ID: 917200715

View in Genome Browser
Species Human (GRCh38)
Location 1:172511723-172511745
Sequence GTGGAGTAAAGGACTATAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917200715_917200724 15 Left 917200715 1:172511723-172511745 CCCCTTATAGTCCTTTACTCCAC No data
Right 917200724 1:172511761-172511783 CACACAAGACCTGGCTTTCTTGG No data
917200715_917200726 29 Left 917200715 1:172511723-172511745 CCCCTTATAGTCCTTTACTCCAC No data
Right 917200726 1:172511775-172511797 CTTTCTTGGTGAGAACCCTGTGG No data
917200715_917200722 6 Left 917200715 1:172511723-172511745 CCCCTTATAGTCCTTTACTCCAC No data
Right 917200722 1:172511752-172511774 TTTGGGCACCACACAAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917200715 Original CRISPR GTGGAGTAAAGGACTATAAG GGG (reversed) Intergenic
No off target data available for this crispr