ID: 917202201

View in Genome Browser
Species Human (GRCh38)
Location 1:172529674-172529696
Sequence AGGTAGTAACTAAATAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917202196_917202201 29 Left 917202196 1:172529622-172529644 CCAGTGCTCTGTTAAGGTAGATT No data
Right 917202201 1:172529674-172529696 AGGTAGTAACTAAATAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917202201 Original CRISPR AGGTAGTAACTAAATAAAGA AGG Intergenic
No off target data available for this crispr