ID: 917195515

View in Genome Browser
Species Human (GRCh38)
Location 1:172460882-172460904
Sequence CAAAGCTGCCTGCCAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917195515_917195519 28 Left 917195515 1:172460882-172460904 CCTGTCTTTGGCAGGCAGCTTTG 0: 1
1: 0
2: 1
3: 16
4: 219
Right 917195519 1:172460933-172460955 ATTCATACAATAGCGCTAGCTGG 0: 1
1: 0
2: 0
3: 0
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917195515 Original CRISPR CAAAGCTGCCTGCCAAAGAC AGG (reversed) Intronic
900105750 1:980358-980380 CAAAGCTGATGGCCAAAGCCGGG - Exonic
901758643 1:11456517-11456539 ACAAGCTCCCTGCAAAAGACTGG + Intergenic
901861312 1:12076423-12076445 AAAAGCGGCTTACCAAAGACAGG - Intronic
903015665 1:20360110-20360132 GAAAGCTGCCAGGCAAAGAAAGG + Intergenic
904323670 1:29713038-29713060 CACAGCTGCCTGCCACACTCTGG - Intergenic
904676255 1:32200976-32200998 CATAGCTGGCTGCCACTGACGGG - Intronic
905417988 1:37817897-37817919 TTAAGCTGCATGCCAAGGACAGG + Intronic
905759765 1:40545394-40545416 CAAAGCAGCTTGCTGAAGACTGG + Intronic
906219623 1:44068613-44068635 CCAAGCTGCCTGCCTCAGTCTGG + Intergenic
907467586 1:54649478-54649500 CAGAGCTGCCTGGCAGTGACTGG - Intronic
907870799 1:58441066-58441088 CAAAGCTGCCCCCAGAAGACTGG + Intronic
907977135 1:59442781-59442803 CACAGTGGCCTGACAAAGACAGG + Intronic
908605125 1:65790470-65790492 CAAAGCTGTCTCTCAAAAACTGG - Intergenic
908877551 1:68695191-68695213 CAAGGCTGTCTGCCATAGAGAGG + Intergenic
909136013 1:71801200-71801222 CAGAGCTGACTGGCAAAGAGAGG - Intronic
913036765 1:114974515-114974537 CAAAGGTGGTTGCCAAGGACTGG - Intronic
913681834 1:121193352-121193374 CAATGGTGCTTGCCAGAGACAGG - Intronic
914033669 1:143980978-143981000 CAATGGTGCTTGCCAGAGACAGG - Intergenic
914155777 1:145086994-145087016 CAATGGTGCTTGCCAGAGACAGG + Intronic
915284170 1:154842340-154842362 CAGAGCTGTCTGGCCAAGACAGG + Intronic
915617250 1:157048061-157048083 AAAAGATGCTTGCCAAAGATAGG + Intergenic
916327845 1:163582904-163582926 CAAAGAAGCCTGCCAACAACTGG - Intergenic
916481873 1:165221505-165221527 CCAAGCTGCATGCCAGAGTCAGG + Intronic
916538635 1:165729860-165729882 CAAACCTGCCTACCACAGAATGG - Intronic
917195515 1:172460882-172460904 CAAAGCTGCCTGCCAAAGACAGG - Intronic
920087518 1:203428554-203428576 CAATGCTGCTTGCCTAAGGCAGG + Intergenic
920469150 1:206211865-206211887 CAATGGTGCTTGCCAGAGACAGG - Intronic
921678045 1:217998942-217998964 CACAACTGCATACCAAAGACAGG + Intergenic
922994122 1:229942639-229942661 CCACGCAGGCTGCCAAAGACTGG - Intergenic
923268330 1:232333436-232333458 CAAAGGGGCCTGACAGAGACAGG + Intergenic
924766396 1:247034911-247034933 GGAAACTGCCTGCCAAACACAGG + Intergenic
1066342800 10:34552347-34552369 CACATCAGCCTCCCAAAGACTGG + Intronic
1066618859 10:37323322-37323344 CAAAGCTTCCCTCCAAAGCCAGG - Intronic
1069959044 10:72068824-72068846 CACAGCTGCCTGCTAAAGCCAGG + Intronic
1070566080 10:77604893-77604915 CCAAGCTGCCTGACAAGGAAGGG - Intronic
1071060475 10:81564608-81564630 GAAAGCAGGCTGCCAAAAACGGG - Intergenic
1074797647 10:116965029-116965051 CAAAGCTGCATTCCCTAGACCGG - Intronic
1075902483 10:126054339-126054361 CAAGGCTGCCTGACAAAATCAGG - Intronic
1076109579 10:127850612-127850634 CAAAGCTGACAGCCAGAGGCAGG + Intergenic
1076157518 10:128215150-128215172 CAAAGGTGCCTGGGAAAGGCAGG + Intergenic
1076868084 10:133179147-133179169 CAGAGCTGCGTCCCAAGGACCGG - Intronic
1077151490 11:1074943-1074965 CCGAGCCCCCTGCCAAAGACAGG - Intergenic
1078347202 11:10561195-10561217 CAAGTCTGCCTGAGAAAGACAGG - Intronic
1078438768 11:11346914-11346936 AAAAGCTGACATCCAAAGACAGG - Intronic
1079382440 11:19949665-19949687 CAAAGGAGCCTGCCACAGAGTGG - Intronic
1082781030 11:57287504-57287526 AGAAGCTGACTGCAAAAGACAGG - Intergenic
1083732955 11:64662949-64662971 CAAAGCTCCCTGCCAAATTCAGG - Intronic
1084428963 11:69100908-69100930 CAAAGCTGCCTGCCCAAGTGGGG + Intergenic
1085399955 11:76230058-76230080 CGAGCCTGCCTTCCAAAGACAGG - Intergenic
1086999185 11:93396059-93396081 AAGTGGTGCCTGCCAAAGACAGG + Intronic
1087253958 11:95934634-95934656 TAATGCTGCTTGCCTAAGACAGG - Intergenic
1087499527 11:98932721-98932743 TAATGCTGCTTGCCTAAGACAGG + Intergenic
1088089644 11:106022481-106022503 CAGAGCTGCGCGCCACAGACGGG - Intergenic
1089710273 11:120309602-120309624 CCAAGCTGTCTGCCAAGCACTGG + Intronic
1090253235 11:125265389-125265411 CAAACCTCCCTGGCAAACACCGG + Intronic
1091157166 11:133384668-133384690 CAAAGCATCCTGCCACTGACAGG + Intronic
1092530219 12:9337904-9337926 TAAAGCAGCATACCAAAGACTGG + Intergenic
1092984909 12:13836202-13836224 CAAACCTGCCTGCCATACTCAGG + Intronic
1095835858 12:46638075-46638097 CAAAGATGGCAGCCAAAGATGGG - Intergenic
1096523624 12:52198130-52198152 CAAAGCTAGCTGCCAGAGATGGG - Intergenic
1098233921 12:68400329-68400351 CACTGCTTCCTGCCAAAGAATGG - Intergenic
1102459516 12:113091701-113091723 CAACTGTGCCTGCCAAGGACAGG + Intronic
1109206030 13:59483834-59483856 CGAAGCTGCCTGACAAAGTAGGG - Intergenic
1110060128 13:71030213-71030235 TAATGCTGCTTGCCTAAGACAGG + Intergenic
1113099748 13:106704333-106704355 CAGAGCCGCCTGTGAAAGACTGG + Intergenic
1113615624 13:111678540-111678562 CACAGCTCCCAGCCACAGACGGG - Intergenic
1113621092 13:111763442-111763464 CACAGCTCCCAGCCACAGACGGG - Intergenic
1113861180 13:113488615-113488637 CAAAGCTTACTGCCAATGTCTGG - Intronic
1118608042 14:67517287-67517309 CAATGCTGCCTCCCAGAGCCTGG - Intronic
1118870795 14:69739697-69739719 CAAACCTGTCTGACAAAGATGGG - Intronic
1121097887 14:91230484-91230506 AAGAGCTGCCTGTCAGAGACTGG + Intergenic
1124353856 15:28980031-28980053 CAAAGCTGTCTTTCAGAGACAGG + Intronic
1126542630 15:49839651-49839673 TAATGCTGCCTGCCTAAGACAGG - Intergenic
1128620762 15:69147681-69147703 CAAAGCAGCATGGCAAAGAGAGG - Intergenic
1129737266 15:77973288-77973310 AAGAGCTGCCTGCCACTGACAGG - Intergenic
1129848806 15:78780337-78780359 AAGAGCTGCCTGCCACTGACAGG + Intronic
1132201118 15:99955480-99955502 CAAAACTGCCTCCCAGAGGCTGG - Intergenic
1132469159 16:92330-92352 AAAAACTGCCTGCCACAGCCAGG + Intronic
1132580944 16:684375-684397 CGAAGCTGCCGGCCAATGGCTGG - Exonic
1132672158 16:1106377-1106399 CCAAGCTGCCTGGCAGAGTCTGG + Intergenic
1133039901 16:3055135-3055157 AGGAGCTGCCTGCCAAAGCCTGG + Intronic
1133043785 16:3074966-3074988 AGGAGCTGCCTGCCAAAGCCTGG + Intronic
1134528521 16:14963617-14963639 GGAAGCTGCCTGCCAATGAGTGG + Intergenic
1136998876 16:35211211-35211233 GCAAACTGCCTGCCAAACACAGG + Intergenic
1137010987 16:35319973-35319995 GCAAACTGCCTGCCAAACACAGG + Intergenic
1137021250 16:35429914-35429936 TCAAACTGCCTGCCAAACACAGG + Intergenic
1137029722 16:35510518-35510540 GCAAACTGCCTGCCAAACACAGG - Intergenic
1139582428 16:67881333-67881355 CACGGCTGCCTGCCAAGGACTGG + Exonic
1141420045 16:83908763-83908785 CAGAGCAGCTTGCCACAGACGGG - Intronic
1142122512 16:88393836-88393858 CAAAGCTGCTGGCCGGAGACCGG - Intergenic
1145249434 17:21289294-21289316 TAATGCTGCATGCCAAAGCCAGG - Intronic
1146751966 17:35389882-35389904 GAAAACTGCCTGGCAAAGAGTGG + Intergenic
1147191755 17:38742024-38742046 CACAGATGCCTGCCAAAGCTGGG + Intronic
1148972837 17:51499388-51499410 TAAAGATGCTTGGCAAAGACTGG - Intergenic
1151034253 17:70779868-70779890 GAAAGCTGCCTGCCCAGGCCCGG + Intergenic
1151666864 17:75550076-75550098 CAAAGCTGCCTGGCAGCCACTGG - Intronic
1152026900 17:77815807-77815829 CAGAGCTACTTGCCAGAGACGGG + Intergenic
1152137863 17:78515746-78515768 GGAAGCTACCTGCCAAGGACTGG - Intronic
1155085663 18:22455232-22455254 GGAAGCTGCCTTCCAAAGACTGG + Intergenic
1155751070 18:29422840-29422862 TAATGCTGCTTGCCTAAGACAGG + Intergenic
1156718583 18:40042257-40042279 CCAAGCTGCCTGGCAAAGGGAGG - Intergenic
1158251288 18:55490228-55490250 TAAAGGAGCCTGCCAAAGAGAGG - Intronic
1160390100 18:78523587-78523609 CAATGCTCCCTGCCAAACAGTGG - Intergenic
1160833849 19:1115630-1115652 CAGAGCTGCCTGTCGAAGTCTGG - Intronic
1161455263 19:4366720-4366742 CACAGCTGCCTGCCCACGGCAGG + Intronic
1162009717 19:7805056-7805078 CAGAGCTCCCTGGCAAAGACTGG - Intergenic
1162595443 19:11625329-11625351 TAATGCTGCCTGCTCAAGACAGG + Intergenic
1164056010 19:21622688-21622710 TAATGCTGCTTGCCTAAGACAGG - Intergenic
1164255823 19:23527367-23527389 TAATGCTGCTTGCCTAAGACAGG + Intronic
925122337 2:1428915-1428937 CATGGATGCCAGCCAAAGACAGG - Intronic
925163179 2:1701111-1701133 AAAAGCTGCATCCCAAAGCCAGG + Intronic
927056018 2:19366150-19366172 CAAAGCTGCCCTCCAAAAACAGG + Intergenic
927718000 2:25364838-25364860 CCCAGCTGCCTGGGAAAGACTGG - Intergenic
927820143 2:26257434-26257456 TAATGCTGCTTGCCTAAGACAGG + Intronic
929069448 2:38014627-38014649 CAATGCTCTCTGCTAAAGACTGG - Intronic
929586790 2:43121295-43121317 GAAAGCTGCCAGCCAGGGACAGG + Intergenic
929787253 2:45001691-45001713 CAAAGCTGCCTAGGAAAGGCTGG - Intergenic
930716886 2:54601662-54601684 AAATGCTGGCTGACAAAGACTGG - Intronic
932535533 2:72589958-72589980 CCAAGCTGCCCTCCAAAGAGGGG + Intronic
932916443 2:75864401-75864423 AAATGCTGACTGCCAAACACTGG + Intergenic
933731902 2:85462632-85462654 CCAAGTTGCCTGCCAGAGAGAGG - Intergenic
936108151 2:109643461-109643483 TAAAGAAGCCTGCCAAAGGCTGG + Intergenic
936150982 2:110022395-110022417 CAAAGCTGCAGGCCCCAGACAGG + Intergenic
936193694 2:110348974-110348996 CAAAGCTGCAGGCCCCAGACAGG - Intergenic
937272463 2:120661757-120661779 CAAGGCTCCCTGCCAGAGCCTGG + Intergenic
937985776 2:127637500-127637522 GAAGGCTGCCCGCCAAGGACAGG - Exonic
938099142 2:128486331-128486353 CAAACGTGCCTGCCATAGAGTGG + Intergenic
938894644 2:135738006-135738028 CAAAGCAACCTGCCAGATACTGG - Intergenic
941526267 2:166610452-166610474 TAATGCTGCCTGCTTAAGACAGG - Intergenic
942073202 2:172333948-172333970 CAAAGCTGCCTGGTAAACAGGGG - Intergenic
942093235 2:172514168-172514190 TAATGCTGCCTGCTTAAGACAGG - Intergenic
942529490 2:176894186-176894208 CATGGCTGCATGCCAAAGAAGGG + Intergenic
942810098 2:179988836-179988858 AACAGGTGCCTGCCACAGACAGG - Intronic
946411009 2:219515143-219515165 CAGGGCTGCCCCCCAAAGACCGG + Exonic
1168753947 20:302826-302848 TGAAGCTGCCACCCAAAGACAGG + Intergenic
1173139460 20:40469724-40469746 CAGAGCAGCCTCCCAAAGGCAGG + Intergenic
1173341009 20:42152902-42152924 CAAAGATGCCTGCCTATGAAAGG - Intronic
1175434890 20:58938204-58938226 CAAAGCTCCCTGGCAAAGACTGG - Intergenic
1175934242 20:62507766-62507788 CAGGGCTGCCACCCAAAGACTGG - Intergenic
1182105060 22:27683205-27683227 CAAAGCTGCCGGCCTGAGATGGG + Intergenic
1183490243 22:38112005-38112027 CCAAGCTGCCTGCCCGAGGCTGG - Exonic
1183959389 22:41402189-41402211 GAAAGCTGCCAGCCAGAGATAGG + Intergenic
950904095 3:16521817-16521839 CAAGGCTGCCTGCCAAAACCGGG - Intergenic
953327079 3:42021527-42021549 CGAAGCTGCCTGTCATAAACAGG - Intronic
953834862 3:46333726-46333748 TAATGCTGCCTGCTTAAGACAGG - Intergenic
960850768 3:122051761-122051783 CAAAGCCGGCTGGTAAAGACTGG - Intergenic
961414863 3:126749879-126749901 CAAAGCTCCATACCAAAGAATGG + Intronic
961557454 3:127706352-127706374 CACAGCTGCCAGCAAAATACAGG - Intronic
962222584 3:133575809-133575831 TAAAGTTGACTGCCATAGACTGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962716722 3:138132938-138132960 CAAAGCTGGCTTCCTGAGACTGG - Intergenic
963729339 3:148956385-148956407 CAGAGCTGACTGCGGAAGACAGG - Intergenic
963849649 3:150198277-150198299 CACAGCTGCCTGGCAAAGGAGGG + Intergenic
965003340 3:162986363-162986385 CAAAGATTCCTGTCAGAGACCGG + Intergenic
967515889 3:190368044-190368066 AAAGGCTGCCTGCCACAGCCAGG - Intronic
967933040 3:194704373-194704395 CCAAGCTGCCAGCCAAGGAATGG - Intergenic
968502035 4:955318-955340 CAAAGCTGTGTGCCAAAGCAGGG - Intronic
969616015 4:8252956-8252978 CAGAGCTGCCTGCCACAGAGGGG - Intergenic
970184122 4:13431163-13431185 CAGAGTTGCCTGCCCTAGACTGG + Intronic
970249351 4:14097584-14097606 CATAGCTGCATGCCAATGAGAGG - Intergenic
971181321 4:24330833-24330855 AAAAGTTGCCTGCCAAAGAGTGG - Intergenic
971400755 4:26273465-26273487 CCTAGCTGCCTGCCAAGGCCGGG - Intronic
974076045 4:57169591-57169613 CAAATCTGCCTGCCAGGGATGGG - Intergenic
974640529 4:64624515-64624537 TAATGCTGCTTGCCTAAGACAGG + Intergenic
975148330 4:70993862-70993884 CAGAGCTGGCTGAGAAAGACGGG - Exonic
976192455 4:82501256-82501278 CAAACCTGACTGCCCAGGACTGG + Intronic
977862280 4:101977298-101977320 TAAAGCTTCCTGACAAAGCCAGG + Intronic
978549650 4:109911714-109911736 CAGAGCTGCCTGGCAGAGGCTGG + Intergenic
980628785 4:135407970-135407992 TAATGCTGCTTGCCTAAGACAGG - Intergenic
980850851 4:138379613-138379635 AGAAGCTACCTGCCAAAGAATGG - Intergenic
983257148 4:165412642-165412664 CAATGCTGCCTGCCTGAGACAGG - Intronic
983821023 4:172193419-172193441 CACAGCAGCCTGGCAAAGAAGGG + Intronic
984328031 4:178277915-178277937 TTAAACTTCCTGCCAAAGACAGG - Intergenic
986758916 5:10862273-10862295 CAAGGCTGGCTGCCAGAGTCAGG - Intergenic
988996564 5:36720971-36720993 CAAATCCGCCTGCCAAAGAAAGG + Intergenic
989949363 5:50279561-50279583 TATACCTACCTGCCAAAGACAGG - Intergenic
990007782 5:50963782-50963804 CAGTGCTGGCTGCCAAAGGCAGG - Intergenic
990428885 5:55715004-55715026 CATAGCTAACTGGCAAAGACTGG + Intronic
990902662 5:60770229-60770251 CAAAGCTGACTGGCGATGACTGG + Intronic
992954422 5:81892549-81892571 AAAAGTTCCCTGCCGAAGACTGG + Intergenic
997694794 5:135852350-135852372 CAAAGCGGCCTGCAGAAGCCGGG + Intronic
1001046397 5:168375444-168375466 CAAAGCTGCCCTCCAAAGTCAGG - Intronic
1001297293 5:170506923-170506945 CCAAGCTGCCTCCCATAGAAGGG - Intronic
1001611999 5:173010190-173010212 GAAATCTGCCTGCCATAGAGTGG + Intronic
1002423510 5:179162745-179162767 GAAGGCTGCCTGCCACTGACGGG + Intronic
1002762916 6:215685-215707 CTAAGCTGGCTGCCACAGGCTGG - Intergenic
1005197175 6:23300880-23300902 GAAAGCTGTCTGCCACAGAGAGG - Intergenic
1005211203 6:23466055-23466077 AACAGCTGCCTGTCAATGACAGG - Intergenic
1005481345 6:26258209-26258231 TAATGCTGCTTGCCTAAGACAGG - Intergenic
1006556462 6:34871362-34871384 TAATGCTGCATGCCAAAGACAGG - Intronic
1006684951 6:35824985-35825007 CACAGCTGACAGCCAAAGATAGG - Intronic
1007173905 6:39883548-39883570 CAATGATGGCTGCCAAGGACAGG + Intronic
1007256787 6:40535332-40535354 CACAGCTGCCTGCCTAACTCAGG - Intronic
1007622297 6:43222605-43222627 CAATGATGCCTGCCAGGGACTGG + Exonic
1009033755 6:58092082-58092104 CAAAGCTGCCTGCCACCCAACGG + Intergenic
1009209364 6:60843789-60843811 CAAAGCTGCCTGCCACCCAGCGG + Intergenic
1010850063 6:80763994-80764016 CATTTATGCCTGCCAAAGACTGG - Intergenic
1011118582 6:83924659-83924681 CAAAGCAGCCTTCCAAACTCTGG - Intronic
1011998449 6:93622742-93622764 CAGAGCTGACTGACATAGACGGG - Intergenic
1013131219 6:107234683-107234705 TATAGTTGCCAGCCAAAGACTGG - Intronic
1016850733 6:148616202-148616224 CAAGGCCCCCTGGCAAAGACAGG - Intergenic
1019517629 7:1446804-1446826 CCAAGCTGCCCGCCAATGCCTGG + Exonic
1023799781 7:43823902-43823924 CAATGCTGCCTGCTTAGGACAGG - Intergenic
1023857264 7:44192253-44192275 CATAGCTTCCTGCTAAGGACAGG + Intronic
1027978217 7:85185647-85185669 CAAAGCTCCCTGCCACAGCGCGG + Intronic
1028890892 7:95987463-95987485 CTAAGCTGCTTGACAAAGAAAGG - Intronic
1029925280 7:104309312-104309334 CATAGATGTATGCCAAAGACAGG - Intergenic
1030065050 7:105652960-105652982 CAAGGCTGCCTGCCCAGAACCGG - Intronic
1033600456 7:142885292-142885314 CAAAGGTGCCAAACAAAGACGGG + Intronic
1033685155 7:143632883-143632905 CAACTCTGCCTGCCAAGGAGTGG + Intronic
1033688328 7:143712102-143712124 CAACTCTGCCTGCCAAGGAGTGG + Intronic
1033699459 7:143824738-143824760 CAACTCTGCCTGCCAAGGAGTGG - Intergenic
1036107478 8:5856470-5856492 TAATGCTGCTTGCCTAAGACAGG + Intergenic
1039472363 8:37821425-37821447 CACAGTTGCCTGCCCAAGGCTGG - Intronic
1041940589 8:63382770-63382792 TAAGGCTGCCTGCCAGAGATGGG + Intergenic
1045271696 8:100667665-100667687 CAAAGCTTCCTGCCTAAGATTGG + Intergenic
1047290528 8:123525672-123525694 CAAAGTTGCCTGCCCAGGAAGGG - Intronic
1048231948 8:132651144-132651166 CAACACTGACTGCCAAAGGCGGG + Intronic
1048284147 8:133128635-133128657 GAAAGCTACCTGCCCAAGATGGG - Intronic
1053223561 9:36331898-36331920 CAAAGCTGCCTGGCATAAGCTGG + Intergenic
1054952381 9:70867054-70867076 CAGAGCTGGCTCCCAGAGACAGG + Intronic
1055268762 9:74531303-74531325 CAAAGCTGCCTACCAACAATGGG + Intronic
1056496169 9:87157564-87157586 CAAGCCTGCCAGCCAAAGAAAGG - Exonic
1059110201 9:111550446-111550468 CACAGCTGCCTGCCATGGAGTGG + Intronic
1059876791 9:118644197-118644219 CAATTCTGCCTGCCTAACACAGG + Intergenic
1186846599 X:13536835-13536857 CAAAGCTGCCTTCAAAATGCTGG - Intergenic
1187297428 X:18015392-18015414 CAAAGCTTTCGGCCAAAGCCAGG + Intergenic
1188113559 X:26218847-26218869 TAATGCTGCTTGCCTAAGACAGG + Intergenic
1191196795 X:57732445-57732467 CAAAGCTACCTCCCATAGTCTGG - Intergenic
1191615959 X:63169273-63169295 CAGAGCTGCCTGCTCAGGACTGG + Intergenic
1191620339 X:63209650-63209672 CAGAGCTGCCTGCTCAGGACTGG - Intergenic
1192769949 X:74178508-74178530 TAATGCTGCCTGCTTAAGACAGG - Intergenic
1195819264 X:108925666-108925688 CAAAGCTGGTCCCCAAAGACGGG + Intergenic
1197704325 X:129622984-129623006 CACAGCTGCCTGCCAGAACCTGG - Intergenic
1197882268 X:131179212-131179234 CAGCACTGCCTCCCAAAGACTGG + Intergenic
1199642643 X:149878866-149878888 CAAAACTGCCTGCCTTAGAACGG - Intergenic
1199655495 X:149990871-149990893 GCAAACTGCCTCCCAAAGACAGG - Intergenic