ID: 917211224

View in Genome Browser
Species Human (GRCh38)
Location 1:172633853-172633875
Sequence TTATCACTCTGGATATTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
917211224_917211228 16 Left 917211224 1:172633853-172633875 CCTTGGAATATCCAGAGTGATAA No data
Right 917211228 1:172633892-172633914 CTAATGATGACTGGTGGCTCCGG No data
917211224_917211230 26 Left 917211224 1:172633853-172633875 CCTTGGAATATCCAGAGTGATAA No data
Right 917211230 1:172633902-172633924 CTGGTGGCTCCGGGACACTAAGG No data
917211224_917211226 7 Left 917211224 1:172633853-172633875 CCTTGGAATATCCAGAGTGATAA No data
Right 917211226 1:172633883-172633905 TTTTGTATGCTAATGATGACTGG No data
917211224_917211227 10 Left 917211224 1:172633853-172633875 CCTTGGAATATCCAGAGTGATAA No data
Right 917211227 1:172633886-172633908 TGTATGCTAATGATGACTGGTGG No data
917211224_917211229 17 Left 917211224 1:172633853-172633875 CCTTGGAATATCCAGAGTGATAA No data
Right 917211229 1:172633893-172633915 TAATGATGACTGGTGGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
917211224 Original CRISPR TTATCACTCTGGATATTCCA AGG (reversed) Intergenic
No off target data available for this crispr