ID: 917211221

View in Genome Browser
Species Human (GRCh38)
Location 1:172633839-172633861
Sequence ATTCCAAGGGTTATAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917211221_917211228 30 Left 917211221 1:172633839-172633861 CCAGCTCCTATAACCCTTGGAAT No data
Right 917211228 1:172633892-172633914 CTAATGATGACTGGTGGCTCCGG No data
917211221_917211227 24 Left 917211221 1:172633839-172633861 CCAGCTCCTATAACCCTTGGAAT No data
Right 917211227 1:172633886-172633908 TGTATGCTAATGATGACTGGTGG No data
917211221_917211226 21 Left 917211221 1:172633839-172633861 CCAGCTCCTATAACCCTTGGAAT No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917211221 Original CRISPR ATTCCAAGGGTTATAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr