ID: 917211222

View in Genome Browser
Species Human (GRCh38)
Location 1:172633845-172633867
Sequence CTGGATATTCCAAGGGTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917211222_917211228 24 Left 917211222 1:172633845-172633867 CCTATAACCCTTGGAATATCCAG No data
Right 917211228 1:172633892-172633914 CTAATGATGACTGGTGGCTCCGG No data
917211222_917211229 25 Left 917211222 1:172633845-172633867 CCTATAACCCTTGGAATATCCAG No data
Right 917211229 1:172633893-172633915 TAATGATGACTGGTGGCTCCGGG No data
917211222_917211226 15 Left 917211222 1:172633845-172633867 CCTATAACCCTTGGAATATCCAG No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data
917211222_917211227 18 Left 917211222 1:172633845-172633867 CCTATAACCCTTGGAATATCCAG No data
Right 917211227 1:172633886-172633908 TGTATGCTAATGATGACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917211222 Original CRISPR CTGGATATTCCAAGGGTTAT AGG (reversed) Intergenic
No off target data available for this crispr