ID: 917211219

View in Genome Browser
Species Human (GRCh38)
Location 1:172633832-172633854
Sequence GGGTTATAGGAGCTGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917211219_917211226 28 Left 917211219 1:172633832-172633854 CCTGGCACCAGCTCCTATAACCC No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917211219 Original CRISPR GGGTTATAGGAGCTGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr