ID: 917191251

View in Genome Browser
Species Human (GRCh38)
Location 1:172421847-172421869
Sequence AGGGAGGGCACAGCGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 1, 2: 30, 3: 84, 4: 321}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917191239_917191251 28 Left 917191239 1:172421796-172421818 CCATCCCCTGGCAGCAGCCACAT 0: 1
1: 12
2: 32
3: 113
4: 635
Right 917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG 0: 1
1: 1
2: 30
3: 84
4: 321
917191240_917191251 24 Left 917191240 1:172421800-172421822 CCCCTGGCAGCAGCCACATAGTG 0: 1
1: 1
2: 10
3: 37
4: 196
Right 917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG 0: 1
1: 1
2: 30
3: 84
4: 321
917191242_917191251 22 Left 917191242 1:172421802-172421824 CCTGGCAGCAGCCACATAGTGTG 0: 1
1: 3
2: 4
3: 33
4: 246
Right 917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG 0: 1
1: 1
2: 30
3: 84
4: 321
917191238_917191251 29 Left 917191238 1:172421795-172421817 CCCATCCCCTGGCAGCAGCCACA 0: 1
1: 11
2: 31
3: 101
4: 608
Right 917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG 0: 1
1: 1
2: 30
3: 84
4: 321
917191241_917191251 23 Left 917191241 1:172421801-172421823 CCCTGGCAGCAGCCACATAGTGT 0: 1
1: 3
2: 40
3: 572
4: 1130
Right 917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG 0: 1
1: 1
2: 30
3: 84
4: 321
917191244_917191251 11 Left 917191244 1:172421813-172421835 CCACATAGTGTGGAGAGAGAATC 0: 1
1: 5
2: 18
3: 49
4: 220
Right 917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG 0: 1
1: 1
2: 30
3: 84
4: 321
917191237_917191251 30 Left 917191237 1:172421794-172421816 CCCCATCCCCTGGCAGCAGCCAC 0: 4
1: 9
2: 36
3: 160
4: 881
Right 917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG 0: 1
1: 1
2: 30
3: 84
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917191251 Original CRISPR AGGGAGGGCACAGCGATTGT GGG Intronic
901096121 1:6681733-6681755 AGGCAGGCCACAGTGAATGTGGG - Intronic
903499206 1:23792368-23792390 AGGCAGGGCATAGGGACTGTAGG - Intronic
903806497 1:26009401-26009423 AGGGAGGGGCCAGCGCTTGGCGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906730870 1:48080049-48080071 AGGGAGGGAACAGAGAGTGCAGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907304388 1:53505685-53505707 AGGGTGGGCACAGGGCTTCTGGG + Intergenic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911052260 1:93681312-93681334 GGGGAGCGCTCAGCGATTGGCGG - Intronic
912181764 1:107227234-107227256 AGTGAGGGCTCAGCAAATGTTGG + Intronic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
915611422 1:156996441-156996463 AGGGAGGACACAGGGACTCTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916119061 1:161511924-161511946 AGGGAGGGAGCAGCGATGGGGGG + Intronic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918632948 1:186740542-186740564 TGGGAAGCCACAGAGATTGTGGG + Intergenic
919001633 1:191839191-191839213 AGGGAGAGGAGAGCGATGGTGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923107902 1:230868545-230868567 AGGGCGGGCACAGCGAGGGGCGG - Exonic
923375238 1:233355648-233355670 AGGGAAGGCACAGCGGGAGTCGG - Intronic
1062926120 10:1316672-1316694 GGGGAGGGCACAGCAATAGAGGG - Intronic
1064666447 10:17656969-17656991 AAGGAGGGCACTGCGCATGTGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1067214370 10:44289303-44289325 AAGGAGGGCACTGCGTATGTGGG - Intergenic
1067692305 10:48509642-48509664 GGGGAGGGCCCAGCGAGTCTGGG - Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070965675 10:80528911-80528933 GGGGAGGGAACAGAGATTGGGGG + Exonic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1074584075 10:114749704-114749726 GGGGAGGGCAGAGAGATGGTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074687774 10:115975730-115975752 AGGGAGGCCAGAGCATTTGTGGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076067905 10:127463739-127463761 AGGGAGGGCACAGGGACAGCAGG - Intergenic
1076641194 10:131918178-131918200 TGGAATGGCACAGCGTTTGTAGG + Intronic
1076641330 10:131918900-131918922 TGGAATGGCACAGCGTTTGTAGG + Intronic
1076641399 10:131919268-131919290 TGGAATGGCACAGCGTTTGTAGG + Intronic
1076641419 10:131919370-131919392 TGGAATGGCACAGCGTTTGTAGG + Intronic
1077476449 11:2792620-2792642 GCGGAGGGCACAGCGGTTGTGGG + Intronic
1077842471 11:5990657-5990679 AGGGAGGGCACAGAAAGAGTGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078659788 11:13277715-13277737 GGGTTGGGCACAGCGATTGGTGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080857116 11:36121875-36121897 AGGGAGGGCACTGCAATGGCTGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1083425307 11:62581350-62581372 AGGGAGGGCTCAGACATAGTAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083953583 11:65970552-65970574 GGGGAGGGCACAGCAGCTGTGGG + Intronic
1084467686 11:69335826-69335848 AGGGAGGAGACAGTCATTGTTGG - Intronic
1084662555 11:70554758-70554780 AGATGGGGCACAGCCATTGTTGG - Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1091348692 11:134874970-134874992 AGAGAGGGCAAAGCCACTGTGGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099426030 12:82523526-82523548 AGGGAGGGTAAAGCCAGTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1101244578 12:102873390-102873412 AAGGAGGGTACAGCCATTGGTGG + Intronic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1101552027 12:105772193-105772215 GGGAAGAGCTCAGCGATTGTTGG - Intergenic
1101763434 12:107677765-107677787 GGGGTGGGCAGAGCGAATGTGGG - Intergenic
1106132755 13:26953226-26953248 AGGCAGGGCACAGCCAGGGTGGG - Intergenic
1107524317 13:41214709-41214731 AGGGAAAGCACAGCAATTTTGGG - Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109203828 13:59459912-59459934 GGGGAAGGCACAGCAATTGCAGG + Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110277955 13:73660922-73660944 TGAGAGGGCACAGAAATTGTGGG + Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115306698 14:31940994-31941016 AGGGAGGGAACATAGATTGGTGG - Intergenic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116504906 14:45665908-45665930 AGGAAGAACACAGCAATTGTGGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117504546 14:56389109-56389131 AGGGACTACGCAGCGATTGTGGG - Intergenic
1117870657 14:60197452-60197474 AGGGAGGACAAAGTGACTGTGGG + Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1124067856 15:26362981-26363003 GGGGAGGGCAGAGCTAATGTGGG + Intergenic
1124213260 15:27781430-27781452 AGGGTGGACACTGCGGTTGTGGG + Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127140270 15:55969129-55969151 ACGAAGGGCAAAGTGATTGTGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129426771 15:75469134-75469156 AAGGAGGTCACAGGGAGTGTTGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130515745 15:84624602-84624624 AGGGAGCGCAGAGAGTTTGTTGG - Intronic
1131463516 15:92636855-92636877 AGGGAGGGCAAAGAGTTTTTTGG - Intronic
1133006256 16:2883345-2883367 AGGGAGGGCACCGCTGTCGTCGG + Exonic
1133184747 16:4087613-4087635 AGGGAGGGCACTGAGTCTGTGGG + Intronic
1133855321 16:9544211-9544233 AGAGAGGGCACAGAGATTTCTGG - Intergenic
1134239389 16:12494249-12494271 AGGGAGGACGCAGAGATGGTGGG - Intronic
1136279368 16:29198947-29198969 AGGGAGGGGAGGGCCATTGTGGG + Intergenic
1136554084 16:30997583-30997605 AGAGAGGGCGCAGCGATGGGCGG + Intronic
1137273517 16:46918528-46918550 AGGGAGGGCACAGGTGCTGTGGG - Intronic
1138748312 16:59389413-59389435 AAGGAGGGCACAGTGCATGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139674322 16:68512490-68512512 AGGGAGGGCACTGAGATGGCCGG + Intergenic
1142083759 16:88165048-88165070 AGGGAGGGGAGGGCCATTGTGGG + Intergenic
1142764936 17:2059461-2059483 AGGGAGGGCACCGCGGGAGTGGG - Exonic
1143088671 17:4435500-4435522 AGGGAGGGCACAGTGGGGGTGGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144327597 17:14196790-14196812 AGGGAGGGCAAAGAGAGTGTGGG - Intronic
1145067807 17:19773936-19773958 AAGGAGGGGACAGGGACTGTGGG + Exonic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1147322764 17:39656253-39656275 AGGGAGGACACAGGGACTCTGGG - Intronic
1148293571 17:46478882-46478904 AGGGATGGTAGAGAGATTGTGGG + Intergenic
1148315757 17:46696584-46696606 AGGGATGGTAGAGAGATTGTGGG + Intronic
1148328981 17:46801775-46801797 AGGGAGGGCAGTGCCACTGTGGG + Intronic
1148452632 17:47789992-47790014 AGGGAGGGCGCAGCGAGCCTGGG - Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150286764 17:63959185-63959207 AGGGTGGGCACAGGGATGGGAGG - Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151426078 17:74032008-74032030 AGCGAAGGCCCAGCGACTGTCGG + Intergenic
1151462240 17:74261347-74261369 AGGGAGGGGACAGCTGATGTAGG - Exonic
1152296365 17:79469489-79469511 AGGGACGGCACAGGGAATGTAGG - Intronic
1152501102 17:80709561-80709583 CGGCAGGGGACAGCGAATGTGGG - Intronic
1152589428 17:81204123-81204145 AGGGAGGGTCCAGGCATTGTGGG + Intronic
1152650438 17:81490093-81490115 AGGGAGGGCACAGCCCTGGGGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1154955933 18:21254645-21254667 AGGAAGGGCACTGCAATTCTTGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155792757 18:29995471-29995493 AGGGAGCGCATAGTGACTGTGGG + Intergenic
1157528633 18:48404399-48404421 AGGGTGGGCACAGGGAGTGAAGG + Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1164986137 19:32650089-32650111 GGGGGGGACCCAGCGATTGTAGG - Intronic
1165305074 19:34998790-34998812 AGGTAGGGCACGGCGATAGGGGG + Intronic
1165311850 19:35033341-35033363 AGGGAGGGCACAGGGGTGGGGGG - Intronic
1165480248 19:36059096-36059118 GGGGAGGTGACAGCGATTCTGGG + Intronic
1165621752 19:37253924-37253946 AGGGAGGTCACAGGGATAGCTGG - Intergenic
925280696 2:2682654-2682676 ATGGAGGACACAGCCATTGGAGG + Intergenic
926299276 2:11590472-11590494 AGGGAAGGAACAGCAAGTGTGGG - Intronic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
931723922 2:65090451-65090473 AGAGAGGGCAGAGCGATGGAGGG - Intronic
935447775 2:103174878-103174900 AGGGAGGCCTCAGCACTTGTGGG + Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
937291431 2:120784507-120784529 AGGGAGGGCACAGGCCTTGGGGG + Intronic
938339122 2:130523753-130523775 ATGGAGGGCACAGCTAGTGAAGG + Intronic
938350716 2:130596997-130597019 ATGGAGGGCACAGCTAGTGAAGG - Intronic
940256201 2:151732543-151732565 ATGAAGGTCACAGCGATTGTTGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941528352 2:166633025-166633047 AGGGAGAGCCCAGCAATTCTGGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943779621 2:191808817-191808839 AAGGAGGCCACAGCAGTTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944046046 2:195413426-195413448 AGGAAGAGCACAGCAATCGTGGG + Intergenic
944550159 2:200838331-200838353 AGAGAGGGCGCAGAGTTTGTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169597185 20:7213871-7213893 AGGGAGCACAAAGGGATTGTGGG + Intergenic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170142006 20:13133775-13133797 AGGGATGGTCCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171009891 20:21503467-21503489 AGGGAGTGCACAGGGGCTGTGGG + Intergenic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1173843992 20:46176723-46176745 AGGGAGGGCACAGGGAAGGAAGG + Intronic
1176411746 21:6452856-6452878 AGGGAGAGCCCAACGATTATGGG + Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1178572314 21:33750247-33750269 AGGGGGGGCACAGCTGCTGTGGG - Exonic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1179687240 21:43061178-43061200 AGGGAGAGCCCAACGATTATGGG + Intronic
1180086870 21:45511650-45511672 GGGGAGGGCACAGCGACATTTGG - Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181687269 22:24538031-24538053 AGTGAGGGACCAGGGATTGTGGG + Intergenic
1184724101 22:46333075-46333097 AGGGAGGTCACAGGGCCTGTGGG - Intronic
1185219925 22:49624108-49624130 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219934 22:49624146-49624168 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219941 22:49624184-49624206 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219960 22:49624261-49624283 AGGGAGGGCACAGTGATGCTCGG + Intronic
1185219969 22:49624299-49624321 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219978 22:49624337-49624359 GGGGAGGGCACAGTGATGCTCGG + Intronic
1185219988 22:49624376-49624398 GGGGAGGGCACAGTGATGCTCGG + Exonic
949584219 3:5422275-5422297 AGGGATGGCAGAGCGACAGTTGG + Intergenic
950683405 3:14600924-14600946 AGTGTGGGCAAAGCCATTGTTGG + Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958424311 3:93963852-93963874 AGGGAAGGCACCTCCATTGTAGG - Intronic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
958868267 3:99526404-99526426 AGGGAGGACACAGAGAATATAGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964062078 3:152537343-152537365 AGGTATGGCAGAGCGCTTGTGGG + Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974343725 4:60650169-60650191 AGGGAGGGCATAAAGAATGTTGG - Intergenic
974636285 4:64567712-64567734 AGGGGGGAAACAGCGATTATGGG + Intergenic
974877136 4:67714582-67714604 ATGGTGGGGACAGTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
975912209 4:79280298-79280320 CGGGAGGGCACAGTGATTCCTGG - Intronic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986155912 5:5175813-5175835 AGGGAGAGAACAGCGATCATGGG - Intronic
987537289 5:19205968-19205990 AGGAAGAACACAGCGATTGCAGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988274631 5:29065140-29065162 AAGGAGGGCACTGCATTTGTGGG - Intergenic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
990681634 5:58251146-58251168 AGGAAGGGGACAGAGAATGTGGG + Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999806085 5:155082672-155082694 AGGGTGGGCATGGCGATGGTAGG - Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002259931 5:177985838-177985860 AGTGTGGGCACGGCGAGTGTGGG + Intergenic
1002259953 5:177985926-177985948 AGTGTGGGCACGGCGAGTGTGGG + Intergenic
1002259956 5:177985941-177985963 AGTGTGGGCACGGCGAGTGTGGG + Intergenic
1002259963 5:177985971-177985993 AGTGTGGGCACGGCGAGTGTGGG + Intergenic
1004185178 6:13415373-13415395 AGGGAGGGCACTGCCATTATGGG + Intronic
1007372057 6:41432469-41432491 AGGGAGGGCCCAGAGATGGGGGG - Intergenic
1009537567 6:64908463-64908485 AGGGAGGGCAAAGGGCTGGTTGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016401055 6:143680739-143680761 AGGGTGGGAACAGAGATTGAGGG - Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018631656 6:165827071-165827093 GGGTAGGGCACAGGGAATGTCGG + Intronic
1018807287 6:167271098-167271120 AGGGAGGGAATTGCGATTCTGGG + Intergenic
1019621260 7:1993290-1993312 AGGGAGGGCACAGGGCTTCTGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1029023541 7:97390475-97390497 AAGGAGGGCACTGCGTATGTGGG + Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033125451 7:138703042-138703064 AGTGAGGACACAGTCATTGTTGG + Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035602524 8:905210-905232 AGGGTGGGCACTGTGTTTGTGGG + Intergenic
1039827385 8:41186536-41186558 AGGGAGGGCTATGCCATTGTGGG - Intergenic
1040290280 8:46120655-46120677 AATGAGACCACAGCGATTGTTGG - Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043226919 8:77745201-77745223 AGGGAGGGTACAGAAATTGGAGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045419243 8:101998051-101998073 AGGGATGGCACAGCTGTTATTGG - Intronic
1046028229 8:108750755-108750777 AAGGAGGGCACTGCGCATGTGGG + Intronic
1046691889 8:117295106-117295128 AGTGAGGGCTCAGTGAGTGTTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048444933 8:134486227-134486249 CGGGAGGGCACTGGGAATGTGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052258900 9:26491793-26491815 AGGGAGAACACAGCAGTTGTGGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055615913 9:78072743-78072765 AGTGAAGGCACAGGGAATGTAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058086284 9:100752028-100752050 AGGGGTTGCACAGTGATTGTGGG - Intergenic
1058426164 9:104876768-104876790 AGAGGGGGCACAGCGATGGCAGG + Intronic
1058529785 9:105894261-105894283 TGGGAGGGCACAGGGGTGGTGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059117594 9:111613554-111613576 AGGGAGCTCACAGGCATTGTGGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061849692 9:133407131-133407153 TGGGAGGGCTCAGTCATTGTGGG - Intronic
1062339972 9:136089558-136089580 AGGGAGGGCACCCCGAGGGTGGG - Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1187506654 X:19883816-19883838 AGGCAGGCCACAGCTATGGTTGG - Intronic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188421225 X:29992518-29992540 AGGGAGGGCATAGTAATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192677962 X:73219602-73219624 AGGGAGTGCAAAGTGAGTGTGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194648092 X:96482823-96482845 AAGGAGGGCACTGCGCATGTGGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194756774 X:97747274-97747296 AGGGAGGGCACTGCGCACGTGGG - Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197183456 X:123561961-123561983 ACGGAGGGCACAGAGCTGGTAGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200177207 X:154125533-154125555 AGGGAGGGCACGGTGACTGTGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic