic
1127475798 15:59331679-59331701 AATGAAATTTAGATGGTGGAAGG - Intronic
1127714731 15:61638888-61638910 ACTGGTATCTAGATGGGAGAAGG + Intergenic
1128343119 15:66836520-66836542 ACTGAAGCCCAGAGGGGAGATGG + Intergenic
1129242740 15:74261294-74261316 ACTTAAGTCTAAAGGGCAGAGGG + Intronic
1130712291 15:86294988-86295010 ACTGAAAGCAAGAGGGAGGAGGG - Intronic
1131599294 15:93830259-93830281 GCTAAAATCTAGAGAGTAGAGGG + Intergenic
1131712466 15:95071016-95071038 ACTGGCATCTAGTGGGTAGAGGG + Intergenic
1133703248 16:8329176-8329198 ACTGGCATCTAGTGGGTAAAGGG - Intergenic
1134027250 16:10963840-10963862 GCTGACATCTAGTGGGTAGAGGG + Intronic
1134125099 16:11610963-11610985 ACCGAAATCTAAGGGGTAGGAGG + Intronic
1135787666 16:25364903-25364925 ACAGGAATCTAGTGGGGAGAGGG - Intergenic
1135890781 16:26355310-26355332 ACACAAAACTAGATGGTAGATGG - Intergenic
1138577181 16:57915456-57915478 GCTTAAAACTAGAGGGCAGAAGG + Intronic
1142448788 16:90161350-90161372 ACTGAACTCCAGGGGGAAGAGGG - Intergenic
1142458699 17:73939-73961 ACTGAACTCCAGGGGGAAGAGGG + Intergenic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1144472091 17:15553114-15553136 ATTGACATCTAGTGGCTAGAGGG - Intronic
1144924382 17:18791599-18791621 ATTGACATCTAGTGGCTAGAGGG + Intronic
1144940210 17:18933530-18933552 ACAGTAGTCTAGAGGGTAAATGG - Intergenic
1145297517 17:21602817-21602839 ACTTAAATATATAGAGTAGATGG - Intergenic
1146422747 17:32704199-32704221 ACTCAAATGTAGAGGGTATATGG + Intronic
1147517255 17:41131789-41131811 TCTCACATCTAGAGAGTAGAGGG + Intergenic
1147539173 17:41342692-41342714 ACTGAAATGTAAAGTGTAGGGGG - Intergenic
1148516123 17:48219475-48219497 GCTGAAATCTAGAGGGGGAAGGG - Intronic
1148765293 17:50035340-50035362 ACTGACATCTGGAGGCTTGAAGG + Intergenic
1149105295 17:52956458-52956480 ACTGGCATCTGGAGAGTAGAGGG - Intergenic
1150032474 17:61754034-61754056 GCTGTAATCTAGATGATAGATGG - Intronic
1150132746 17:62678207-62678229 ACTGAAGTCTAGGGAGAAGAAGG + Intronic
1151449172 17:74187250-74187272 ACTGGCATCTAGTGGGTAGAGGG - Intergenic
1153273640 18:3347635-3347657 ACTGAGGTCTAGAGAGAAGAGGG + Intergenic
1153604750 18:6821094-6821116 ACAGTAATATAAAGGGTAGAGGG + Intronic
1156558683 18:38096866-38096888 CCTTAATTCTATAGGGTAGAGGG + Intergenic
1156920340 18:42514831-42514853 AGTGAGACTTAGAGGGTAGAAGG + Intergenic
1156945241 18:42821567-42821589 ACTAACATCTAGTGAGTAGAAGG + Intronic
1157288385 18:46392899-46392921 GCTGGAATCCAGAGGGTAGCAGG - Intronic
1158207077 18:55005274-55005296 ACTGAAAGCAATGGGGTAGAGGG + Intergenic
1159993529 18:74939623-74939645 ACAGAAATCTAAAAGGTTGACGG + Intronic
1160043462 18:75366023-75366045 ACTGACATCTGGTGGGTAGAGGG + Intergenic
1160351547 18:78185960-78185982 TCAGAAAACTAGAGTGTAGAAGG + Intergenic
1160648417 19:206452-206474 ACTGAACTCCAGGGGGAAGAGGG + Intergenic
1165380021 19:35472596-35472618 ACTGCAATGTAGAGAGTGGATGG - Intergenic
1167677698 19:50897755-50897777 ACTGGCATCTAGTGGGCAGAGGG - Intergenic
1168127330 19:54292611-54292633 TCTTTATTCTAGAGGGTAGATGG + Intergenic
1168127335 19:54292685-54292707 TCTTTATTCTAGAGGGTAGATGG + Intergenic
1168127338 19:54292722-54292744 TCTCTATTCTAGAGGGTAGATGG + Intergenic
1168127344 19:54292796-54292818 TCTTTACTCTAGAGGGTAGACGG + Intergenic
1168173022 19:54602047-54602069 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168173031 19:54602158-54602180 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168173034 19:54602195-54602217 TCTTTATTCTAGAGGGTAGATGG - Intronic
1168173040 19:54602269-54602291 TCTCTATTCTAGAGGGTAGATGG - Intronic
1168173046 19:54602343-54602365 TCTTTATTCTAGAGGGTAGATGG - Intronic
925191739 2:1890463-1890485 GCTGAAATCTAGAGATCAGACGG - Intronic
925365904 2:3312028-3312050 AATGAAAGCTATAGGGTGGAGGG - Intronic
926624145 2:15076418-15076440 GCTGAAATCTAAAGGATATAAGG + Intergenic
927120077 2:19951220-19951242 ACTAAAATAAAGATGGTAGATGG - Intronic
927169772 2:20359349-20359371 GCTGATAACTAGGGGGTAGAAGG - Intergenic
929955930 2:46458697-46458719 ACTGAAATCTGGAGGGAGGAGGG + Intronic
930207537 2:48603007-48603029 ACAGAACTGAAGAGGGTAGAAGG - Intronic
930822816 2:55664227-55664249 ACTGCAATATAAAGGATAGAAGG + Intronic
931151192 2:59575337-59575359 CCTGCTATATAGAGGGTAGATGG + Intergenic
931267674 2:60674835-60674857 ACTGCTATCAAGAGGGAAGAGGG - Intergenic
933038874 2:77435071-77435093 ACTGGCATCTAGTGGGCAGAGGG - Intronic
934109382 2:88727551-88727573 ACTGAAGGATAGAGGGTGGAGGG - Intronic
935084518 2:99831829-99831851 ACACAAAACAAGAGGGTAGAAGG - Intronic
935877353 2:107524626-107524648 AGGGACATCTAGAGGGGAGAGGG - Intergenic
936018090 2:108974776-108974798 ACTGAAACTGAGAGGGTAGAGGG + Intronic
936782175 2:116047582-116047604 ACTGAAAAGTGGAGGATAGAAGG - Intergenic
937925358 2:127163529-127163551 CCTGAACTCCAAAGGGTAGAGGG - Intergenic
937955125 2:127417850-127417872 CCTGAAAAATAGAGGTTAGAGGG + Intergenic
939997935 2:148937635-148937657 ACAGAAATCCAGAGGATAAAGGG - Intronic
940675261 2:156719285-156719307 ACTGACATCTCGAGGACAGATGG - Intergenic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
941114286 2:161453676-161453698 ACTGAAATCTAGTGAATAGAAGG + Intronic
941339153 2:164284655-164284677 ACTGGTTTCCAGAGGGTAGAGGG + Intergenic
942311477 2:174660967-174660989 ACTGAAGTCAAGAGGGGCGAGGG + Intronic
943499173 2:188665849-188665871 CTTAAAGTCTAGAGGGTAGAAGG + Intergenic
943818434 2:192286292-192286314 ACTGGCATCTAGTGGGCAGAGGG + Intergenic
943931496 2:193859505-193859527 CCTGAAATATAGAGGCAAGATGG - Intergenic
944200743 2:197104889-197104911 ACAGAAGTCTTGAGAGTAGAGGG - Intronic
945519575 2:210807867-210807889 ACTGTAATCTAGAGGATAATAGG + Intergenic
946930526 2:224665826-224665848 ACTGACTTCTAGAGGGTGGCTGG + Intergenic
947375460 2:229490600-229490622 AGTGATAGCTAAAGGGTAGAGGG + Intronic
1169876026 20:10297774-10297796 ACTGAAAGCCAGAGGGTAAGAGG + Intronic
1171196787 20:23206124-23206146 ACTGAAGGCCAGAGGTTAGAGGG - Intergenic
1173063585 20:39685489-39685511 ACTGAAAACTAGGGGGAAAAGGG + Intergenic
1173591366 20:44227633-44227655 ACTGATATCTAGTGGACAGAAGG + Intergenic
1173861312 20:46285468-46285490 ACTGGCATCTAGTGGGTGGAGGG + Intronic
1173997481 20:47349802-47349824 ACTGAAATCTACAGTGGTGAGGG + Intronic
1174194336 20:48762407-48762429 ATTTGTATCTAGAGGGTAGAGGG - Intronic
1175205188 20:57305794-57305816 ACTGAAATGTGCAGAGTAGATGG - Intergenic
1175528540 20:59655501-59655523 ACTAAAATCAAGAGTGTAAAAGG - Intronic
1177304983 21:19303568-19303590 ACTGAAATGTAGAGGGCAAATGG + Intergenic
1178175150 21:30088555-30088577 ACTGAAAGCTAGAAAGTATATGG + Intergenic
1180133389 21:45843134-45843156 CCTGAAAGCTGGAGGGAAGAAGG - Intronic
949304409 3:2623477-2623499 ACTGGAATCTAGAGAACAGAGGG + Intronic
949323436 3:2837763-2837785 AGTAAAATGTAGAGGGAAGATGG + Intronic
949359274 3:3214654-3214676 TCTGCTCTCTAGAGGGTAGAAGG - Intergenic
950317197 3:12013414-12013436 ACTGACACCTTGAGAGTAGATGG - Intronic
950364841 3:12475512-12475534 ACTGAGGTCTAGAGAGAAGAAGG - Intergenic
951305837 3:21060507-21060529 AGTGAAAGCTATAGGGTAGCAGG + Intergenic
951419588 3:22468724-22468746 ACTGAAATCTTAAGTGTTGATGG + Intergenic
951569234 3:24044612-24044634 ACTGAAAAGAAGAGGGTAAACGG - Intergenic
951726985 3:25770926-25770948 ACTGATATCTAGAATCTAGAAGG - Intronic
953927679 3:46990641-46990663 ACTGAAACTCAGAGGGCAGAAGG - Intronic
954422947 3:50428190-50428212 GCTGGCATCTAGTGGGTAGAGGG + Intronic
955812225 3:62803468-62803490 ACTGGCATCTAGTGGGTAGAAGG + Intronic
955872025 3:63449480-63449502 ACTGACACATAGTGGGTAGAAGG - Intronic
956846147 3:73184847-73184869 ACTGGCATCTAGTGAGTAGAGGG + Intergenic
957937279 3:86960873-86960895 CATGAAATCTAGAGCTTAGAGGG - Intronic
958462068 3:94411166-94411188 ACTGGCATCTAGTGTGTAGAGGG + Intergenic
959356930 3:105343761-105343783 AATGAAATCTATAAGGAAGATGG + Intergenic
962364658 3:134770180-134770202 ACTGAAATCTCTTGGGAAGAGGG + Intronic
964249338 3:154692411-154692433 ACTGACATTTAATGGGTAGAGGG + Intergenic
965629888 3:170721927-170721949 ACTCAAATCTAGCCTGTAGATGG + Intronic
965656679 3:170992930-170992952 ACTGATATCTAGAGTCTACAAGG + Intergenic
965698001 3:171429287-171429309 AATGAATTGTAGAGGGCAGAGGG - Intronic
967414162 3:189198223-189198245 ACTGTACACTAGAGGGTAGGTGG - Intronic
967598410 3:191355583-191355605 ACTGAAAGCCAGAAGGAAGAAGG - Intronic
967943865 3:194786969-194786991 ACTGCAAGCAAGAGGGCAGAGGG + Intergenic
968369431 3:198213663-198213685 ACTGAACTCCAGGGGGAAGAGGG - Intergenic
969185726 4:5472938-5472960 ACTGGTATCTAGTAGGTAGAGGG - Intronic
969542134 4:7799029-7799051 GCTGAAAACTGGAGGGTGGATGG - Intronic
970775107 4:19664318-19664340 TCTGAAAAATAGAAGGTAGATGG + Intergenic
971214269 4:24649034-24649056 ACTGAAATTTTGAGGGTATGGGG + Intergenic
971759732 4:30750019-30750041 ATTTATATCTAGTGGGTAGATGG + Intronic
972994437 4:44863180-44863202 ACTGGCATTTAGTGGGTAGAGGG - Intergenic
976337385 4:83906119-83906141 ACTGACATCTAGTGGGTAGAGGG - Intergenic
978916874 4:114137374-114137396 ACAGAAACTTAGAGGGCAGAGGG - Intergenic
978964088 4:114721324-114721346 AGTGAAATCCAGAGGGAATATGG - Intergenic
980642023 4:135593644-135593666 AGTTAAATCTTGAGGGTAGGTGG + Intergenic
981730586 4:147892879-147892901 ACAGACATCTAGAGGGTAGAGGG + Intronic
981981519 4:150798535-150798557 ATTGATAGCTAGAGGGTTGAAGG - Intronic
982271296 4:153591997-153592019 ACTGAAAGTTAGAGGTAAGAGGG - Intronic
982582965 4:157202737-157202759 ACTGAAAACAAGGGGGCAGAGGG + Intergenic
982754692 4:159204312-159204334 AGTGGGATGTAGAGGGTAGATGG + Intronic
985845952 5:2347125-2347147 AAAGAAATCTAGAGGGAAGCTGG - Intergenic
986073896 5:4314638-4314660 ATTCAATTCTAGATGGTAGAGGG + Intergenic
986984596 5:13485903-13485925 AGTGAAATCTCTAGGGGAGAAGG - Intergenic
987614763 5:20259244-20259266 ACTGAAAACTAGAAGAGAGATGG + Intronic
987785348 5:22492180-22492202 ACTGAATTCTGGAGGTGAGAAGG - Intronic
988358452 5:30205561-30205583 ACAAAAATCTAAAGAGTAGATGG + Intergenic
990967735 5:61467919-61467941 ACTGGAATCTTGAGGGGAGGAGG - Intronic
992952585 5:81875003-81875025 ACTTAAATAAAGAGGGTGGATGG + Intergenic
997835329 5:137187444-137187466 AGTGGTAACTAGAGGGTAGAAGG - Intronic
999541514 5:152579264-152579286 ACTCAAAGATAGAGGGTAGGAGG - Intergenic
1001221928 5:169907839-169907861 ACTGGCATCTAGTGGGTAGAGGG + Intronic
1001329065 5:170749474-170749496 AATGAAATCTGGGGGGCAGAGGG - Intergenic
1001943310 5:175756113-175756135 ACTGAAAAATAGAGAGAAGAAGG + Intergenic
1002549340 5:179975368-179975390 ACTGACACCTAGTGGGTAGAGGG + Intronic
1002728710 5:181319248-181319270 ACTGAACTCCAGGGGGAAGAGGG - Intergenic
1004494660 6:16152458-16152480 ACTGGCATTTAGTGGGTAGAGGG + Intergenic
1004596168 6:17101966-17101988 ACTGAAAACTAGAAGGTTGGAGG - Intergenic
1005404773 6:25474894-25474916 AATGAAATCTAGAGTTAAGATGG + Intronic
1006331470 6:33394083-33394105 ACTGGCATCTAGTGGGTAGAGGG + Intronic
1006797002 6:36738145-36738167 ACTGAGACCCAGAGGGCAGATGG + Intergenic
1016271449 6:142294938-142294960 ACTGACATTTAAAGGGAAGAAGG - Intergenic
1018476625 6:164148899-164148921 ACTAAAAGGAAGAGGGTAGAGGG + Intergenic
1020809132 7:12829985-12830007 ACTGGGATCAAGAGGGGAGAGGG + Intergenic
1023272361 7:38477845-38477867 CCTAAAATCTAGAGGTCAGAAGG - Intronic
1023745279 7:43317328-43317350 ACTGCAATCTGGAGGGCAGGAGG - Intronic
1023808829 7:43895169-43895191 ACTGATATCTAGAGTATACAAGG + Intronic
1027332867 7:77117779-77117801 ACTGGCATCTAAAAGGTAGAGGG + Intergenic
1028626169 7:92880289-92880311 ACTGAAAGCAAGAAGGGAGAAGG + Intergenic
1029789891 7:102831339-102831361 ACTGACATATAGTGAGTAGAGGG + Intronic
1031677354 7:124626897-124626919 ACTGAAATCAATATGGTAAAAGG + Intergenic
1032089682 7:128905052-128905074 ACTAAAATCTTGGGGGTTGATGG - Intronic
1033684412 7:143625295-143625317 ACTGAAATCAGGAAGGAAGAAGG - Intronic
1033687588 7:143704514-143704536 ACTGAAATCAGGAAGGAAGAAGG - Intronic
1033700199 7:143832328-143832350 ACTGAAATCAGGAAGGAAGAAGG + Intergenic
1034565591 7:151912107-151912129 ACTGAAAACTGGGAGGTAGAAGG - Intergenic
1034727465 7:153351026-153351048 TCTGAAAGGTAGAGGGGAGAAGG - Intergenic
1037950377 8:23015588-23015610 ACTGAAATCCCCAGGGGAGAGGG - Intronic
1040498330 8:47986382-47986404 ACTGAAACCTATAGGATAGCAGG + Intergenic
1041016303 8:53595436-53595458 ACTGATATCTAGAGTTTATATGG - Intergenic
1041354952 8:56990676-56990698 ACTGGCATCTAGTAGGTAGAGGG - Intronic
1041762443 8:61381584-61381606 ACTTAAAGTTGGAGGGTAGAAGG - Intronic
1042407331 8:68421250-68421272 TCTGAAATCTAGAAAGAAGAAGG + Intronic
1043130589 8:76456055-76456077 ACTGGCGTCTAGAGGGTGGAAGG - Intergenic
1045427887 8:102085231-102085253 AGTGGCATCTAGTGGGTAGATGG - Intronic
1045944461 8:107779962-107779984 TCTGAAATCTAGCCAGTAGAGGG - Intergenic
1046042214 8:108919519-108919541 TCTGAAAACTATAGGGGAGAAGG - Intergenic
1046735608 8:117773301-117773323 ACTGTACTCTGGAGGGAAGAAGG - Intergenic
1048006289 8:130422010-130422032 AGTGAAATGTACAAGGTAGAGGG + Intronic
1048008970 8:130441565-130441587 ACTGAAGTCTAGAGGAAAGAAGG - Intronic
1051804124 9:20972543-20972565 ACTGAAAAAGAGAGGGCAGAGGG - Intronic
1052006100 9:23350731-23350753 ACTGTCATCTAATGGGTAGAAGG - Intergenic
1052679970 9:31678166-31678188 GAGGAAATCTAGAGGGTTGATGG + Intergenic
1055012736 9:71584937-71584959 ATTTAAACCTAGAGGGGAGAAGG - Intergenic
1055776864 9:79775781-79775803 TCTGAAATCCAGAAGGGAGAGGG + Intergenic
1056763379 9:89429840-89429862 ACTGAAGTCTACATGGTGGATGG + Intronic
1057105243 9:92408698-92408720 ACTAGCATCTAGTGGGTAGAAGG - Intronic
1057327857 9:94082358-94082380 TCTGAAATCTTGAGTATAGAAGG + Intronic
1057927579 9:99166800-99166822 ACTGGAAGCTAGAAAGTAGATGG - Intergenic
1059761383 9:117340852-117340874 ACTGAAGCCTAGAGGGAGGAAGG - Intronic
1062753770 9:138276347-138276369 ACTGAACTCCAGGGGGAAGAGGG - Intergenic
1203576286 Un_KI270745v1:11126-11148 ACTGAACTCCAGGGGGAAGAGGG - Intergenic
1185834937 X:3336657-3336679 ACTGAATTGTAGAGGCTACAAGG + Intronic
1186543888 X:10428775-10428797 ACAGGCATCTAGTGGGTAGAGGG - Intergenic
1186906131 X:14112806-14112828 ACTGACATCTAGGGGGTGGGGGG - Intergenic
1189290006 X:39878224-39878246 ACAGAAATCTAGGGGGGCGATGG - Intergenic
1192147607 X:68692406-68692428 ACTGAAAGCTAGACAGGAGAGGG + Intronic
1192221910 X:69203208-69203230 ACTGAAAGCCAGTGGGTTGAGGG + Intergenic
1192909945 X:75592749-75592771 ATTGTCATCTAGTGGGTAGAGGG - Intergenic
1194248312 X:91541464-91541486 ACTGGAATCTAGGAGGCAGAGGG + Intergenic
1195532058 X:105968775-105968797 AATGAAATTTAGAGGGTGGAGGG + Intergenic
1196132442 X:112171972-112171994 TCTGATATCCAGAGTGTAGAAGG + Intergenic
1199484564 X:148333861-148333883 ACTGGCATCTAATGGGTAGAAGG - Intergenic
1199592072 X:149476791-149476813 GTTGAATTCTTGAGGGTAGATGG - Intergenic
1199834427 X:151574460-151574482 AATGAATTCTAGAGGGTTCAGGG + Intronic
1200567324 Y:4782984-4783006 ACTGGAATCTAGGAGGCAGAGGG + Intergenic
1200689788 Y:6295449-6295471 ACTGAAATCTGGATGGTTTAAGG + Intergenic
1201045484 Y:9879271-9879293 ACTGAAATCTGGATGGTTTAAGG - Intergenic
1201453821 Y:14146357-14146379 ACCGAATTCTAGAGGGAAGATGG - Intergenic