ID: 917200374

View in Genome Browser
Species Human (GRCh38)
Location 1:172508362-172508384
Sequence TCACATCTTAGCTGAAGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917200370_917200374 23 Left 917200370 1:172508316-172508338 CCCTAAAAAAACAAATGCATTTG No data
Right 917200374 1:172508362-172508384 TCACATCTTAGCTGAAGCCCGGG No data
917200371_917200374 22 Left 917200371 1:172508317-172508339 CCTAAAAAAACAAATGCATTTGT No data
Right 917200374 1:172508362-172508384 TCACATCTTAGCTGAAGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917200374 Original CRISPR TCACATCTTAGCTGAAGCCC GGG Intergenic
No off target data available for this crispr