ID: 917200954

View in Genome Browser
Species Human (GRCh38)
Location 1:172514822-172514844
Sequence CATCTGGGTGGTGCACTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917200954_917200963 11 Left 917200954 1:172514822-172514844 CCATCAAGTGCACCACCCAGATG No data
Right 917200963 1:172514856-172514878 TCATCTGATTTGGGGGCCACTGG No data
917200954_917200960 2 Left 917200954 1:172514822-172514844 CCATCAAGTGCACCACCCAGATG No data
Right 917200960 1:172514847-172514869 TAAACTGTCTCATCTGATTTGGG No data
917200954_917200961 3 Left 917200954 1:172514822-172514844 CCATCAAGTGCACCACCCAGATG No data
Right 917200961 1:172514848-172514870 AAACTGTCTCATCTGATTTGGGG No data
917200954_917200962 4 Left 917200954 1:172514822-172514844 CCATCAAGTGCACCACCCAGATG No data
Right 917200962 1:172514849-172514871 AACTGTCTCATCTGATTTGGGGG No data
917200954_917200959 1 Left 917200954 1:172514822-172514844 CCATCAAGTGCACCACCCAGATG No data
Right 917200959 1:172514846-172514868 ATAAACTGTCTCATCTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917200954 Original CRISPR CATCTGGGTGGTGCACTTGA TGG (reversed) Intergenic
No off target data available for this crispr