ID: 917210951

View in Genome Browser
Species Human (GRCh38)
Location 1:172631710-172631732
Sequence TATGCAGGAACACAGAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917210949_917210951 -6 Left 917210949 1:172631693-172631715 CCAGGAGCGGGAAGTTTTATGCA No data
Right 917210951 1:172631710-172631732 TATGCAGGAACACAGAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917210951 Original CRISPR TATGCAGGAACACAGAAGAG TGG Intergenic
No off target data available for this crispr