ID: 917200207

View in Genome Browser
Species Human (GRCh38)
Location 1:172506836-172506858
Sequence ATCTGGTTATTTAGGTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917200203_917200207 17 Left 917200203 1:172506796-172506818 CCTAAGGTGGAGAGAGATGGTCT No data
Right 917200207 1:172506836-172506858 ATCTGGTTATTTAGGTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917200207 Original CRISPR ATCTGGTTATTTAGGTCAGA AGG Intergenic
No off target data available for this crispr