ID: 917193517

View in Genome Browser
Species Human (GRCh38)
Location 1:172443771-172443793
Sequence CGGGCGGGCGCTGCCCTTTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917193517_917193530 -3 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193530 1:172443791-172443813 CCGCAGAGTGGGGCTGGGAGGGG 0: 1
1: 0
2: 2
3: 73
4: 572
917193517_917193539 24 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193539 1:172443818-172443840 GGTAGGGTAGGGTGACCCCAGGG 0: 1
1: 0
2: 0
3: 19
4: 161
917193517_917193538 23 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193538 1:172443817-172443839 GGGTAGGGTAGGGTGACCCCAGG 0: 1
1: 0
2: 1
3: 19
4: 210
917193517_917193535 8 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193535 1:172443802-172443824 GGCTGGGAGGGGACGGGGTAGGG 0: 1
1: 0
2: 11
3: 125
4: 1182
917193517_917193532 2 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193532 1:172443796-172443818 GAGTGGGGCTGGGAGGGGACGGG 0: 1
1: 0
2: 22
3: 208
4: 1954
917193517_917193536 12 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193536 1:172443806-172443828 GGGAGGGGACGGGGTAGGGTAGG 0: 1
1: 0
2: 13
3: 322
4: 2592
917193517_917193526 -5 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193526 1:172443789-172443811 GCCCGCAGAGTGGGGCTGGGAGG 0: 1
1: 0
2: 5
3: 47
4: 388
917193517_917193522 -9 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193522 1:172443785-172443807 GCCCGCCCGCAGAGTGGGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 154
917193517_917193528 -4 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193528 1:172443790-172443812 CCCGCAGAGTGGGGCTGGGAGGG 0: 1
1: 0
2: 4
3: 46
4: 375
917193517_917193524 -8 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193524 1:172443786-172443808 CCCGCCCGCAGAGTGGGGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 160
917193517_917193534 7 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193534 1:172443801-172443823 GGGCTGGGAGGGGACGGGGTAGG 0: 1
1: 1
2: 22
3: 242
4: 2629
917193517_917193537 13 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193537 1:172443807-172443829 GGAGGGGACGGGGTAGGGTAGGG 0: 1
1: 0
2: 7
3: 233
4: 2050
917193517_917193533 3 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193533 1:172443797-172443819 AGTGGGGCTGGGAGGGGACGGGG 0: 1
1: 2
2: 12
3: 145
4: 1220
917193517_917193531 1 Left 917193517 1:172443771-172443793 CCCAAAAGGGCAGCGCCCGCCCG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 917193531 1:172443795-172443817 AGAGTGGGGCTGGGAGGGGACGG 0: 1
1: 2
2: 20
3: 301
4: 2897

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917193517 Original CRISPR CGGGCGGGCGCTGCCCTTTT GGG (reversed) Exonic
902768545 1:18632413-18632435 CGGGCGGGCGCTGGATGTTTAGG - Intronic
903462747 1:23530814-23530836 CGGGCGCGCCAAGCCCTTTTGGG - Exonic
904164444 1:28544673-28544695 CGGGGGGGCCCTTCCCTGTTTGG + Intergenic
916694479 1:167221558-167221580 CGGGGGGGCGCTGCCCGCCTTGG + Intronic
917193517 1:172443771-172443793 CGGGCGGGCGCTGCCCTTTTGGG - Exonic
1063624285 10:7675004-7675026 CGGGGGGGAGATGCACTTTTAGG - Intergenic
1064769560 10:18710371-18710393 GGGGCGAGCGCTGTCCTTTGCGG - Intergenic
1070586884 10:77773081-77773103 TAGGCGGGCCCTTCCCTTTTAGG + Intergenic
1073466272 10:103696217-103696239 CGAGCAGGCGCTGCCCTAATAGG + Intronic
1074023135 10:109605660-109605682 CTGGCGGGTGCTTCCCATTTAGG - Intergenic
1075132061 10:119748622-119748644 CGGGAGGGAGCTGCCCCCTTCGG - Intronic
1075940850 10:126388891-126388913 CGGGCGAGAGATGCCCCTTTGGG - Intergenic
1076247965 10:128962211-128962233 CGGGCGGGAGCTGCCCTGTGCGG + Intergenic
1078561705 11:12378011-12378033 CGCCCGGGCGCTGCCCTCCTGGG + Intronic
1082850945 11:57764238-57764260 CGGGGGGGCGGTTCTCTTTTAGG + Intronic
1106540157 13:30683368-30683390 CGGGCTGGGGCTGTCCTTCTAGG - Intergenic
1117003577 14:51395680-51395702 GGGCCTGGCGCTGTCCTTTTTGG - Intergenic
1127827781 15:62719925-62719947 TGGGCAGGGGCTGCCCTTTAAGG + Intronic
1129669649 15:77600158-77600180 CCGGCAGGGGCTGCCATTTTGGG + Intergenic
1132437818 15:101824654-101824676 CTGGCGGAGGCTGCCATTTTGGG + Intergenic
1132975199 16:2707542-2707564 CGGGTGGGCGCTGCCTCTTGGGG + Exonic
1136535599 16:30897174-30897196 CGGGCGCGCGCTGTGCGTTTCGG + Intronic
1136983879 16:35082474-35082496 CTGGAGGTCCCTGCCCTTTTGGG + Intergenic
1142156574 16:88535104-88535126 CAGGCGGGCGCTGCCCCCTGCGG - Exonic
1143452944 17:7047021-7047043 CGGGAGGGCCCTTCCCTTTTAGG + Intergenic
1144242300 17:13324663-13324685 CGGCCGGGCTCAGCCCTTTAAGG - Intergenic
1147452890 17:40517098-40517120 CAGGGTGGGGCTGCCCTTTTGGG + Intergenic
1150069306 17:62138402-62138424 CGGGCGGGCGCGGCGCTGTGCGG + Intergenic
1160383984 18:78483138-78483160 CAGGCAGGGTCTGCCCTTTTGGG - Intergenic
1160726915 19:621437-621459 CGGGCGGGCGCGGCGCTGTGCGG + Exonic
1162745217 19:12793985-12794007 CAGGCGGGCGCCGCCCTTCCTGG - Intronic
1165723986 19:38100024-38100046 CGGGCGGGGCCTGCCCTTGAAGG + Exonic
1167638649 19:50668579-50668601 CGGGAGGCCGCCGCCCTTCTGGG + Exonic
937313613 2:120917120-120917142 TGGGAGGGCGCTGGCCTTCTGGG + Intronic
1174824178 20:53754519-53754541 AGGGCAGGAGCTGCCTTTTTGGG + Intergenic
1175881066 20:62259313-62259335 CGGCCGGCCGCTGCCCTGGTGGG - Intronic
1178862861 21:36303952-36303974 CGTGTGGCCGCAGCCCTTTTTGG + Intergenic
1181160737 22:20958075-20958097 CGGGCGGAGGCTGTCCTCTTGGG - Intergenic
1181595853 22:23913957-23913979 CGGGCGCGCGCTGCTCCCTTAGG - Intergenic
1182903742 22:33920093-33920115 CCGGCAGGCGCTGCCCTACTCGG + Exonic
954613728 3:51959170-51959192 AGGGAGGGGGCTGCCCTCTTAGG + Intronic
963915298 3:150854248-150854270 AGGGGGGGGGCTACCCTTTTTGG + Intergenic
967880255 3:194296911-194296933 GGGGCGCGCGCTGCCCTTCGAGG - Intergenic
968521396 4:1036190-1036212 CAGCCGTGCGCTGACCTTTTGGG + Intergenic
968674914 4:1871878-1871900 CGGGCGGGCGCGGCCATGTTGGG + Intronic
968910215 4:3473658-3473680 CGGGCGGGGGCTCCCCGTTCAGG + Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
983649643 4:170026006-170026028 GGGGCGGGGGCTGGCCGTTTGGG - Intronic
985669533 5:1200431-1200453 CTGTCGGGCGCTGCCCGTTTGGG - Intergenic
987203022 5:15596603-15596625 CAGGCAGGCACTGCCCTTGTGGG - Intronic
1001659042 5:173376742-173376764 CTGGCCGGAGCTGCCCTTTCAGG - Intergenic
1013654234 6:112228683-112228705 CCGGCGGGAGCTGCCATCTTGGG + Intronic
1023700668 7:42888952-42888974 CAGGCAGGCGCCGCCCTGTTCGG + Intergenic
1043968896 8:86508700-86508722 CGGGCGGGCGCGGTTCTTTCCGG - Exonic
1061200867 9:129137792-129137814 CCGGCCGGCCCTGCCATTTTGGG - Intronic
1061293433 9:129665293-129665315 CGGGCGGGCGGGGCCGTTGTTGG + Intergenic
1061880471 9:133566486-133566508 CGGGCGCGCCCTGCCCTCTGTGG - Intronic
1062499415 9:136845866-136845888 CGGGCGGGCGCCGGCCTTCGGGG - Exonic